ID: 1182505805

View in Genome Browser
Species Human (GRCh38)
Location 22:30781489-30781511
Sequence GTGTGTTTGTGGAGAGACGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 307}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182505801_1182505805 -8 Left 1182505801 22:30781474-30781496 CCCAGCCTGAGGTGTGTGTGTTT 0: 1
1: 0
2: 7
3: 81
4: 490
Right 1182505805 22:30781489-30781511 GTGTGTTTGTGGAGAGACGCAGG 0: 1
1: 0
2: 1
3: 32
4: 307
1182505800_1182505805 -7 Left 1182505800 22:30781473-30781495 CCCCAGCCTGAGGTGTGTGTGTT 0: 1
1: 0
2: 3
3: 34
4: 260
Right 1182505805 22:30781489-30781511 GTGTGTTTGTGGAGAGACGCAGG 0: 1
1: 0
2: 1
3: 32
4: 307
1182505798_1182505805 6 Left 1182505798 22:30781460-30781482 CCTGTGGCTCAGGCCCCAGCCTG 0: 1
1: 0
2: 4
3: 62
4: 481
Right 1182505805 22:30781489-30781511 GTGTGTTTGTGGAGAGACGCAGG 0: 1
1: 0
2: 1
3: 32
4: 307
1182505795_1182505805 26 Left 1182505795 22:30781440-30781462 CCACACACTGAGTCATTTGTCCT No data
Right 1182505805 22:30781489-30781511 GTGTGTTTGTGGAGAGACGCAGG 0: 1
1: 0
2: 1
3: 32
4: 307
1182505802_1182505805 -9 Left 1182505802 22:30781475-30781497 CCAGCCTGAGGTGTGTGTGTTTG 0: 1
1: 0
2: 8
3: 62
4: 575
Right 1182505805 22:30781489-30781511 GTGTGTTTGTGGAGAGACGCAGG 0: 1
1: 0
2: 1
3: 32
4: 307

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182505805 Original CRISPR GTGTGTTTGTGGAGAGACGC AGG Intronic
900177432 1:1297149-1297171 GTGTGTGTGTGCACAGGCGCGGG + Intronic
900177444 1:1297195-1297217 GTGTGTGTGTGCACAGGCGCGGG + Intronic
900177471 1:1297283-1297305 GTGTGTGTGTGCACAGGCGCGGG + Intronic
900177510 1:1297421-1297443 GTGTGTGTGTGCACAGGCGCGGG + Intronic
900177537 1:1297509-1297531 GTGTGTGTGTGCACAGGCGCGGG + Intronic
900177576 1:1297647-1297669 GTGTGTGTGTGCACAGGCGCGGG + Intronic
900177603 1:1297733-1297755 GTGTGTGTGTGCACAGGCGCGGG + Intronic
900500692 1:3003112-3003134 GTGAGTTGGGGGAGAGACGTTGG + Intergenic
901029831 1:6300633-6300655 CTGTGTTTGTGGAGAGAGGCCGG - Intronic
901029873 1:6300817-6300839 CTGTGTTTGTGGAGAGGGACCGG - Intronic
901526745 1:9827879-9827901 GGGTGTTTGTGGAGCGGAGCCGG + Intergenic
902173460 1:14631496-14631518 GAGTGGTGGTGTAGAGACGCAGG + Intronic
902721691 1:18308434-18308456 GTGTGTGTGTGGAGGGGCTCTGG - Intronic
902819137 1:18932939-18932961 GGGTGTTTCTGGAGACACCCAGG + Intronic
904075626 1:27839884-27839906 GTATTTTTTTGTAGAGACGCGGG - Intronic
904093139 1:27959031-27959053 GTTTGTTTTTGGAGAGAGTCTGG - Exonic
904402163 1:30263957-30263979 GTGGGTTTGGAGAGAGATGCGGG - Intergenic
905119750 1:35672602-35672624 GTGTGTTTGAGGGGGGACTCAGG - Intergenic
906688807 1:47779340-47779362 GTGTGTGTGGGGAGAGGGGCTGG + Intronic
906729300 1:48067355-48067377 GTGTGCTTGAGGAGTGGCGCTGG + Intergenic
907853713 1:58281041-58281063 GTGTGTTTGGGGAGAAAGACAGG + Intronic
908928909 1:69292163-69292185 GTGTGTGTGTGTAGGGAAGCTGG + Intergenic
909204455 1:72737719-72737741 GTGTGTTTGTGAATAGACCATGG + Intergenic
909567055 1:77064389-77064411 GTGTTTTTGTGTTGAGAGGCTGG - Exonic
910122984 1:83810783-83810805 GTGTGTATGTGCAGAGATGGGGG - Intergenic
910853274 1:91669636-91669658 GTGTGTTTGTGGAGTGAGCGTGG - Intergenic
911440828 1:97923211-97923233 GTGTGGTTGTAGGGAGATGCAGG - Intergenic
913547902 1:119887600-119887622 ATGTGTTTGTGAAGAGAAGAAGG - Intergenic
914834220 1:151194028-151194050 GGGTGTTAGGGGAGAGATGCTGG - Intronic
914983683 1:152438765-152438787 GTGTGTTTGGGGAGAGGTGGAGG + Intergenic
915091780 1:153431190-153431212 GTGTGTGTGTGCACAGATGCAGG - Intergenic
917653683 1:177104482-177104504 ATGTGTTTGTGCTGTGACGCAGG + Intronic
918039960 1:180907984-180908006 GTGTGTGTGTGGAGTGAAGCAGG + Intergenic
920723833 1:208415149-208415171 GTGTGTGTGTGCAGAGTCGGGGG - Intergenic
920766069 1:208835130-208835152 CTGTGTGTGTGGGGAGAGGCAGG - Intergenic
921709526 1:218359763-218359785 GTTTGTTTGTGTGGAGAGGCTGG + Intronic
922850343 1:228727949-228727971 GTGTGTTTGGGGAGGGAAGTTGG + Intergenic
923374497 1:233347048-233347070 GTGTGTGTGTGTAGAGGAGCGGG + Intronic
924060986 1:240174050-240174072 GGGAGTTGGTGGAGAGAAGCAGG - Intronic
1063863728 10:10341443-10341465 GTGTTTATGAGGAGAGATGCAGG + Intergenic
1063955338 10:11260240-11260262 ATGTGTTAGCGGAGAGACCCCGG + Intronic
1064861756 10:19834371-19834393 GTGTGTCTGTGAAGAGACAGGGG + Intronic
1065347891 10:24766124-24766146 GTGTGTTTTGGGAGGGACCCAGG - Intergenic
1068088230 10:52401074-52401096 GTGTGTGTGTGTATAGAGGCAGG - Intergenic
1068721063 10:60246846-60246868 GGGTGTGTGTGGGGAGAAGCAGG - Intronic
1069319167 10:67146089-67146111 GTGTGTGTGTGGAGGGGTGCTGG - Intronic
1069746334 10:70717274-70717296 GTGGGGTTGTGGAGAGAGGAGGG + Intronic
1072256030 10:93621135-93621157 GTGTGTGTGGGGAGAGTGGCGGG - Intronic
1072628729 10:97131269-97131291 GTGTGTGTGGTGAGAGATGCCGG - Intronic
1072759007 10:98040566-98040588 GTGTGTGTGTGTAGAGATGGGGG - Intergenic
1072812938 10:98477691-98477713 TTCTGTTTGTTGAGAGACACTGG + Intronic
1073305399 10:102499985-102500007 GTGTGTGTGTGGAGAGAAGTGGG + Intronic
1074986611 10:118665139-118665161 GTGTGTCTCTGGAGAGACCTCGG + Intergenic
1075005010 10:118823809-118823831 CTGTGTTTATGGAGAGGGGCTGG + Intergenic
1076144681 10:128108069-128108091 GTCTGACTGTGGAGAGTCGCAGG + Exonic
1076835957 10:133021017-133021039 GTGTGTGTTTGGGGAGAAGCTGG + Intergenic
1077965088 11:7121809-7121831 GTGTGTGTGTGGATAAAGGCAGG + Intergenic
1079868532 11:25765453-25765475 GTGTGTGTGTGGGGAGAGGGGGG + Intergenic
1081602413 11:44504416-44504438 GTGTGTGTGTGGAGAGAGTATGG - Intergenic
1082020144 11:47525906-47525928 GTTTGTTTGTGGATAGAGACGGG - Intronic
1084556426 11:69878860-69878882 GTGTGTTGGTGGAGTGAGGATGG - Intergenic
1085148703 11:74229361-74229383 GTGTGTTTCTGGAGACCCACTGG - Intronic
1085214880 11:74820615-74820637 GTGTGTTTGGGGAGGGATTCAGG + Intronic
1085518861 11:77126635-77126657 GTGTGGTGGTGGGGAGAAGCAGG + Intergenic
1085567551 11:77528115-77528137 ATGTGTTTGTGGGGATAGGCTGG - Intronic
1085717515 11:78885916-78885938 GTTTGTTTGTGTAGAGATGGGGG - Intronic
1086596851 11:88582864-88582886 ATGTGATTGTGGAGAGAGACAGG + Intronic
1086861561 11:91930799-91930821 GTGTCTATGTGGAGAGAGGTCGG + Intergenic
1087045852 11:93843283-93843305 GTGTGTTGCTGGAGAGAAACAGG - Intronic
1087083746 11:94196666-94196688 GTGGGTCTGTGGAGAGGCCCAGG - Intergenic
1088627768 11:111744023-111744045 CTGTGTAAGTGGAGAGAAGCGGG + Intronic
1088678799 11:112221893-112221915 CTGTTTTAGTGGAGAGAGGCAGG + Intronic
1090153202 11:124406782-124406804 GTGTGTGTGTGGTGAGAAGGAGG - Intergenic
1090408269 11:126490533-126490555 CTGTGTTTGTGGTGAGACCTGGG + Intronic
1090740492 11:129654995-129655017 GTCTGTTTGTGGAGTCACACTGG - Intergenic
1091227606 11:133966930-133966952 GTGTGTTTGTGGAAACACGTGGG - Intergenic
1092783928 12:12011112-12011134 GTGTGTGTGTGTAGAAACGCTGG + Intergenic
1093930065 12:24947156-24947178 GTGTGTGTGTGGAGGGAAGACGG - Intronic
1094177694 12:27558580-27558602 GTGTGTTGGTGGAGAGGTGGGGG - Intronic
1094536465 12:31325907-31325929 GTGTGTATGTGGAAGGACGGGGG + Intronic
1095173217 12:39059722-39059744 GTTTGTTTATGGAAAGAAGCAGG - Intergenic
1096583264 12:52601833-52601855 GTGTGTGTCTGGGGAGACGGAGG + Intergenic
1096616061 12:52834231-52834253 GTATGTTTGCCGAGAGACGGAGG + Exonic
1096835480 12:54348079-54348101 GGGTGTTTGTGAATAGATGCGGG - Intronic
1097272261 12:57783284-57783306 GTGTGTGTGTGGAGGGGTGCAGG + Intronic
1098015774 12:66103202-66103224 GAGTGCTTGTGGAGAGAAGAAGG + Intergenic
1098139370 12:67436033-67436055 GTGTGCTTCTGGACAGAGGCAGG + Intergenic
1100014028 12:89987234-89987256 GTGTGGGTATGGAGAGACGAAGG + Intergenic
1100304852 12:93340953-93340975 GTGTGTGTGTGTAGAGATGGGGG + Intergenic
1101518505 12:105459936-105459958 GCGTGTTTGTGGAGAGGCCCAGG + Intergenic
1101923386 12:108951369-108951391 ATGTTTTCGTGGAGAGACACGGG + Intronic
1102122173 12:110450172-110450194 GTGTGTGTGCCGAGAGAAGCGGG - Intronic
1104192451 12:126495593-126495615 GTGTGTGTGTGCATAGACACTGG + Intergenic
1105600974 13:21886489-21886511 GTCTGAGTGTTGAGAGACGCTGG + Intergenic
1105607315 13:21936898-21936920 GTGTGTGTGTGTAGAGAAGGTGG + Intergenic
1106600646 13:31183652-31183674 GTTTTTTTTTGGAGAGACGGGGG - Intergenic
1106700372 13:32222343-32222365 GTGGATTTGTGGAGAGCCGCTGG + Intronic
1107634999 13:42383119-42383141 GTTTGTTTGTTGAGAAACTCAGG + Intergenic
1107794055 13:44031719-44031741 GTGTGTGTGAGCAGAGAGGCAGG - Intergenic
1107982927 13:45750649-45750671 CTGTGCTTGTGGAGAGACAGAGG + Intergenic
1107994021 13:45843050-45843072 GTGTGTGTGTGTAGAAACTCAGG + Intronic
1108465737 13:50713857-50713879 GTGTGTCTGAGGAGGGAGGCAGG - Intronic
1108776562 13:53772136-53772158 GTGTGTTGTGGGAGAGACCCTGG - Intergenic
1110363492 13:74655856-74655878 GTGTGCTTGTGGACAGAAGAGGG + Intergenic
1112873488 13:104005012-104005034 GTGGGTTTGAGGAGATCCGCGGG - Intergenic
1113873997 13:113583338-113583360 GTGTGTATGTGGACACACGGAGG - Intergenic
1113932270 13:113974680-113974702 GTGTGGGTGGGGAGAGGCGCTGG - Intergenic
1117340862 14:54790009-54790031 GTGTGTGTGTGGAGCAAGGCTGG - Exonic
1117755104 14:58966649-58966671 ATGTGTTTGAGGAGAGACAAAGG + Intergenic
1122796041 14:104206775-104206797 GTGTGTGTGTGAAGGGAAGCAGG + Intergenic
1126782225 15:52148705-52148727 GTGTTTTTGTGGGGAAACACAGG + Intronic
1127061836 15:55194793-55194815 GTGTGTGTGTGTAGAGACAGAGG - Intronic
1128342530 15:66832357-66832379 GTGTGTGTGTGGTGAGAGGCAGG + Intergenic
1131345898 15:91647812-91647834 GTGTGTTTGTGGAAAGGAGAAGG + Intergenic
1131904949 15:97133107-97133129 GTGTGTGTTTGGAGAGATGGTGG + Intergenic
1132556554 16:575241-575263 CTGTGATTGTGGAGAGAAGCAGG - Intronic
1132930022 16:2454342-2454364 GTGCGTGTGTGGAGTGACACAGG - Intronic
1136110210 16:28059786-28059808 TTCTGTTTGTGGAAGGACGCGGG + Intronic
1137253686 16:46758255-46758277 GTGTGTGTGTGGAGAGAGAGAGG - Intronic
1137944547 16:52721207-52721229 GTGTGTGTGTTGAGAGGCACAGG - Intergenic
1138919266 16:61507179-61507201 GTGTGTTTGTGGATAGAGCAGGG + Intergenic
1139515538 16:67450419-67450441 GTGTGTGTGTGGAGTGTTGCAGG - Intronic
1139647867 16:68344923-68344945 GTGTGTGTGTGTAGAGATGCAGG - Intronic
1140132429 16:72175302-72175324 GTGTGGTTTTGGAGAGAGGAAGG + Intronic
1140909048 16:79435235-79435257 GTGTGTGTGTGCACAGTCGCAGG - Intergenic
1142103587 16:88289850-88289872 GTATGTTTGTGGAGTGAGGAGGG + Intergenic
1142425764 16:90001493-90001515 GGGTGTTTGTGGAGAGACTGTGG + Intergenic
1143362295 17:6382060-6382082 GTGCCTTTGTGGAGAGATTCTGG + Intergenic
1143964258 17:10745351-10745373 GTGTATGTGTGGACAGAAGCAGG - Intergenic
1144725736 17:17501447-17501469 TTGTGTCTGTGGGGAGACCCAGG + Intergenic
1146491132 17:33283163-33283185 GTGTGCCTGGGGAGAGATGCTGG - Intronic
1148928176 17:51106092-51106114 GTGTGTGTGTGTAGAGATGGGGG - Intronic
1149684698 17:58528701-58528723 GTGGATTTGTGCAGAGAGGCAGG - Intronic
1151534913 17:74733632-74733654 GTGTGTCTGGGGAGAGACACAGG + Intronic
1152231778 17:79117522-79117544 GTGTGGGTGTGGAGGGAAGCGGG - Intronic
1152261722 17:79270762-79270784 GTGTGTTTGTGGATTAAAGCAGG - Intronic
1152532125 17:80924789-80924811 GTGTGCTTGTGGAGTGAGGCTGG - Intronic
1153946042 18:10018327-10018349 GTGTGATTGTGAAGGGATGCTGG + Intergenic
1155204712 18:23548490-23548512 GTGTGTGTGTGGAGTGGCTCTGG - Intronic
1156129396 18:33952130-33952152 ATGTGTTTGTGGTGGGAAGCTGG + Intronic
1157469358 18:47976701-47976723 GTGTGTGTGTGGAGGGGCGGGGG + Intergenic
1159556374 18:69949568-69949590 GTGTGTGTGTGAAGGGACACAGG - Intronic
1159937192 18:74378614-74378636 GTCTGCATGTGGAGAGAAGCTGG - Intergenic
1160354225 18:78213389-78213411 GTGGGTATGTGAAGAGACACAGG - Intergenic
1161088726 19:2347343-2347365 GTGTGTGTGTGGAGAGAGAACGG - Intronic
1161088756 19:2347750-2347772 GTGTGTGTGTGGAGAGAGAACGG - Intronic
1161088762 19:2347834-2347856 GTGTGTGTGTGGAGAGAGAACGG - Intronic
1161088787 19:2348196-2348218 GTGTGTGTGTGGAGAGAGAACGG - Intronic
1161088903 19:2350225-2350247 GTGTGTGTGTGGAGAGAGAACGG - Intronic
1161088907 19:2350315-2350337 GTGTGTGTGTGGAGAGAGAACGG - Intronic
1161088911 19:2350407-2350429 GTGTGTGTGTGGAGAGAGAACGG - Intronic
1162144661 19:8606233-8606255 TTGTTTTTTTGGAGAGACGGGGG + Intronic
1163020049 19:14477006-14477028 GGGTGTTGGTGGACAGACCCGGG - Intergenic
1163447179 19:17353530-17353552 GTGTGTTTGAGGGAAGAGGCCGG - Intronic
1165490869 19:36121895-36121917 GAGTGTTTGTGGAGGGAAGTGGG + Intronic
1165996070 19:39845111-39845133 GTGTTTGTGTGGAGAGATGGGGG - Intronic
1166303472 19:41924828-41924850 CGGTGTTTCTGGAGAGAAGCAGG + Intronic
1166485283 19:43206750-43206772 GTGTGCTTGTGGGGAGAAGGGGG - Intronic
1166915343 19:46191658-46191680 GCATGTTTTTGGAGAGCCGCAGG + Intergenic
1168116624 19:54224471-54224493 CTGTGTGTGTGGACAGGCGCTGG + Intronic
1168119607 19:54244254-54244276 CTGTGTGTGTGGACAGGCGCTGG + Intronic
1168126101 19:54284053-54284075 CTGTGTTTGTGGACAGACCCTGG + Intergenic
1168168613 19:54572171-54572193 CTGTGTGTGTGGACAGGCGCTGG - Intergenic
1168175835 19:54627024-54627046 CTGTGTTTGTGGACAGACCCTGG - Intronic
1168184981 19:54694893-54694915 CTGTGTGTGTGGACAGGCGCTGG - Intronic
925363238 2:3294372-3294394 GGGTGTGTGTGGAGAGAGGATGG - Intronic
925363255 2:3294440-3294462 GTGTGTGTTTGGAGAGAGGATGG - Intronic
925363290 2:3294605-3294627 GGGTGTGTGTGGAGAGAGGATGG - Intronic
925363298 2:3294638-3294660 GTGTGTGTTTGGAGAGAGGATGG - Intronic
925363325 2:3294769-3294791 GTGTGTATGTAGAGAGAGGATGG - Intronic
925363362 2:3294935-3294957 GTGTGTGTGTGTAGAGAGGATGG - Intronic
925363369 2:3294974-3294996 GTGTGTGTGTGTAGAGAGGATGG - Intronic
925363413 2:3295220-3295242 GTGTATGTGTGGAGAGAGGACGG - Intronic
925363421 2:3295255-3295277 GGGTGTGTGTGGAGAGAGGACGG - Intronic
925363429 2:3295288-3295310 GGGTGTGTGTGGAGAGAGGACGG - Intronic
925363437 2:3295321-3295343 GTGTGTGTGTGTAGAGAGGATGG - Intronic
925363456 2:3295420-3295442 GTGTGTGTGTGCAGAGAGGATGG - Intronic
925363477 2:3295521-3295543 GGGTGTGTGTGGAGAGACGATGG - Intronic
925363484 2:3295554-3295576 GTGTGTGTGTGGAGAGAGGATGG - Intronic
925363602 2:3296128-3296150 GTGTGTGTGTGCAGAGAGGATGG - Intronic
925363642 2:3296303-3296325 GTGTGTGTGTGTAGAGAGGATGG - Intronic
925363670 2:3296447-3296469 GTGTGTGTGTGGAGAGAGGATGG - Intronic
925728199 2:6894941-6894963 GTGAGTTTGTTGAGGGATGCTGG - Intronic
927681329 2:25141412-25141434 ATGTGTTTGTGGAGAGGCCCAGG + Exonic
930045165 2:47164331-47164353 GTGTGTTTTAGTAGAGACGGGGG - Intronic
932410165 2:71542764-71542786 GTGTCTGTGTGGAGAGAAGTGGG - Intronic
933947970 2:87304022-87304044 GTGTGTGTGTGAAGAGACACAGG + Intergenic
936143604 2:109963344-109963366 GTGGGTCTGTGGAGAGGCGAAGG + Intergenic
936180287 2:110261307-110261329 GTGGGTCTGTGGAGAGGCGAAGG + Intergenic
936201084 2:110408122-110408144 GTGGGTCTGTGGAGAGGCGAAGG - Intronic
936332228 2:111557572-111557594 GTGTGTGTGTGAAGAGACACAGG - Intergenic
937092447 2:119215564-119215586 GTGTGTTTTTGTAGAGATGGGGG + Intergenic
937260446 2:120582739-120582761 GTGTGTTTGTGGATGGTGGCTGG - Intergenic
937862827 2:126724398-126724420 GTGTGTTTGTGGAGGAAAGGAGG - Intergenic
939095340 2:137827424-137827446 GGTTGTGTGTGGAGAGACACTGG + Intergenic
939417761 2:141923478-141923500 GTGTGTGTGTAGAGAGAGGGAGG + Intronic
939721505 2:145658525-145658547 GTGTGTGTGTGTAGAGATGGGGG + Intergenic
940079402 2:149783226-149783248 GTGTGTGTGTGGTGAGTCGCTGG - Intergenic
940209117 2:151238277-151238299 GTGCGTGTGTGGAGAGAGGTGGG - Intergenic
941818340 2:169820899-169820921 GTGTGTGTGTGGGTAGAGGCAGG + Intronic
943745657 2:191460355-191460377 GTGTGTGTGTGGAGGGATGGTGG - Intergenic
943862996 2:192893011-192893033 GTGTTTCTGTGGAGAGACTCAGG + Intergenic
945125300 2:206502948-206502970 TTGTGGTTGTGGAGAGCCACGGG - Intronic
945957368 2:216098822-216098844 GTGTGTGTGTGGATAGGCGTGGG + Intronic
946444333 2:219725519-219725541 GTGAGTTTGGGGAGACAGGCAGG - Intergenic
946889897 2:224264443-224264465 GTGTGTTTGGGGAGAGGAGCTGG + Intergenic
947468854 2:230381701-230381723 GTGTGTGTGTGTAGAGAGACAGG - Intronic
948276804 2:236715189-236715211 GTGTGGTTGTGGTTAGAGGCTGG + Intergenic
949061397 2:241960020-241960042 TGGTGTTTGTGGAGAAAAGCTGG - Intergenic
1168961250 20:1871492-1871514 GTGTGTGTGTGGAGAGGGGGTGG - Intergenic
1169221735 20:3827164-3827186 GAGTGTTTGTGGAGGTACACTGG - Exonic
1171135511 20:22691360-22691382 GTTTTTTTGTGCAGAGTCGCTGG - Intergenic
1175911670 20:62407984-62408006 GTATCTTTGTGGAGGGACTCAGG + Intergenic
1178890203 21:36514651-36514673 GTGTGTGTGTGTAGAGAGACAGG + Intronic
1179030693 21:37717377-37717399 GTGGGTGTGTGGAGGGAGGCAGG + Intronic
1180002267 21:45000630-45000652 GAGTGAATGTGGAGAGATGCTGG + Intergenic
1180948913 22:19712016-19712038 ATGTGTCTGTGGAGGGACTCGGG + Intergenic
1182505805 22:30781489-30781511 GTGTGTTTGTGGAGAGACGCAGG + Intronic
1183186672 22:36295412-36295434 GTGTGTGTGTGCAGAGGCCCGGG + Intronic
949096094 3:87577-87599 TTGTGTGTGTGGGGGGACGCGGG + Intergenic
949918620 3:8984604-8984626 GTGTTTGTGTGTAGAGACGGGGG - Exonic
951259106 3:20485370-20485392 GTGTGTATGTGGGGAGAGGGGGG + Intergenic
952810657 3:37399608-37399630 GAGTCTTTGTGGACAGAGGCAGG + Exonic
953671303 3:44964435-44964457 GCGTGTCTGTGGACAGATGCAGG + Intronic
953699598 3:45185556-45185578 GTGTGTGTGTGGAAGGAAGCTGG + Intergenic
954060476 3:48062101-48062123 GTGTCTGTGTGGAGAGAAGTGGG + Intronic
958801023 3:98756028-98756050 GTGTATGTGTGGAGAGAAGCTGG + Intronic
960044063 3:113179351-113179373 GTGTGTGTGTGTAGAGGCACTGG - Intergenic
960476047 3:118129940-118129962 ATGTGTTTGGGCAGAGACTCAGG - Intergenic
964327552 3:155563606-155563628 GTGTGTTTGTGGAGGGAGAAGGG - Intronic
965529481 3:169756918-169756940 ATGTGTTTTGGGAGAGACCCAGG - Intergenic
966206574 3:177412599-177412621 GTGTCTGTGTGGAGAGAAGTGGG - Intergenic
968015760 3:195331227-195331249 GTGTGTGTGTGTTGAGACGGGGG - Intronic
969136603 4:5034287-5034309 GTGTGTTTGGTGAGAAAGGCAGG - Intergenic
971372778 4:26031674-26031696 GTGTGTGTGTGTAGGGAGGCAGG + Intergenic
971846214 4:31922154-31922176 GTGTGTTTGTGGTGGGGAGCAGG - Intergenic
973012076 4:45089001-45089023 GTGTGTTTGTGTAGAGGTGTGGG - Intergenic
973148200 4:46856382-46856404 GTGAATTTGTGGAGTGAAGCAGG - Intronic
974381038 4:61140187-61140209 GTGGGCTTGGGGAGAGATGCAGG - Intergenic
980501368 4:133658587-133658609 GTGTGTGTGTACAGAGATGCTGG - Intergenic
980693309 4:136323703-136323725 ATGTGTGTGTGGAGAGAGGGAGG + Intergenic
982230376 4:153203384-153203406 GTGTGTGTGTGTAGAGATGTGGG - Intronic
983063467 4:163183993-163184015 GTGTGTCTGAGGAGGGAAGCAGG - Intergenic
984965249 4:185134216-185134238 GTGTGTGTGTGTAGAGACAGGGG + Intergenic
985186045 4:187317220-187317242 GTGTGTTTGAGGAGAAATACAGG + Intergenic
986170902 5:5313775-5313797 GTGTGTTTGCGTACACACGCAGG - Intronic
988508678 5:31846750-31846772 TTGTGTTTGTGGAGAGCTGGTGG + Intronic
988636883 5:32994543-32994565 GTGTGTGTGTGTAGAGAGGGAGG - Intergenic
988986828 5:36628398-36628420 GTGGGTTGGTGGGGAGAAGCGGG - Intronic
990321060 5:54630339-54630361 GTGTGCATGTGCAGAGATGCAGG + Intergenic
990323835 5:54655195-54655217 GTGTGTTTGTGGACTGAGTCGGG + Intergenic
991326194 5:65436209-65436231 GTGTGTGTGTGTAGAGATGGGGG - Intronic
991416351 5:66396783-66396805 GTGTCTTTGTGGCGGGACGAAGG + Intergenic
992810773 5:80386296-80386318 GTGTGGTGGTGGAGAGGGGCAGG + Intergenic
993134875 5:83947395-83947417 GTGTGTGTGTGCAGAGGTGCTGG + Intronic
994465494 5:100123854-100123876 GTGTCTTTTTGGAGATAGGCTGG - Intergenic
996702069 5:126460253-126460275 GTGCCTTTGTGGAGAGAAACTGG + Intronic
996866853 5:128133727-128133749 GTGTGTTTTTGGACAGCAGCAGG + Intronic
998538341 5:142955126-142955148 GTGTGTGTGTGCAGAGATGGGGG - Intronic
999268799 5:150284471-150284493 GTGTGCTTGTGGAGGGAGGTGGG + Intronic
1000260664 5:159585333-159585355 GTGTGTATGTGGAGTGTTGCTGG + Intergenic
1000571817 5:162924191-162924213 GTGTGTTTGTGGAGGGAAGGAGG + Intergenic
1000714561 5:164624517-164624539 GTGTGTGTGTGGAGAGGTGTTGG - Intergenic
1000795892 5:165663912-165663934 GTGTGTGTGTGGAGGGGTGCTGG + Intergenic
1001295752 5:170497766-170497788 GTGTGTGTGTGGTGAGGCGGGGG - Intronic
1001820438 5:174705956-174705978 GGGTATGTGTGGAGAGAGGCAGG - Intergenic
1002851853 6:1003643-1003665 GTGTGGATGTGGAGAGAGGTGGG - Intergenic
1002923664 6:1592305-1592327 GTGTGTGTGTGGAGAGGGGTAGG - Intergenic
1003116708 6:3288265-3288287 GGGTGTTTGGGGAGAGAAGGGGG - Intronic
1005588083 6:27296355-27296377 GTTTGGTTTTGGAGAGAGGCGGG + Intronic
1007960199 6:45951872-45951894 GTGTGTTTGGGGAGGGACATGGG - Intronic
1010364942 6:75040240-75040262 GTGTGTTTGTGGGGGGATGAAGG - Intergenic
1012541118 6:100363046-100363068 GTGTGTGTGGGGAGAGGGGCAGG - Intergenic
1013413595 6:109904699-109904721 GAGTGTTTGGGTAGAGAAGCAGG - Intergenic
1015367239 6:132409882-132409904 GTGTGTGTGTGGAGAGAGACAGG - Intergenic
1017090300 6:150753301-150753323 GTGTGTGTGTTGGGAGAGGCAGG + Intronic
1019067609 6:169315480-169315502 GTGTGTGTGTGGACAGAGGCAGG - Intergenic
1019067645 6:169315798-169315820 GTGTGTGTGTGGACAGAGGCAGG - Intergenic
1019067653 6:169315885-169315907 GAGTGTGTGTGGACAGAGGCGGG - Intergenic
1019135844 6:169907198-169907220 GTGTGTGTGTGCAGGTACGCAGG - Intergenic
1019291869 7:254435-254457 ATTTGTTTGTGGAGAAACTCTGG - Intronic
1019548073 7:1587961-1587983 GTGTGGATGTGGGTAGACGCTGG - Intergenic
1021575769 7:22104409-22104431 GTGTGTGTGTGTATAGAGGCAGG + Intergenic
1022751714 7:33234688-33234710 GTGTGTGTGTGGATAGATGGAGG - Intronic
1023343986 7:39252355-39252377 GTGTGTTTGTGTGGTGACTCTGG - Intronic
1026823543 7:73566347-73566369 GTGTGTTTGTGTATAGACAGGGG + Intergenic
1028239761 7:88405238-88405260 GTGTGTTTGGGGAGAGTTGGGGG - Intergenic
1029638449 7:101802173-101802195 GTGTGTGTGTGTAGAGACAGGGG - Intergenic
1031664926 7:124472301-124472323 GTGTGTGTGTAGTGAGACGGAGG + Intergenic
1033181331 7:139182088-139182110 GTGTGTGTGTGGAGGGGCGGGGG + Intronic
1034428084 7:151025121-151025143 GTGTGTGTGTGGAGGGAAGTGGG - Intergenic
1035201667 7:157271594-157271616 GTGCGTACGTGGAGTGACGCTGG - Intergenic
1035285234 7:157801820-157801842 GTGTGTTTTGGGGGAGACACAGG - Intronic
1035296791 7:157872034-157872056 GGGTGTGTGTGGGGAGGCGCTGG - Intronic
1035296804 7:157872106-157872128 GGGTGTGTGTGGGGAGGCGCTGG - Intronic
1035894906 8:3388861-3388883 GTGTGTATGTAGAGAGAGGGAGG - Intronic
1036461329 8:8955586-8955608 GTGTGTTAGAGAAGAGACACTGG + Intergenic
1037659520 8:20914983-20915005 GTTTGTGTGTGGAGAGAGGAGGG - Intergenic
1039225127 8:35379757-35379779 GTGTGTATGAGGAGAGACAAAGG + Intronic
1039520529 8:38167235-38167257 GTGTGTTTGTGCAGAGAAAGAGG - Intronic
1039752464 8:40490996-40491018 GTGTGTGTGTGTAGAGATGGGGG + Intergenic
1040505835 8:48046771-48046793 GTGTGTGTGTGTAGAGATGGGGG + Intronic
1040598449 8:48862031-48862053 GTGTGTGTCTTGAGAGATGCTGG + Intergenic
1040818074 8:51529772-51529794 GTGTGGTTGTGGGGAGAGACTGG - Intronic
1041725887 8:61017066-61017088 CTGTCTTTTTGGAGAGAAGCAGG - Intergenic
1041905419 8:63027768-63027790 GCGTGTTTCTGAAGAGACTCGGG - Intronic
1042654210 8:71077769-71077791 GTGTGTTTGTGAGGAGAAGGAGG + Intergenic
1043158990 8:76822002-76822024 GTGTGTATGTGGAGAGACAGGGG - Intronic
1044931981 8:97259968-97259990 ATGTGGTTGGGGTGAGACGCGGG + Intergenic
1044982176 8:97727744-97727766 GTATGTATGTGGAGACAGGCTGG - Exonic
1048638338 8:136324637-136324659 GTGTGTGTGTGGAGAGACAGAGG - Intergenic
1049194132 8:141306375-141306397 ATGTGTTTCTAGAGAGAGGCTGG - Intronic
1052167666 9:25352946-25352968 GTGTGTTTGTGGAGAGTTAGGGG - Intergenic
1055273598 9:74589354-74589376 GTGTGTTGGGGGAGAGAGGTGGG - Intronic
1055392552 9:75838556-75838578 GTGAGTTTGTGGGGAGATGATGG - Intergenic
1056753837 9:89370412-89370434 GTGTGTTTGTGGTGTGTGGCTGG + Intronic
1056936947 9:90922549-90922571 GTGTGCATGTGCAGAGACACAGG - Intergenic
1060197286 9:121631930-121631952 GTTGGTGTGTGGAGAGACGATGG + Intronic
1061405288 9:130390428-130390450 GTGTCTTTGTGTTGAGAGGCTGG + Intronic
1061587368 9:131577728-131577750 GAGTGTGTGTGTAGAGTCGCTGG - Exonic
1061855716 9:133440942-133440964 GTGGGTTTGTGGGGAGATGAAGG + Intronic
1062202146 9:135309237-135309259 GTCTGTTTGTGGACAGCCACTGG - Intergenic
1062653681 9:137590974-137590996 GGGTGTTTCTGGAGAGACAGCGG + Intergenic
1185545164 X:937745-937767 GTGTGTGTGTGCAGAGATGGGGG - Intergenic
1185579623 X:1201346-1201368 GTGTGTGTGTGTAGAGAGACAGG + Intronic
1185776523 X:2807304-2807326 GTGTGCATGTGGATAGATGCAGG + Intronic
1186672280 X:11780040-11780062 GTGTGTGTGTGTAGAGATGAGGG - Intergenic
1187797954 X:23024923-23024945 GTGTGTGTGTGTAGAGATGGGGG - Intergenic
1189621076 X:42838469-42838491 GTGTGTTTGTTGGGGGTCGCGGG - Intergenic
1190625988 X:52339110-52339132 GTGTGTTTGTGGAGTTACGGGGG + Intergenic
1192423483 X:71054424-71054446 GTGTGTGTGTGTAGAGATGGGGG - Intergenic
1193248429 X:79258957-79258979 GTGTCTTTGTGGAGAGAGGTAGG + Intergenic
1196150490 X:112368238-112368260 GTGTGTTAGTGAAGAGAAGGTGG + Intergenic
1197712860 X:129684560-129684582 GTGTGTGTGTAGAGAGAGACGGG + Intergenic
1197783140 X:130176274-130176296 GTGTGTGTGTGTAGAGAGGGAGG + Intronic
1197901142 X:131373676-131373698 GTGTGTGTGTGGAGAGAGAGGGG + Intronic
1199457919 X:148050201-148050223 GTGTGTTTGGGGAAAGATGTTGG - Intergenic
1201293455 Y:12444170-12444192 GTGTGCATGTGGATAGATGCAGG - Intergenic
1201468358 Y:14309508-14309530 GTGGGTTGGTGGGGAGACTCAGG - Intergenic
1202059481 Y:20871424-20871446 GTTTGTTTAAGGAGAGACTCAGG + Intergenic
1202197612 Y:22310314-22310336 GTGTGTGTGTGAATAGACACGGG - Intronic