ID: 1182496515

View in Genome Browser
Species Human (GRCh38)
Location 22:30712195-30712217
Sequence TTGGAGAAGAAAGAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2011
Summary {0: 1, 1: 0, 2: 18, 3: 223, 4: 1769}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182496515_1182496529 27 Left 1182496515 22:30712195-30712217 CCCTCCTCCTCTTTCTTCTCCAA 0: 1
1: 0
2: 18
3: 223
4: 1769
Right 1182496529 22:30712245-30712267 CCTCACCTTTTCCTCCCACCTGG 0: 1
1: 0
2: 5
3: 37
4: 489

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182496515 Original CRISPR TTGGAGAAGAAAGAGGAGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr