ID: 1182490099

View in Genome Browser
Species Human (GRCh38)
Location 22:30665974-30665996
Sequence AGAAAGACCAAAGGTTGTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182490091_1182490099 25 Left 1182490091 22:30665926-30665948 CCAGGGAGGGGCTGGGTGGGGAT No data
Right 1182490099 22:30665974-30665996 AGAAAGACCAAAGGTTGTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182490099 Original CRISPR AGAAAGACCAAAGGTTGTAT AGG Intronic