ID: 1182511764

View in Genome Browser
Species Human (GRCh38)
Location 22:30825054-30825076
Sequence GCTTAGATCTGGGAGCAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182511764_1182511770 -7 Left 1182511764 22:30825054-30825076 CCACCCTGCTCCCAGATCTAAGC No data
Right 1182511770 22:30825070-30825092 TCTAAGCATGTGAGGAGCCCTGG No data
1182511764_1182511772 0 Left 1182511764 22:30825054-30825076 CCACCCTGCTCCCAGATCTAAGC No data
Right 1182511772 22:30825077-30825099 ATGTGAGGAGCCCTGGGCAATGG No data
1182511764_1182511771 -6 Left 1182511764 22:30825054-30825076 CCACCCTGCTCCCAGATCTAAGC No data
Right 1182511771 22:30825071-30825093 CTAAGCATGTGAGGAGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182511764 Original CRISPR GCTTAGATCTGGGAGCAGGG TGG (reversed) Intronic