ID: 1182494756

View in Genome Browser
Species Human (GRCh38)
Location 22:30698119-30698141
Sequence AAACCCACCCTGCTGCTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 189}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182494756 Original CRISPR AAACCCACCCTGCTGCTGTC AGG (reversed) Intronic
902617422 1:17631333-17631355 AGACCCCCCCTGCTAGTGTCAGG - Intronic
904542788 1:31244635-31244657 GAACCCACCATGCTTCTCTCCGG - Intergenic
905254751 1:36673156-36673178 AATTCCTCCCTACTGCTGTCTGG - Intergenic
907321590 1:53606181-53606203 AAGGCCCCTCTGCTGCTGTCTGG + Intronic
908870132 1:68600926-68600948 TAACCCATTCTGCTGCTGTATGG - Intergenic
908945095 1:69486175-69486197 ATCCCCTCCCTGCTTCTGTCAGG + Intergenic
911690710 1:100830732-100830754 CACCCCTCCCTGCTGCTGACAGG + Intergenic
913593461 1:120351516-120351538 AAACACTCCCTCCTGCTATCAGG + Intergenic
914199348 1:145470958-145470980 AAACACTCCCTCCTGCTATCAGG - Intergenic
914304731 1:146406434-146406456 AAACACTCCCTCCTGCTATCAGG + Intergenic
914478463 1:148044091-148044113 AAACACTCCCTCCTGCTATCAGG - Intergenic
914597324 1:149166395-149166417 AAACACTCCCTCCTGCTATCAGG - Intergenic
919262429 1:195214217-195214239 AAATCCAGCATGATGCTGTCAGG - Intergenic
920255527 1:204651850-204651872 AACCCCATCCTCCTGCTGTAGGG + Intronic
920376874 1:205513533-205513555 ATGTCCACCCTGCTGCTCTCTGG - Intronic
920721669 1:208393175-208393197 CAACCCACCCAGCTGCTCACAGG - Intergenic
923082166 1:230668377-230668399 TAGCCAGCCCTGCTGCTGTCTGG + Intronic
923087300 1:230711352-230711374 AAACCAACTCTGCTGATGGCTGG + Intronic
924050289 1:240073631-240073653 AGACCCAACCTGCTGAGGTCGGG - Intronic
924125535 1:240846677-240846699 AAACCAACCCTGGTGCAGTGTGG - Intronic
1063319604 10:5040464-5040486 AATTCCACCCTGCTGATGTGGGG - Intronic
1063874662 10:10461495-10461517 AACCCCATCCTTCTTCTGTCAGG - Intergenic
1064141431 10:12793985-12794007 AAACCCTCCCTACTGCTCTTGGG - Intronic
1066745746 10:38603397-38603419 GAACCCACCCTGCTGGTACCAGG - Intergenic
1067196783 10:44126673-44126695 AGACACAGCCTGCTGCTGCCTGG - Intergenic
1067292771 10:44956430-44956452 ACACCCAGCCTGTTCCTGTCAGG - Intergenic
1067698592 10:48552882-48552904 AAGCCCACCCTTCTGGGGTCAGG + Intronic
1070824750 10:79384618-79384640 AAATCCACCCTGCAGCTCCCTGG + Exonic
1072306340 10:94111242-94111264 AATCCCACCCTGCAGCTGGAAGG - Intronic
1076753965 10:132558405-132558427 CAACACACCATGCAGCTGTCAGG - Intronic
1076876679 10:133219721-133219743 AAAACCTCCCAGCGGCTGTCAGG + Intronic
1077222279 11:1423056-1423078 TAACCCTCCGGGCTGCTGTCTGG - Intronic
1077430467 11:2513607-2513629 ACAGCCACCCGCCTGCTGTCGGG + Intronic
1078473886 11:11613890-11613912 AAGCCCACCATGCTGCCTTCTGG + Intronic
1084498386 11:69519282-69519304 AAAACCACCATGCTGGGGTCAGG + Intergenic
1084543207 11:69800162-69800184 GGACCCACCCTGCTGCTGTGGGG + Intergenic
1085448755 11:76618056-76618078 AATCCCACCCTCCCACTGTCTGG - Intergenic
1088503326 11:110506131-110506153 AGCCCAGCCCTGCTGCTGTCCGG + Intergenic
1088792521 11:113238552-113238574 AAACCCACCCTTTTGCTGCTAGG + Intronic
1088846308 11:113671265-113671287 AATCCCACCTTCCTTCTGTCTGG + Intergenic
1091501639 12:1023423-1023445 AAACCAAACCTGCTGCTGCAGGG - Intronic
1094413109 12:30189207-30189229 AAATCCACTCTGCTTCTGCCTGG + Intergenic
1103516267 12:121510211-121510233 ATCCCCACCCTGCTGCTTCCCGG + Intronic
1105303471 13:19154237-19154259 AGTCCCACCCAGCTGCTGCCTGG - Intergenic
1109267034 13:60213208-60213230 AAACCCTTTCTGCTGTTGTCTGG - Intergenic
1112871762 13:103980214-103980236 AAACCAATCCTTTTGCTGTCAGG + Intergenic
1113347697 13:109496525-109496547 AAACCCACCAGGATGCGGTCAGG - Intergenic
1115401745 14:32969312-32969334 AAACCAACCCTGGTGCGGTGTGG + Intronic
1118644224 14:67821274-67821296 ATACACACCCTGCTGAGGTCTGG - Intronic
1119731661 14:76955171-76955193 AAAGCCTTCCTGCTGCTTTCAGG + Intergenic
1119736396 14:76985490-76985512 AATACCACCCTGCCTCTGTCTGG + Intergenic
1125679478 15:41522015-41522037 GAACCCAGCCTGCTTCTGCCAGG - Intronic
1128589463 15:68882043-68882065 AAACTCACCCTGTGGCTGGCTGG - Intronic
1129032991 15:72631737-72631759 TGACCCACACTGCTGCTGGCCGG + Intergenic
1129216892 15:74105492-74105514 TGACCCACACTGCTGCTGGCCGG - Intronic
1130093432 15:80839540-80839562 AGGCCCACCCTTCTGCTGTGAGG - Intronic
1130515490 15:84622928-84622950 AAACCCACCCTGCTGTGTGCAGG - Exonic
1131527799 15:93166489-93166511 AATCCCACCCTGCTGCTCGCTGG - Intergenic
1132153149 15:99476310-99476332 ACACCCTGCCTGCGGCTGTCAGG + Intergenic
1132276385 15:100568532-100568554 AATCCCACCCTGCCCCTTTCTGG - Exonic
1132338086 15:101061483-101061505 CAACCCTGCCTGCTGCTGGCTGG + Intronic
1132799726 16:1746077-1746099 GAACCCACCCAGCGGCTGCCTGG + Intronic
1133607483 16:7402498-7402520 AAAGACTCCTTGCTGCTGTCAGG + Intronic
1136506823 16:30709792-30709814 AAACCCACCCTGTGGCTTGCAGG + Intronic
1141297395 16:82782800-82782822 AAAGGCAGCCTGCTCCTGTCAGG - Intronic
1142068063 16:88074025-88074047 TAACGCACCCTGCAGTTGTCTGG - Intronic
1143691053 17:8566320-8566342 AAACCAACCCTGATACTGTGTGG - Intronic
1149983939 17:61333045-61333067 AAACCTACACTGCTGCAGCCTGG + Intronic
1151352903 17:73542284-73542306 AAGCTGCCCCTGCTGCTGTCAGG - Intronic
1152092004 17:78252325-78252347 AAACCCACTCAGCTGCTCACCGG - Intergenic
1152271197 17:79325885-79325907 AAACCCACCCGGGAGCTGTCCGG + Intronic
1152724085 17:81936801-81936823 AAGCCCACGCTCATGCTGTCCGG + Exonic
1153844162 18:9033413-9033435 AAGCCCACACTGCAGCTCTCAGG - Intergenic
1155074047 18:22339855-22339877 AAAGCCACCCTGCAGCAGGCTGG + Intergenic
1155455251 18:26005075-26005097 CAGCCCACACTGCAGCTGTCAGG - Intergenic
1156498097 18:37538998-37539020 TGCCCCACCCTGCTGCTCTCAGG + Intronic
1157305367 18:46513124-46513146 AAACCCTCCATGCTGCCTTCAGG - Intronic
1158387655 18:57013270-57013292 TCACCCACCCTCCTGCTGTACGG + Intronic
1160188436 18:76694643-76694665 AAGCCGACCAGGCTGCTGTCTGG - Intergenic
1160832753 19:1111319-1111341 AAACCCACCCGGCAGCTGCTGGG + Intronic
1160898186 19:1412597-1412619 AAGCCCACTCTGGTGCTGCCAGG + Intronic
1161207560 19:3049291-3049313 AAACCCACCCTGCTTTTGGTGGG + Intergenic
1161265979 19:3364950-3364972 AAACCCACTGTGCAGCTGTGGGG - Intronic
1163122710 19:15227609-15227631 ACACCCACATTGCTGCTGTGGGG - Exonic
1163704024 19:18801979-18802001 AAACCCTCCCTGAAGCTGCCAGG - Intergenic
1164018360 19:21273440-21273462 AAAACTAACCTGGTGCTGTCGGG - Intronic
1165744913 19:38224757-38224779 TAACCTGCACTGCTGCTGTCAGG - Intronic
926149424 2:10416342-10416364 AAAGCCCCCCTCCGGCTGTCAGG - Intronic
927276353 2:21265672-21265694 AACCCCACCCTGCACCTCTCTGG + Intergenic
928987934 2:37198530-37198552 AATCCCAGCTCGCTGCTGTCAGG - Intronic
929894131 2:45943797-45943819 CAGCCTCCCCTGCTGCTGTCTGG - Intronic
929924703 2:46198556-46198578 ACCCCCATCCTGGTGCTGTCTGG - Intergenic
934188447 2:89765366-89765388 GAACCCACCCTGCTGGTACCAGG + Intergenic
934308148 2:91842589-91842611 GAACCCACCCTGCTGGTACCAGG - Intergenic
936666481 2:114602803-114602825 AAAACCACCCAGTTGTTGTCTGG - Intronic
937311349 2:120905253-120905275 AAACTCAGCCTACTGCTGTGGGG + Intronic
940319718 2:152363856-152363878 AAACTCAGCCTACTGCAGTCGGG - Intronic
941180000 2:162248067-162248089 AAATACAACCTGCTGCTATCTGG - Intergenic
942567330 2:177280090-177280112 AAGCCAGCCCTGCTGATGTCTGG - Intronic
946167946 2:217876839-217876861 AAACCAACCCTGCTGAAATCTGG + Intronic
947874481 2:233459244-233459266 AACCCCACCCTGCGACTGTCTGG + Intronic
1169510200 20:6255626-6255648 AAACCAACCCTCTTGCTTTCAGG - Intergenic
1171090990 20:22285659-22285681 AAAAGGATCCTGCTGCTGTCAGG + Intergenic
1171148860 20:22809517-22809539 AAACCCACCCACCTGCAGCCTGG + Intergenic
1171167087 20:22981514-22981536 AAACTCACCCTGCTGGCATCTGG - Intergenic
1171190267 20:23153980-23154002 AAACCCACCCTGCTGGCACCTGG - Intergenic
1172046176 20:32081965-32081987 AATCCCACCCTGCTGCTTCCTGG + Intronic
1172810148 20:37641497-37641519 ACACCAGCCCTGCTGATGTCAGG - Intergenic
1175244120 20:57571241-57571263 CAAAACACCCTGCAGCTGTCGGG - Intergenic
1177719624 21:24888489-24888511 AAACCTACCATGATGCTGTTAGG - Intergenic
1178263097 21:31117809-31117831 ACACCGACGCTGCTGGTGTCAGG + Intergenic
1179190352 21:39117614-39117636 GTCCCCACCCTGCTGCTGTTAGG + Intergenic
1179513540 21:41891352-41891374 GAACACACCCTGCTGATGGCTGG - Intronic
1180003265 21:45004664-45004686 ACACCCACCATGCTGCTGCCCGG - Intergenic
1180841726 22:18962062-18962084 ACACCCACCCTGCTGCCTCCAGG - Intergenic
1181059776 22:20276799-20276821 ACACCCACCCTGCTGCCTCCAGG + Intronic
1182494756 22:30698119-30698141 AAACCCACCCTGCTGCTGTCAGG - Intronic
1183272217 22:36869392-36869414 AAAGCCACCCAGCTGGTGACAGG + Intronic
1184401348 22:44276448-44276470 AAGATCACGCTGCTGCTGTCGGG + Intronic
1184453494 22:44596603-44596625 CAACCCAGCCTGCAGCTGCCTGG + Intergenic
951045928 3:18038277-18038299 ACACCCACCCTACTGTTGTAGGG + Intronic
953389386 3:42525767-42525789 CCACCAACCCTGGTGCTGTCAGG - Intronic
954418175 3:50404361-50404383 AGCCCCACCCAGCTGCTGCCAGG + Intronic
956222760 3:66922233-66922255 ACACCCAGGCAGCTGCTGTCTGG + Intergenic
960439670 3:117671309-117671331 CAACCCATCCAGCTGCTGACTGG + Intergenic
961030860 3:123602449-123602471 AAAGCTGTCCTGCTGCTGTCCGG + Intergenic
962263822 3:133931461-133931483 AAACCCCCCATCCTACTGTCTGG - Intergenic
962953650 3:140244268-140244290 AAACCCACCCTCATGCAATCAGG - Intronic
966379198 3:179326210-179326232 AATCCCAGCCTCCTGCTGGCGGG + Intronic
966655909 3:182358577-182358599 AAACCAAACCTGCTGCTCTTTGG + Intergenic
967075129 3:185994925-185994947 AAACCTACCCTGTTGCTCCCAGG - Intergenic
967134926 3:186505039-186505061 CAACCCACCCTCATCCTGTCTGG + Intergenic
968898339 4:3418233-3418255 AAAACCACCCGGCTGGTGTCTGG - Intronic
968925456 4:3544890-3544912 AAACCCATGCTGCTTCTGCCTGG - Intergenic
969664283 4:8548165-8548187 ACACACACCCTGGGGCTGTCTGG + Intergenic
970226271 4:13860514-13860536 AATCACACCCTGCTGCTTACAGG + Intergenic
970474999 4:16413032-16413054 AAGCCCATCCTCCTGCTGTGTGG + Intergenic
970726803 4:19055830-19055852 AAAACCACCTTTCTGCTATCTGG + Intergenic
980847419 4:138340912-138340934 GAAGCCACCCTGCTGCTACCTGG - Intergenic
981816601 4:148837932-148837954 ACATCCACCTTACTGCTGTCTGG - Intergenic
983160929 4:164413295-164413317 AAATCCACCTTGGTGCTGTCTGG - Intergenic
983732094 4:171008190-171008212 ATACCCCACCTGCTGTTGTCAGG - Intergenic
985886454 5:2683905-2683927 CAGCCCTCCCTGCTGCTGCCAGG + Intergenic
988428576 5:31092615-31092637 AAACCCCACATGCTGTTGTCTGG - Intergenic
993296961 5:86153153-86153175 TAACTCAGCCTGCTGCTCTCAGG + Intergenic
994168185 5:96629749-96629771 AAACCCACTGCTCTGCTGTCTGG + Intronic
998668989 5:144332464-144332486 CAACCCTCTCTGCTACTGTCAGG - Intronic
999262346 5:150245663-150245685 AGACGCAGCCTGCAGCTGTCCGG - Intronic
1002709180 5:181184039-181184061 ATACCAATCCTGCTGCGGTCTGG + Intergenic
1002884845 6:1284170-1284192 AAACCCACCTGGCTATTGTCTGG - Intergenic
1005130245 6:22498579-22498601 GAACCCAACCTGCTGCCTTCTGG + Intergenic
1006654100 6:35575663-35575685 ACAGCCCCCCTGCTGCTGCCCGG - Exonic
1007729082 6:43934962-43934984 AAACCCACCCTGAGGCTGTGGGG + Intergenic
1007735259 6:43978323-43978345 GAGCCCTCCCTGCTGCTGTGAGG - Intergenic
1008694364 6:54016815-54016837 AAACCAACCCTGGTGCTGCAGGG - Intronic
1013374744 6:109503731-109503753 ATACCCACCCTGCAGCTGCTGGG + Intronic
1015515387 6:134078204-134078226 AAACCCACACATCTGATGTCAGG - Intergenic
1016495711 6:144659576-144659598 CAACCCAGGCTGCTGGTGTCTGG + Intronic
1016993794 6:149947073-149947095 CACCCCACCCTCCTGCTGTGGGG - Intronic
1017004541 6:150020464-150020486 CACCCCACCCTCCTGCTGTGGGG + Intronic
1018507904 6:164491233-164491255 TGCCCCACCCTGCTGCTGCCTGG + Intergenic
1019304849 7:328476-328498 CAACCCACCCTGCTGCCACCCGG + Intergenic
1019429173 7:990899-990921 AATCCCTCCCAGCTGTTGTCAGG + Intergenic
1020248539 7:6449250-6449272 GAAACCACCCTGCAGCTGGCGGG + Intronic
1021378785 7:19940940-19940962 AAAAACACCCAGCTGCTGCCTGG + Intergenic
1021909077 7:25366186-25366208 AAACCCTATCTGTTGCTGTCTGG - Intergenic
1025254517 7:57374553-57374575 CCACTCTCCCTGCTGCTGTCTGG - Intergenic
1025262381 7:57427384-57427406 GACCCCAGCCTGCTGATGTCGGG - Intergenic
1029244837 7:99191523-99191545 AAAGCCTCCCTGCTGCTAGCAGG + Intronic
1030842960 7:114378742-114378764 AATCACAGCCTTCTGCTGTCTGG + Intronic
1031535888 7:122932406-122932428 ACAGCCACCCTGCTGCTGGGGGG - Intergenic
1031850702 7:126859048-126859070 AAACCAACCCTGCTGCCTTTAGG - Intronic
1032417387 7:131746768-131746790 TAACCCAACAGGCTGCTGTCTGG - Intergenic
1035654213 8:1293300-1293322 GAGCCCAGCCTGCTGCTGCCTGG - Intergenic
1035654240 8:1293399-1293421 GAGCCCAGCCTGCTGCTGCCAGG - Intergenic
1035975538 8:4306736-4306758 AACACTACCCTGCTGCGGTCGGG - Intronic
1037219633 8:16502084-16502106 AAACTCACTCTGCTACTCTCTGG + Intronic
1038155249 8:24983216-24983238 AAATCCACTCTCCTGCTCTCTGG - Intergenic
1038865765 8:31437228-31437250 CACCCCCCTCTGCTGCTGTCAGG - Intergenic
1039550017 8:38436629-38436651 AAACCTACCCTGCTTCTCTAAGG + Intronic
1040412573 8:47169289-47169311 ACTCCCACTCTGCTGGTGTCTGG + Intergenic
1043570599 8:81598770-81598792 AAACCCACCCTTGGGTTGTCAGG + Intergenic
1044086855 8:87953086-87953108 CACCCCAACCTGCTGCTTTCAGG + Intergenic
1047779501 8:128099961-128099983 AAACCCACCCTGCGGCTGGCTGG - Intergenic
1049394663 8:142394302-142394324 CCACCCGCCCTGCTGCTGTGGGG - Intronic
1052029500 9:23612026-23612048 CAACTCACCCTGCAGCTGTTAGG - Intergenic
1053130094 9:35609707-35609729 ACACCCAGCCTGCAGCTGCCTGG + Exonic
1053800347 9:41760072-41760094 AAACCCATGCTGCTTCTGCCTGG - Intergenic
1054144851 9:61554763-61554785 AAACCCATGCTGCTTCTGCCTGG + Intergenic
1054188774 9:61972224-61972246 AAACCCATGCTGCTTCTGCCTGG - Intergenic
1054464543 9:65485720-65485742 AAACCCATGCTGCTTCTGCCTGG + Intergenic
1054649747 9:67616393-67616415 AAACCCATGCTGCTTCTGCCTGG + Intergenic
1056068510 9:82961725-82961747 ATAACCAACCTGCTGCTGTCAGG + Intergenic
1056329868 9:85512252-85512274 AGAGCCACACTGCTGCTGTAAGG + Intergenic
1057308774 9:93928285-93928307 AAACCAACCCTGCTGATACCTGG - Intergenic
1061368096 9:130182900-130182922 AAACCCACACTGCACCTGTGAGG - Intronic
1061798572 9:133102356-133102378 AATCCTACCCTGCTGCTGACTGG - Intronic
1061835344 9:133325066-133325088 AAACCAACCCTGCTGATGTCTGG + Intergenic
1062368238 9:136222354-136222376 CCAGCCACCCTGCTCCTGTCTGG + Intronic
1189327164 X:40119904-40119926 AACCCCACACTCCTGCTATCAGG - Intronic
1191161167 X:57331028-57331050 AAAACCACCCTGCAGATTTCAGG + Intronic
1192487620 X:71543596-71543618 AAACCTACCCTTAGGCTGTCAGG - Intronic
1194665003 X:96667712-96667734 AAACCAACCCTGCTGATGCCTGG - Intergenic
1197481040 X:126986162-126986184 AATCCCACCCAGCAGCTGCCGGG - Intergenic
1199770294 X:150970888-150970910 AAGCCCTCCCTGCTGCTGTAGGG - Intergenic