ID: 1182510809

View in Genome Browser
Species Human (GRCh38)
Location 22:30818863-30818885
Sequence CAGAGCAACCAGTTTGATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 142}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182510807_1182510809 15 Left 1182510807 22:30818825-30818847 CCATAGACATGGGAGGAAAGCAA 0: 1
1: 0
2: 2
3: 26
4: 256
Right 1182510809 22:30818863-30818885 CAGAGCAACCAGTTTGATGTGGG 0: 1
1: 0
2: 0
3: 6
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182510809 Original CRISPR CAGAGCAACCAGTTTGATGT GGG Intronic
905546957 1:38807618-38807640 CAGAGCAACCCCATCGATGTGGG + Intergenic
907187020 1:52617318-52617340 CACAGCAAGCAGTTTGGTGTTGG - Intergenic
910407456 1:86904343-86904365 CATAGCAATCTGTTTTATGTAGG - Intronic
910494896 1:87815808-87815830 CAGAGCTCACAGTTTGATGAGGG - Intergenic
910895584 1:92066215-92066237 CAGAAAAAGCAGTTGGATGTGGG + Intergenic
917576136 1:176323629-176323651 CAGAGCATTCAGTTTGAGGGTGG - Intergenic
918822431 1:189271615-189271637 GAGAGGAAGCAGTTAGATGTTGG - Intergenic
1064467790 10:15602076-15602098 CAGAACATCCAGTTTACTGTTGG - Intronic
1064913520 10:20429865-20429887 CAGAGCACACAGTTTTAGGTGGG + Intergenic
1067170317 10:43900530-43900552 CAGAGCAAGCAATTTGACTTGGG + Intergenic
1071443371 10:85724057-85724079 CATAGCAATCACTTTAATGTAGG + Intronic
1071928611 10:90440230-90440252 CAGAGTAAGAAGTTTGATTTTGG + Intergenic
1073213337 10:101822214-101822236 CTGAGCAACTAGATGGATGTTGG + Intergenic
1076121767 10:127941901-127941923 CAGAGCCACCAGTGAGAAGTTGG + Intronic
1076624583 10:131813756-131813778 CAGAGAAACCAGTTTTATCCTGG - Intergenic
1077805210 11:5584048-5584070 CAGAACAACCATTATGATGTCGG - Intronic
1077840360 11:5967878-5967900 CAGAGCTACCAGTTTGTTATAGG - Exonic
1077939651 11:6827175-6827197 CAGAGCAAGGATTTTAATGTAGG + Intergenic
1078400659 11:11023590-11023612 CAGTGTAACCAGTTTGCTGCTGG - Intergenic
1081047874 11:38298144-38298166 CATTGCCACCAATTTGATGTGGG - Intergenic
1084236892 11:67793583-67793605 CTGAGCAGCCAGGTAGATGTGGG - Intergenic
1085265240 11:75234037-75234059 CAGAGCAAGCAGATCGATATAGG + Intergenic
1086205698 11:84255667-84255689 CTGAGTCACCAGTTTGATTTAGG - Intronic
1092407775 12:8232893-8232915 CTGAGCAGCCAGGTAGATGTGGG - Intergenic
1100786530 12:98084547-98084569 CAGGTCAACCACTTTGATTTTGG - Intergenic
1101236451 12:102794748-102794770 CAGAGCAAACAGAGTTATGTGGG - Intergenic
1102760891 12:115383990-115384012 TGGTGCAACCAGTTTGTTGTAGG - Intergenic
1107064404 13:36197116-36197138 CAGAGCCTACAGTTTGATTTTGG - Intronic
1112208924 13:97353906-97353928 CAGAGCTACCACTTTAAAGTAGG - Intronic
1113577502 13:111404595-111404617 CTGAGGAACCCCTTTGATGTTGG + Intergenic
1114824516 14:26060671-26060693 CAGAGCCACCAGTTGGAAATAGG + Intergenic
1116694856 14:48160259-48160281 AAGGGCAGCCAGTTTGCTGTAGG + Intergenic
1118610309 14:67534135-67534157 CAGTCCAAACAGTTTGATGAAGG - Intronic
1121850107 14:97213842-97213864 CAGAGCAGACAGATTTATGTGGG + Intergenic
1124805560 15:32878417-32878439 CAGAGAAACCTGCTTGATATGGG + Intronic
1125111331 15:36038381-36038403 CACCGCAACCAATTTGCTGTTGG - Intergenic
1125133408 15:36311820-36311842 CAGAGCTACAATTTGGATGTAGG + Intergenic
1125343434 15:38696503-38696525 CAGAGCCACCAATTTGCTGATGG - Intergenic
1125919715 15:43518242-43518264 CAGACCAACCGGTTTGCAGTGGG + Intronic
1129081516 15:73045218-73045240 CTGAGTAACTAGTTTGAAGTGGG + Intergenic
1130853821 15:87823283-87823305 AAAAGCAACCAGTTTGAGGACGG + Intergenic
1133737039 16:8623769-8623791 CACAGCAACCACTTAAATGTAGG + Intronic
1134872407 16:17663832-17663854 CAGAGCTAGCAGATTGAGGTGGG + Intergenic
1136712393 16:32250244-32250266 CAGAGCCACCAGTTTCTGGTGGG + Intergenic
1136755522 16:32679185-32679207 CAGAGCCACCAGTTTCTGGTGGG - Intergenic
1136812591 16:33191185-33191207 CAGAGCCACCAGTTTCTGGTGGG + Intergenic
1136819067 16:33301265-33301287 CAGAGCCACCAGTTTCTGGTGGG + Intronic
1136825630 16:33357800-33357822 CAGAGCCACCAGTTTCTGGTGGG + Intergenic
1136830696 16:33456571-33456593 CAGAGCCACCAGTTTCTGGTGGG + Intergenic
1137029706 16:35510362-35510384 CAGAGCCATCAGTTTGTGGTGGG + Intergenic
1141337998 16:83175531-83175553 CAGAGCCTCCAGTTTGCTTTGGG + Intronic
1141722522 16:85764598-85764620 CAGTGGAACTATTTTGATGTAGG + Intergenic
1202991168 16_KI270728v1_random:14155-14177 CAGAGCCACCAGTTTCTGGTGGG + Intergenic
1203057664 16_KI270728v1_random:939524-939546 CAGAGCCACCAGTTTCTGGTGGG - Intergenic
1143216050 17:5225809-5225831 GAGAGCAACCAGCTTCAAGTTGG - Intronic
1150008223 17:61482823-61482845 CAGAGCACCCTGTTGGATGCTGG - Intronic
1150525148 17:65915218-65915240 CTGAGCAACCAGGTGGATGGTGG - Intronic
1157055770 18:44226779-44226801 CAAAGCAAACTGTTAGATGTTGG + Intergenic
1157164136 18:45342585-45342607 CAGAGCAACCAGATGAATGCAGG + Intronic
1159096561 18:63908625-63908647 AAGAGCACCTAGTATGATGTGGG - Intronic
1160806277 19:993574-993596 CAGAGGAACCAGTTACATGGAGG - Intronic
1165052503 19:33150958-33150980 CAGAGCTGCCAGTCTGATGGAGG - Intronic
1166212201 19:41314046-41314068 GGGAGCACCCAGTCTGATGTGGG - Intronic
1166545439 19:43632143-43632165 CTGAGCAACCAGGTGGATGGTGG - Intronic
925284965 2:2709785-2709807 CAGAGCAGGCAGCTGGATGTGGG + Intergenic
927144833 2:20156536-20156558 CAGATCAACCAGTTTTGTCTGGG - Intergenic
935520501 2:104098130-104098152 CACAGCAACCTGTTTCTTGTAGG - Intergenic
937484506 2:122300621-122300643 CAGAACAATCAGTCTGAGGTGGG - Intergenic
941476476 2:165956632-165956654 CAGACCAATCAGTAGGATGTGGG - Intergenic
946413016 2:219524866-219524888 CAGTGCAGCCATTTTGATCTTGG - Intronic
948939311 2:241188149-241188171 CAGAGCCAGCAGTGTGATCTGGG + Intergenic
1172741656 20:37173125-37173147 CAGTGCAATCAGTGTGATGGGGG - Intronic
1173689898 20:44952571-44952593 CAGAACAACCATTTTCATTTTGG + Intronic
1182200685 22:28566164-28566186 CAGAGAAACCAGTTCCATTTAGG + Intronic
1182510809 22:30818863-30818885 CAGAGCAACCAGTTTGATGTGGG + Intronic
1184469856 22:44690295-44690317 CTGAGCACCCAGTCTGATGGAGG + Intronic
951848448 3:27111026-27111048 CAGAGCTACCAGTGTGCTGCTGG - Intronic
953872697 3:46641207-46641229 CGAAGCAACCATTTTGATTTTGG - Intergenic
954818575 3:53304407-53304429 CAGAGCAAACATTTTGAGGTTGG - Intronic
955618633 3:60836759-60836781 CAAAGCAATCACTTTGATTTTGG + Intronic
956380041 3:68655490-68655512 CAGATAAGCCAGTGTGATGTAGG - Intergenic
957052845 3:75423347-75423369 CTGAGCAGCCAGGTAGATGTGGG - Intergenic
957636268 3:82790395-82790417 CCGAGCACCCACTGTGATGTTGG + Intergenic
961302003 3:125928181-125928203 CGGAGCAGCCAGGTAGATGTGGG + Intergenic
961861496 3:129919942-129919964 CACAGGAAACAGTTTGATGCAGG + Intergenic
964765016 3:160171230-160171252 CAGAGAGACCATTTAGATGTGGG + Intergenic
967330370 3:188284043-188284065 AAGTGCAACCAGTTTGGTGGAGG - Intronic
969818318 4:9702588-9702610 CTGAGCAGCCAGGTAGATGTGGG + Intergenic
970345578 4:15149428-15149450 CAGAGCAGGCAGTCTGATGCGGG - Intergenic
973767583 4:54177301-54177323 GAGATCAACCAGGTTGAAGTTGG + Intronic
973768435 4:54185208-54185230 CAGTGCAATCAGTTTGAGTTTGG - Intronic
975348211 4:73318418-73318440 CAGGGCATCCATTTTGCTGTGGG - Intergenic
977570773 4:98627040-98627062 GAGAGCAACCAGCTTGGGGTAGG + Intronic
977770640 4:100854108-100854130 CAAAGCAACCAGTTTAAATTTGG - Intronic
979307975 4:119169877-119169899 CAGAGCGGGCAGTTTGATTTAGG - Intronic
979782369 4:124669147-124669169 CAGAGCAACCAGGTTTTTCTTGG - Exonic
981265749 4:142781356-142781378 CAGTACAACCAGTGGGATGTGGG - Intronic
982692965 4:158568719-158568741 CAGAGCACATAGTTTGATGAAGG - Intronic
983818391 4:172161498-172161520 CAGAGAAACCATTTTGCTGATGG + Intronic
984041799 4:174744238-174744260 CTGAGCAGCCAGTGTGGTGTGGG - Intronic
986083901 5:4423353-4423375 AATAGCAACGAGTTTGCTGTTGG + Intergenic
986650195 5:9955746-9955768 CAAAGCATCCAGTTTGCTCTGGG + Intergenic
989848441 5:46176365-46176387 CTGAGAAACCACTTTGTTGTGGG - Intergenic
990153964 5:52853159-52853181 CAGAGCAACCAAAAAGATGTGGG + Intronic
990529289 5:56657774-56657796 CAGAGTAAACAGTTTCAGGTTGG + Intergenic
993361519 5:86982256-86982278 TAGAGCAACTAGTTAGCTGTAGG + Intergenic
994373729 5:98994994-98995016 CAGAGCATCCAGTTTGCAGATGG + Intergenic
999118281 5:149184315-149184337 CAGAGCAGCCATTCTAATGTTGG + Intronic
1000463197 5:161547294-161547316 CTGAGCAACCCGTTGGATTTGGG + Intronic
1002314824 5:178336784-178336806 CAGAGCAATCTGTTTCATCTTGG + Intronic
1003659610 6:8047893-8047915 CAGAGTAACCAAGTTGTTGTTGG - Intronic
1003748660 6:9031272-9031294 TATAGCAACCAATTTGATCTGGG - Intergenic
1007142362 6:39588704-39588726 TTGAGCAACCGGGTTGATGTTGG - Intronic
1007229239 6:40336868-40336890 CAGAGCAACCAGAAGGATGGGGG + Intergenic
1007323620 6:41044001-41044023 CAGGGCAGCCAGTTTGTTGATGG - Exonic
1007544182 6:42679500-42679522 CATTGGGACCAGTTTGATGTAGG + Intronic
1012316412 6:97786366-97786388 CAGATACACCATTTTGATGTTGG - Intergenic
1012737104 6:102962260-102962282 CAGAGCAAAAAGTTTTATTTAGG - Intergenic
1014896961 6:126913176-126913198 CATAGCAACCAATTTGGTGTTGG - Intergenic
1016667591 6:146660079-146660101 TACAACAGCCAGTTTGATGTTGG - Intronic
1016811294 6:148263534-148263556 CAGGGCAACCATTCTGATGGAGG + Intergenic
1018684622 6:166294357-166294379 CAGAGCAACCAGTTGGGGTTTGG - Intergenic
1019834443 7:3368469-3368491 CAGAGCAATCAGTATGGAGTAGG + Intronic
1020291231 7:6723841-6723863 GAGAGCAAACTGTTTGTTGTAGG - Intergenic
1020319919 7:6932070-6932092 CTGAGCAGCCAGGTAGATGTGGG - Intergenic
1020718280 7:11707145-11707167 CAAAGCAACCACTTTCAAGTAGG + Intronic
1023499772 7:40835166-40835188 CAGAGCCACCAGCCTCATGTGGG - Intronic
1023572220 7:41583955-41583977 CAGAGCAGGCAGTTTTCTGTAGG + Intergenic
1026907238 7:74069417-74069439 CAGGTCAACCAGGTTGATGGTGG - Intronic
1028220638 7:88192177-88192199 CAGTGTAACCAGTTCAATGTGGG + Intronic
1028867031 7:95725361-95725383 CAGAGCAACAAGGCTGATGATGG - Intergenic
1031033956 7:116766851-116766873 CAAAGCCACCAGTTTAATTTTGG + Intronic
1031555141 7:123166057-123166079 AGGAGCAACTAGTTTGATCTGGG - Intronic
1032407349 7:131666238-131666260 CATAGCAACCATCCTGATGTTGG + Intergenic
1034897243 7:154885529-154885551 CAGAGCAGCCAGTTCCATGCAGG - Intronic
1036161271 8:6390659-6390681 CTGAGCAACCTGGTTGATGATGG - Intergenic
1038024337 8:23575616-23575638 CAGGGCAAGCAGATTGATGGTGG + Intergenic
1040574616 8:48640442-48640464 TAGAGCAACAAGTATGAGGTGGG - Intergenic
1040622420 8:49104951-49104973 CAAAGCAAGCATTTTTATGTAGG + Intergenic
1041280317 8:56202604-56202626 TAGAGAAAGCAGTTTGTTGTGGG - Intronic
1043154093 8:76756423-76756445 CAGAGAGACCAGATTGAGGTTGG + Intronic
1058460447 9:105177627-105177649 TAGACTAAGCAGTTTGATGTAGG + Intergenic
1192388243 X:70696146-70696168 CAGATCAACCAGATAGATATTGG - Intronic
1193191446 X:78575558-78575580 CAGAGTAAACAGTTTTATTTGGG + Intergenic
1195881711 X:109599949-109599971 CAGTGTTAACAGTTTGATGTGGG - Intergenic
1197095680 X:122591878-122591900 AAGAGTAACCATTTTGATATAGG + Intergenic
1198301669 X:135339513-135339535 CAGAGCTACCAGTAGGATGTGGG + Intronic
1199900668 X:152168965-152168987 CAGAGCAACCCCTATGAGGTAGG + Intronic
1200716910 Y:6557073-6557095 CTGGGCAGCTAGTTTGATGTGGG - Intergenic