ID: 1182511984

View in Genome Browser
Species Human (GRCh38)
Location 22:30826404-30826426
Sequence CCAAGTAGGCAGAGGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 526
Summary {0: 1, 1: 0, 2: 3, 3: 40, 4: 482}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182511984_1182511999 22 Left 1182511984 22:30826404-30826426 CCAGCCTCCCTCTGCCTACTTGG 0: 1
1: 0
2: 3
3: 40
4: 482
Right 1182511999 22:30826449-30826471 CATAATAAATTCATCCTTGCAGG 0: 1
1: 0
2: 2
3: 17
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182511984 Original CRISPR CCAAGTAGGCAGAGGGAGGC TGG (reversed) Intronic
900420507 1:2554100-2554122 ACCAGCAGGGAGAGGGAGGCAGG - Intergenic
900532963 1:3163668-3163690 CCAGGGAGCCAGAAGGAGGCCGG - Intronic
900595613 1:3478906-3478928 CCATGTGAGCAGAGGGAGGTGGG + Intronic
900653870 1:3745398-3745420 CTGAGTCGGGAGAGGGAGGCTGG - Intergenic
901221857 1:7587935-7587957 CCATCTGGGCCGAGGGAGGCGGG - Intronic
901315392 1:8304034-8304056 CTGAGTGGACAGAGGGAGGCAGG + Intergenic
901756493 1:11444552-11444574 CCAAGGAGGCAGAGAGAGGAAGG - Intergenic
902514981 1:16985249-16985271 ACAAGTAGTCAGAGTGGGGCCGG - Intergenic
902571327 1:17348806-17348828 GAAAGCAGGGAGAGGGAGGCAGG - Intronic
902748670 1:18490826-18490848 TCAAGAAGGTAGAGGGGGGCAGG - Intergenic
902776122 1:18676171-18676193 CGAAGATGGCAGGGGGAGGCTGG - Intronic
903122822 1:21227389-21227411 CCCTGAAGCCAGAGGGAGGCTGG + Intronic
903144562 1:21362635-21362657 ACCAGTAGCCAGAGTGAGGCTGG + Intergenic
903223307 1:21880920-21880942 TCAGGTAGGCAGAGTGAGGGAGG - Intronic
903541033 1:24096448-24096470 ACGGGTGGGCAGAGGGAGGCAGG + Intronic
903622417 1:24707571-24707593 CCTGGTGGGCAGAGGGAGCCAGG + Intergenic
903737168 1:25537373-25537395 CCAAGGAGGACGAGGGAAGCGGG + Intergenic
903840186 1:26233633-26233655 CCAAGTTTGGGGAGGGAGGCAGG + Intergenic
904208583 1:28871121-28871143 CCAATTAGGGGCAGGGAGGCGGG + Intergenic
904403185 1:30270173-30270195 CCAAGGAGGAAGAGGGTGGAAGG + Intergenic
904784137 1:32973052-32973074 CCAGGGAGGGAAAGGGAGGCTGG - Intergenic
905542094 1:38767939-38767961 CAAGGGAGGCAGAGGGAAGCTGG - Intergenic
905801414 1:40845899-40845921 ACAAGAAGGGAGAGGGAGGGAGG - Intergenic
906194274 1:43920309-43920331 CCAAGTAGGGACAGTGAGGCGGG - Intronic
906291039 1:44619318-44619340 CAAAGAAGCCAGAGGGAGGCTGG + Intronic
906671977 1:47662713-47662735 CAGGGTAGGCAGAGTGAGGCTGG - Intergenic
906747245 1:48230702-48230724 GCAGGTAGGCAGAGGGAAGAGGG + Exonic
907109064 1:51909873-51909895 CCAATCAGGCAGAGCTAGGCAGG - Exonic
912547418 1:110460936-110460958 CCTGGTATCCAGAGGGAGGCCGG + Intergenic
914330613 1:146666877-146666899 CCAAGCACACAGAGGCAGGCAGG + Intergenic
914901559 1:151713932-151713954 CCAGGTATGCCCAGGGAGGCAGG - Intronic
914947094 1:152077544-152077566 GCAGGGAGGCAGAGGCAGGCAGG - Intergenic
915242445 1:154532976-154532998 CCCAGTAGGGAGAGAGAGGGGGG + Intronic
915624676 1:157107335-157107357 ACTACTGGGCAGAGGGAGGCAGG - Intergenic
915971919 1:160361080-160361102 CACAATAGGCAGAGGCAGGCTGG - Intergenic
916811279 1:168307649-168307671 GGAAGAAGGCAGAGGGAGGGAGG - Intronic
916933157 1:169600627-169600649 CCAAGTAAGCAGAGGCAGTGTGG - Intronic
917794766 1:178525305-178525327 CAGAGTAGGCATGGGGAGGCAGG - Intronic
917930699 1:179820745-179820767 CCAAGTAGTACGAGGGAGGAGGG - Intergenic
919737570 1:200962691-200962713 CCAAGCAGGAAGCAGGAGGCTGG + Intergenic
920174603 1:204092697-204092719 CCAAGTAGGCCCAGGAATGCTGG - Intronic
920430807 1:205917697-205917719 CAAAGCAGGCAAAGTGAGGCTGG - Intronic
920748909 1:208655601-208655623 CCAAGTACGGAGAGAGAGGTGGG - Intergenic
920957836 1:210635389-210635411 CTTAGTAGGCTGAGAGAGGCAGG + Intronic
921266117 1:213421868-213421890 CACACTAGGCAGAGGGAGACGGG - Intergenic
922751815 1:228073605-228073627 ACAAGTAGGCCGGGGCAGGCCGG + Intergenic
923201551 1:231717471-231717493 CAGAGTCAGCAGAGGGAGGCGGG - Intronic
923358328 1:233182674-233182696 CCATGTAGGCAAAGGCAGGAGGG - Intronic
923511825 1:234659676-234659698 CCCAGTAGACACAGGGAGGTTGG + Intergenic
924538710 1:244960970-244960992 CCAAGTAGTAAAAGGAAGGCAGG - Intergenic
1063096221 10:2911368-2911390 CCAAGTAGGGAGCGGGAGGCAGG + Intergenic
1063112516 10:3048939-3048961 CTAAGTAAGAAGAGGGAGTCAGG - Intergenic
1063142423 10:3267399-3267421 CCAAGGAGGCCAAGGGAGGGAGG - Intergenic
1063556548 10:7085744-7085766 CCATGCAGGCACAGGCAGGCAGG - Intergenic
1064880511 10:20047651-20047673 CCATGTAAGGAAAGGGAGGCTGG - Intronic
1065853871 10:29814149-29814171 CCAAGTACACAGAGGGAAGGAGG - Intergenic
1066101402 10:32121727-32121749 CCAAGTGGGCAGAATGAGCCCGG - Intergenic
1067237307 10:44461756-44461778 CCACGTAGGCAGAGGAATGGAGG + Intergenic
1067238624 10:44472159-44472181 CAAAGGATGCAGAGAGAGGCCGG - Intergenic
1067781694 10:49212412-49212434 GGGAGTAGGGAGAGGGAGGCAGG - Intergenic
1068830674 10:61491272-61491294 GCAGGGAGGGAGAGGGAGGCAGG + Intergenic
1069082554 10:64103854-64103876 CCAAGCAGGCATAGGGCAGCAGG + Intergenic
1069593833 10:69657722-69657744 CAAAGGTGGCAGATGGAGGCTGG - Intergenic
1070366623 10:75743000-75743022 CCAAGTAGGCAGTGGGGGATGGG + Intronic
1071508775 10:86248361-86248383 CCAAATTGGGAGAGGGAGGGCGG + Intronic
1073096313 10:100982217-100982239 AGCAGCAGGCAGAGGGAGGCTGG + Intronic
1073671743 10:105598441-105598463 CCAAGTGGGCTGGGGGAAGCAGG - Intergenic
1074859035 10:117496281-117496303 CCATGGAGGAAGAGTGAGGCTGG - Intergenic
1075257202 10:120934725-120934747 CAAAGCAGGCAGAGGGAGGGGGG - Intergenic
1075535073 10:123264187-123264209 CCAGGGAGGCTGAGGGGGGCAGG + Intergenic
1075714104 10:124546020-124546042 CCAGCTTGGCAGAGGGAGGGAGG - Intronic
1075910596 10:126122463-126122485 AAAAATAGGCAAAGGGAGGCAGG + Intronic
1075962970 10:126585295-126585317 GCAAGCAAGCAGAGGGAGGAAGG + Intronic
1076858928 10:133130606-133130628 ACAAGGAGGAAGAGGGAGGGAGG - Exonic
1076906547 10:133365180-133365202 CCAGGTGCGCAGATGGAGGCAGG + Intronic
1077117796 11:893185-893207 CCAAGTGGACAGAAGCAGGCTGG - Intronic
1077155486 11:1089148-1089170 CTGGGGAGGCAGAGGGAGGCCGG - Intergenic
1077320591 11:1939149-1939171 CCAGAAAGGCAGAGGCAGGCGGG + Intergenic
1078569033 11:12441730-12441752 CCAAATCTGCTGAGGGAGGCAGG + Intronic
1079457831 11:20651967-20651989 ACAAATAGGCAGAGGTGGGCAGG - Intronic
1079755094 11:24248761-24248783 CCAAGAAGGCAGTGGGATGAGGG + Intergenic
1080240499 11:30121951-30121973 GCAGGTAGGCAGAGAGAGGCCGG - Intergenic
1081703779 11:45168495-45168517 CGGAGGAGGCAGAGGGAGACAGG - Intronic
1081783393 11:45729112-45729134 CTAAGGTGGCATAGGGAGGCTGG + Intergenic
1082637455 11:55613892-55613914 GAAAGGAGGCAGAGGGAGACAGG - Intergenic
1083143411 11:60739896-60739918 CCAAGTGGGCAAGGGAAGGCTGG + Intronic
1083258034 11:61508657-61508679 CCAATGAGGCGGAGGGAGGGCGG - Intergenic
1083712646 11:64558716-64558738 CAAGGTGGGCAGTGGGAGGCAGG - Intronic
1085084163 11:73655761-73655783 CCAAGAAGGAGGAGGGAGGGAGG - Intronic
1085299424 11:75449706-75449728 CCCAGTTGGCAGATGGAGACAGG - Intronic
1085374684 11:76048924-76048946 CCAAGCAGGCATAGGGCAGCAGG + Intronic
1085458798 11:76680895-76680917 CCCAGCAGGGAGAGGGAGGAGGG - Intergenic
1085521724 11:77142998-77143020 ACAAGTAGCCTGAGGCAGGCAGG - Intronic
1088089457 11:106021731-106021753 CAAAGGAGGCAGCGGGAGGGAGG - Exonic
1088110873 11:106259909-106259931 CAAAGCAGCCAAAGGGAGGCAGG + Intergenic
1088979646 11:114850632-114850654 ACAAGGAGGCAGAGGGAACCAGG + Intergenic
1089351263 11:117822823-117822845 CCAAGCAGGCGAGGGGAGGCTGG + Intronic
1089538275 11:119173874-119173896 ACAAGTTGGCACAGGGAGGCTGG - Exonic
1089612890 11:119679446-119679468 CCAGCTAGGCAGAGGGAAGTGGG + Intronic
1090399928 11:126442693-126442715 CAGAGCAGGCAGAGGGAGGGGGG - Intronic
1090425003 11:126601659-126601681 GCAAGTGGGCAGAGGGGGCCAGG - Intronic
1090942000 11:131395068-131395090 CCAAGGTGGCAGTGGGAGCCAGG + Intronic
1091208472 11:133836307-133836329 GCATGCAGGCAAAGGGAGGCTGG + Intergenic
1092149423 12:6236835-6236857 GCAAGAGGGCAGAGGCAGGCGGG - Intronic
1092493947 12:8973024-8973046 CCAGCTGGGCTGAGGGAGGCTGG + Intronic
1092936172 12:13366526-13366548 ACATGTAGGCAGAGGAAGGGAGG - Intergenic
1093550747 12:20407548-20407570 CCAAGTTCCCAGAGGGAGGTTGG + Intronic
1095994536 12:48069212-48069234 CCAAGTAGACAGAGAGAGAAAGG + Intronic
1096771426 12:53938483-53938505 CCAGGGAGGGAGAGGGAGGGGGG - Intergenic
1098342497 12:69467202-69467224 CCTAGTGGGTAGAGGCAGGCGGG + Intergenic
1098904889 12:76151664-76151686 CCTGGGAGGCAGAGGGAGGTTGG + Intergenic
1099341318 12:81438390-81438412 CCCAGCAGGCAGAGAGAGGTTGG + Intronic
1099574409 12:84362169-84362191 CCAAGGAGCCAGCGGGAGACAGG + Intergenic
1100819655 12:98419605-98419627 CCAAGCAGGCATAGGGCAGCAGG + Intergenic
1100820351 12:98423655-98423677 CCAAGCAGGCATAGGGCAGCAGG + Intergenic
1100840450 12:98607464-98607486 GCAAGTTGGCAGAGTGAGGTGGG + Intergenic
1101124481 12:101617204-101617226 CCAAGTAAAGAGAAGGAGGCCGG + Exonic
1101914437 12:108885243-108885265 CTAAGTCTGCAGAGGGAGTCAGG + Intronic
1102036347 12:109772439-109772461 CCAAGGAGGCACAGGTAGTCAGG - Intergenic
1102519339 12:113469045-113469067 CCAAGTAGGGAGTGCCAGGCTGG + Intronic
1102524911 12:113505580-113505602 CCAAGAAGGCAGCAGGAGGCAGG + Intergenic
1102624654 12:114225324-114225346 CCATGCTGGCACAGGGAGGCAGG - Intergenic
1103908016 12:124337112-124337134 CCCAGTGGGCAGTGGGTGGCAGG + Exonic
1104048558 12:125181334-125181356 CCAAGAAGGAAGAGGGAAGAGGG + Intergenic
1104374323 12:128250527-128250549 ACAAGAAGGCAGAGGAAGGGCGG + Intergenic
1105211483 13:18259567-18259589 CCAAGCAGGCAGAGGGCAGGTGG - Intergenic
1106197159 13:27503713-27503735 CCAACTATTCAGAGGAAGGCAGG + Intergenic
1106587163 13:31067598-31067620 CCAGGGAGGCAGAGTGAGGGAGG + Intergenic
1107070133 13:36259788-36259810 CCAAGAAGTCAGAGGCAGGTTGG + Intronic
1108716854 13:53088655-53088677 ACTGGTAGGAAGAGGGAGGCAGG + Intergenic
1110980502 13:81890578-81890600 CCAAGTGGGCAGAATGAGCCCGG + Intergenic
1111861448 13:93712014-93712036 CCAAGTAGCAAGAGTGAGGGAGG - Intronic
1111984015 13:95047230-95047252 CCCAGTTGGCAGAGCCAGGCAGG - Intronic
1112254580 13:97817992-97818014 CCAAGTGGGGATGGGGAGGCAGG + Intergenic
1112477701 13:99747366-99747388 GCAAGGAGGAAGAGGAAGGCGGG - Intronic
1113672092 13:112182439-112182461 GCAATGAGGCAGAGGGAGCCTGG + Intergenic
1114491665 14:23106200-23106222 CCAGGCAGGCCGGGGGAGGCCGG - Intergenic
1114672541 14:24419161-24419183 CCAGGGAGGGAGAGTGAGGCTGG - Exonic
1116165829 14:41332951-41332973 CCATGAAGGCAGCGGGAGGGAGG - Intergenic
1116282709 14:42928960-42928982 CCAAGTGGGCACAGCTAGGCTGG + Intergenic
1116373194 14:44162388-44162410 CCAAGCAGGCACAGGGCAGCAGG + Intergenic
1116464044 14:45211965-45211987 TAAAAGAGGCAGAGGGAGGCTGG - Intronic
1117469261 14:56025415-56025437 CCAAGTAGTTAGTGGGAGCCAGG - Intergenic
1117495163 14:56295315-56295337 CCCAGGCGGGAGAGGGAGGCTGG - Intronic
1118309436 14:64681849-64681871 CCCAAGAGGAAGAGGGAGGCTGG + Intergenic
1118362575 14:65068913-65068935 CAAAGGAGGCAAGGGGAGGCTGG + Intronic
1118751270 14:68809274-68809296 CTAAGAAGGCAGAGTGAGGTGGG + Intergenic
1120036838 14:79707328-79707350 CAAAGTAGGCAAAGGGAGTTAGG + Intronic
1120529537 14:85615204-85615226 CCCAGTGGGCTGAGAGAGGCAGG + Intronic
1121312497 14:92942835-92942857 CCAAGTTGGCTCAGGCAGGCAGG - Intronic
1122043160 14:99004369-99004391 ACAAGTAGGGAGAGAGAGGAAGG - Intergenic
1122289814 14:100674544-100674566 CCAAGTTGCCATAGGCAGGCAGG + Intergenic
1122397533 14:101444166-101444188 CCATGTGGGTAGAGGAAGGCGGG - Intergenic
1122512405 14:102280212-102280234 CAAAGAAGGCAGAGTGAGACAGG + Intronic
1122626890 14:103089524-103089546 CCAGGGAGGCAGAATGAGGCTGG - Intergenic
1122721843 14:103726660-103726682 CCAAGCAGCCTGAGGCAGGCAGG - Intronic
1122954883 14:105065985-105066007 CCATGTAGGAAGAGGGAGGCGGG - Intergenic
1123122873 14:105926281-105926303 CCAGGTGGGCAATGGGAGGCAGG - Intronic
1123405516 15:20017701-20017723 CCAGGTGGGCAATGGGAGGCAGG - Intergenic
1123514848 15:21024349-21024371 CCAGGTGGGCAATGGGAGGCAGG - Intergenic
1124122060 15:26895952-26895974 GCATGGAGGCAGGGGGAGGCTGG - Intronic
1124408186 15:29410585-29410607 TCAGGAAGGCAGAGGGAGGCAGG - Intronic
1125522310 15:40355015-40355037 CCTAGGAGGCAGAAGGAGACTGG + Intronic
1128768475 15:70265303-70265325 CCAGGAAGACAGAGGCAGGCAGG - Intergenic
1129272226 15:74424985-74425007 CCAAGTGGAGGGAGGGAGGCAGG + Intronic
1129705402 15:77791367-77791389 GCAAAGAGGCCGAGGGAGGCGGG + Intronic
1130410602 15:83645141-83645163 GTAAGTAGACAGAGGTAGGCAGG - Intergenic
1130872005 15:87978939-87978961 CCAAGCAGGGAAAGTGAGGCTGG + Intronic
1132083025 15:98883786-98883808 CCAGGGAGGCAGAGGCAGCCCGG - Intronic
1133738984 16:8637563-8637585 CCAAATGGGCAGACTGAGGCTGG + Intronic
1133814087 16:9183206-9183228 CCAGGAAGCCAGAGGGAGTCGGG + Intergenic
1134220635 16:12351100-12351122 CCAATGAGGCAAAGGGAGGTTGG - Intronic
1134385055 16:13763951-13763973 CCAAACAGGCCGAGGAAGGCTGG + Intergenic
1134523643 16:14929199-14929221 ACAGGGAGGCAGAGGGAGGGTGG - Intronic
1134549254 16:15131737-15131759 ACAGGGAGGCAGAGGGAGGGTGG + Intronic
1134711235 16:16327684-16327706 ACAGGGAGGCAGAGGGAGGGTGG - Intergenic
1134719089 16:16370986-16371008 ACAGGGAGGCAGAGGGAGGGTGG - Intergenic
1134850353 16:17473891-17473913 CCAAGTTGTTACAGGGAGGCTGG - Intergenic
1134948338 16:18340899-18340921 ACAGGGAGGCAGAGGGAGGGTGG + Intergenic
1134955594 16:18381009-18381031 ACAGGGAGGCAGAGGGAGGGTGG + Intergenic
1136118152 16:28108806-28108828 CTCAGGAGGCAGATGGAGGCAGG + Intronic
1138234562 16:55371081-55371103 CGAAGTAGGTAGAGGGAAGGAGG - Intergenic
1139094987 16:63694609-63694631 CCAAGTGGGAGGAGGGAGGGAGG + Intergenic
1139614299 16:68079760-68079782 CCAAGTGGGATGAGGAAGGCGGG - Intergenic
1139955481 16:70691140-70691162 ACAAGTTTGCAGAGGGAAGCTGG - Intronic
1140002941 16:71044029-71044051 CCAAGCACACAGAGGCAGGCAGG - Intronic
1140209290 16:72958388-72958410 CCAATGTGGCAGAGGGCGGCAGG - Exonic
1141049529 16:80747850-80747872 CCAGGTGGGCAGAGGTAGGAAGG - Intronic
1142017075 16:87755148-87755170 CCACGTGGGAAGAGGGAGGGTGG + Intronic
1143083156 17:4396431-4396453 CAAAGAAGGCACAAGGAGGCCGG + Intergenic
1143101213 17:4505826-4505848 CCAAGAGGGCAGAGGAAAGCGGG - Intronic
1144107015 17:11995299-11995321 CCAGGGAGGCTGAGTGAGGCAGG + Intronic
1144921559 17:18768360-18768382 CTAAGAAGGCCGATGGAGGCCGG - Intronic
1144950749 17:18992245-18992267 CCAAGGACACAGAGGGAGGTGGG - Intronic
1145260550 17:21352106-21352128 CCAAGTCAGGAGAGGGAGGAGGG + Intergenic
1145266310 17:21381165-21381187 CCAGGTGGGCAGGGGGAGTCAGG - Intronic
1145933112 17:28700072-28700094 TGAAGTAGGTAGAGGGAGGAAGG - Intronic
1146193474 17:30791180-30791202 GCAACTAGGGAGAGTGAGGCAGG - Intronic
1146255233 17:31388490-31388512 CCCACTAAGCAAAGGGAGGCAGG + Intergenic
1146308217 17:31746848-31746870 CCAAGCAGGAAGAAGGGGGCTGG - Intergenic
1146602987 17:34234765-34234787 CCAGGTATGGTGAGGGAGGCTGG - Intergenic
1147505720 17:41015356-41015378 CTAAATAAGCAGAGGGAGGCTGG + Intronic
1147563768 17:41524360-41524382 CCGGGTAGGTAGAGGGAAGCAGG - Exonic
1148099862 17:45082663-45082685 CAAAGTAGGCTGACAGAGGCAGG + Intronic
1150345625 17:64402693-64402715 CCAGAGAGGCAGAGGGAGGCGGG - Intronic
1150621031 17:66807811-66807833 CTGAGAAGGGAGAGGGAGGCGGG + Exonic
1151034738 17:70784955-70784977 CCAAGGAGGCCGAGGGTAGCGGG + Intergenic
1152149223 17:78588711-78588733 CCCAGTAGACAGAGGGAGGTGGG - Intergenic
1152551619 17:81033226-81033248 CCAAGATGACAGATGGAGGCTGG - Intergenic
1153383609 18:4467357-4467379 ACAAGCAGGGAGAGGGAGGGAGG - Intergenic
1155917598 18:31571745-31571767 CTAAGTAGTCAAAGGGAGGGTGG - Intergenic
1157203490 18:45679170-45679192 CCTGCTAGGCAGAGGGAGCCAGG + Intronic
1157561381 18:48648821-48648843 CCAAAAAGCCAGAGTGAGGCTGG + Intronic
1158885538 18:61823676-61823698 CCCAGGTGGCAGAGGCAGGCAGG + Intronic
1158933612 18:62344871-62344893 CCGTGCAGGCAGAGGGAGACTGG + Intronic
1159138370 18:64363321-64363343 CCAAATAGGAAGAGAGGGGCTGG + Intergenic
1159505274 18:69328048-69328070 CCAAGCAGGCACAGTCAGGCTGG - Intergenic
1160749280 19:726386-726408 CCCATCAGGCAGAGCGAGGCCGG - Intronic
1160981225 19:1817487-1817509 CCAAGAAGACACAGGGAGGACGG + Intronic
1161054031 19:2180998-2181020 ACAAGGAGACAGAGGAAGGCAGG - Intronic
1161428271 19:4216399-4216421 CCAGGTAGGGAAAGTGAGGCTGG + Exonic
1161474115 19:4474864-4474886 CCAAGGATGCAGAGGGTGGGGGG - Intronic
1161548424 19:4896605-4896627 CCAAGGAGGAAGAGGGAAGGTGG - Intronic
1161571933 19:5035557-5035579 CCAAGGAGGCAGAGGGAGGGAGG - Intronic
1161781532 19:6296333-6296355 CCTACTCGGGAGAGGGAGGCAGG - Intergenic
1162359577 19:10210460-10210482 CCTGGCAGGCAGAAGGAGGCTGG - Intronic
1162851966 19:13437885-13437907 CCCAGTGGACAGAGGGAGCCAGG + Intronic
1163404192 19:17112403-17112425 GCCAGTGGCCAGAGGGAGGCTGG + Intronic
1163632166 19:18423081-18423103 CAGAGTGGGCTGAGGGAGGCTGG + Intronic
1166044790 19:40223524-40223546 CTCAGGAGGCAGAGGAAGGCGGG + Exonic
1166473072 19:43096920-43096942 CTAAGTAGGCCCAGGAAGGCAGG - Intronic
1167571344 19:50290822-50290844 CCTAGCACACAGAGGGAGGCTGG + Intronic
925083821 2:1091915-1091937 CTAAATAGGCTGAGGGAGCCTGG - Intronic
925182732 2:1827451-1827473 CCTTCTAGGCAGAGGGTGGCGGG - Intronic
927436632 2:23072104-23072126 GAGCGTAGGCAGAGGGAGGCTGG - Intergenic
927865766 2:26586254-26586276 GCAAGGAGGCAGAGTGAGGGCGG - Intronic
928143287 2:28749605-28749627 CAAGTGAGGCAGAGGGAGGCCGG - Intergenic
928679132 2:33680872-33680894 CCAGGAAGGCAGTGGGAGGCAGG + Intergenic
929936671 2:46298404-46298426 CCAAGTGGGCAAAGGGGGGCGGG + Intronic
930034927 2:47079408-47079430 TGAGGTAGGCAGAGGGAAGCGGG + Intronic
930479206 2:51926003-51926025 CCAACTGTGCAGAGGGAGCCTGG + Intergenic
932114618 2:69035144-69035166 GCAAGAAGGCAGCGGGGGGCGGG + Intronic
932125741 2:69144236-69144258 GCCACTGGGCAGAGGGAGGCTGG - Intronic
932246101 2:70197903-70197925 TCAAGGAGGCAGAGGCAGGCCGG - Intronic
932300587 2:70664231-70664253 CCCAGTAGGCAGAGGGAGAGTGG + Intronic
932340485 2:70960165-70960187 CCAAGCAGGCAGGGGCTGGCAGG + Intronic
933211517 2:79575345-79575367 CCAAGGAGGCACAGGGAACCAGG - Intronic
933778371 2:85785483-85785505 CCAAGGAGGGCGAGGGAGCCGGG - Intronic
935676379 2:105598083-105598105 GGAGGCAGGCAGAGGGAGGCAGG - Intergenic
935863389 2:107358853-107358875 ACATGTAGGCACAGGTAGGCAGG - Intergenic
937340689 2:121088773-121088795 CCAGGCAGGCTCAGGGAGGCAGG - Intergenic
937430655 2:121835548-121835570 CCAAGAAGGTAGATGGAGGTGGG - Intergenic
938377957 2:130820753-130820775 CCAAGGAGGCATAGCGGGGCCGG + Intergenic
939178541 2:138779929-138779951 TAAAGTAGGCAGAAGGTGGCCGG - Intronic
941036678 2:160576351-160576373 CAAAGGAGACAGAGGGAGACAGG + Intergenic
942865369 2:180667156-180667178 ACAAGAAGGGAGAGGGAGGATGG + Intergenic
942868176 2:180700179-180700201 CCAGGAAGCCAGAGGGAGCCAGG - Intergenic
942998146 2:182290552-182290574 TCAGGCAAGCAGAGGGAGGCTGG - Intronic
944450165 2:199834459-199834481 CTAAGAAGGAAGAGGGAGGCAGG - Intronic
944878309 2:203985416-203985438 CACAGTAGACACAGGGAGGCAGG - Intergenic
946247210 2:218394713-218394735 CGAAGTAGGCAGGGTGGGGCAGG - Exonic
946394561 2:219436608-219436630 CCAAGTCAGGAGAGGGAGCCGGG + Intronic
947375285 2:229489454-229489476 AAAAGGAGGCAGAGAGAGGCCGG + Intronic
947629754 2:231644520-231644542 CCAAGTAGGAAAAGGAAGCCGGG + Intergenic
947640422 2:231704670-231704692 CTCAGGAGGCTGAGGGAGGCAGG + Intergenic
947729701 2:232421046-232421068 CCAGGTAGCCAGAGGGTCGCAGG - Intergenic
947751653 2:232535712-232535734 GTAGGTAGGAAGAGGGAGGCTGG - Exonic
948046946 2:234952167-234952189 CCAGGTAGGCAGGCGGCGGCGGG + Intronic
948272858 2:236687561-236687583 CCATGCAGGCTGAGGAAGGCAGG - Intergenic
948660931 2:239506018-239506040 TCCAGTAGGCAGTGGGGGGCGGG + Intergenic
948678282 2:239611883-239611905 CCTGGTGGGCAGAAGGAGGCCGG + Intergenic
948755198 2:240155380-240155402 CCAAAAAGTCAGAGGGAGGAGGG - Intergenic
948764937 2:240214782-240214804 CTCACTAGGCAGAGAGAGGCTGG + Intergenic
948887568 2:240891826-240891848 CCAAGTTGGCAGCAGGAGGAGGG - Intronic
1168856487 20:1012843-1012865 CGAGGGAGGCAGAGGGAGGGAGG + Intergenic
1169474872 20:5922506-5922528 AGAAATGGGCAGAGGGAGGCGGG + Exonic
1170601183 20:17842974-17842996 GAAAGCAGGCAGAGGGATGCTGG - Intergenic
1171040090 20:21754878-21754900 CTAAGTAGGCTGAGGTAGGAGGG + Intergenic
1172164299 20:32889548-32889570 CCAAGTAGGCAGGGGGTGGTCGG + Intronic
1172681205 20:36716730-36716752 CCTAGTAGGTAGAGGAAGGCAGG + Intronic
1173132318 20:40405967-40405989 ACAAGTAGGTTGAGAGAGGCAGG + Intergenic
1173347545 20:42214784-42214806 CCATGTACCCAGAGGGAGGAGGG - Intronic
1173524182 20:43719473-43719495 TTAAGATGGCAGAGGGAGGCTGG + Intergenic
1173659020 20:44720192-44720214 CCAAGGAGGTAGAGAGAGGAGGG - Intronic
1174184998 20:48700065-48700087 CTGAGTAGGTAGATGGAGGCAGG - Intronic
1174677175 20:52369738-52369760 GCAACAAGGCAGAGGGAGCCTGG + Intergenic
1175391228 20:58628640-58628662 CCTAGAAGTCAGAGGGATGCAGG - Intergenic
1175472735 20:59243474-59243496 ATAAGTAGACAGAGGGAGGTGGG + Intronic
1175688773 20:61050618-61050640 CCCAGGAGGCAGGGGGAGGCTGG + Intergenic
1176099902 20:63360212-63360234 CCAGGCAGGAAGAGGGAGGAAGG + Intronic
1176385931 21:6138548-6138570 CCAAGCTGGCAGAGCGAGTCCGG + Intergenic
1178077524 21:29025274-29025296 CCGAGTAGGCAGGGGAAGACTGG + Intronic
1178166726 21:29986091-29986113 CCGAGTGGGCAGAGTGAGCCTGG + Intergenic
1179712200 21:43269694-43269716 TCAAGGAGGCAGATGGAGGAAGG - Intergenic
1179737542 21:43399704-43399726 CCAAGCTGGCAGAGCGAGTCCGG - Intergenic
1180116181 21:45706698-45706720 CTAGCCAGGCAGAGGGAGGCAGG + Intronic
1180581565 22:16844179-16844201 CTCTGTAGGCAGAGGGAGGAGGG + Intergenic
1180764742 22:18339871-18339893 CCAAGCAGGCAGAGGGCAGGTGG + Intergenic
1180814287 22:18779813-18779835 CCAAGCAGGCAGAGGGCAGGTGG - Intergenic
1181200473 22:21214148-21214170 CCAAGCAGGCAGAGGGCAGGTGG - Intronic
1182161007 22:28121717-28121739 CCCCATAGGCAGAGGCAGGCAGG - Intronic
1182418978 22:30239490-30239512 CCAAATAGGCAGCGGGAGGAGGG + Intergenic
1182511984 22:30826404-30826426 CCAAGTAGGCAGAGGGAGGCTGG - Intronic
1182519100 22:30875325-30875347 GCCACAAGGCAGAGGGAGGCTGG - Intronic
1183191178 22:36322891-36322913 GCAAGGAGGTAGAGGGAAGCTGG - Intronic
1183275476 22:36894449-36894471 CCAAGTTGGCAGAGGGTACCAGG - Intergenic
1183374771 22:37456876-37456898 CGAAGTAGGAAGGGGGTGGCAGG + Intergenic
1183471122 22:38007290-38007312 TCAAGAAGGCAGAGGGAGAGTGG + Intronic
1183675055 22:39294569-39294591 CCAGGTTGGCATGGGGAGGCTGG + Intergenic
1183733709 22:39631996-39632018 CCAGCTGGGCAGAGTGAGGCGGG + Intronic
1184000757 22:41671653-41671675 CCAAGGTGGCGGGGGGAGGCGGG + Intergenic
1184043458 22:41957968-41957990 CCCCCAAGGCAGAGGGAGGCCGG + Intergenic
1184106736 22:42371745-42371767 CCAGGCAGGAAGAGGGAGGAGGG - Intergenic
1184372093 22:44089137-44089159 CCAGGTAGGAAGAGAGAGACAGG - Intronic
1184678525 22:46056325-46056347 CCAGGTAGGCAGCAGGCGGCAGG - Intronic
1185002497 22:48254420-48254442 CAAAGAAGGAAGAGGGAGGGAGG + Intergenic
1185020169 22:48369879-48369901 CCCAAGAGGCAGAGGGAGACCGG - Intergenic
1185158132 22:49206512-49206534 CGAGGCAGGCAGAGGGAGGGTGG - Intergenic
1185276284 22:49951393-49951415 ACAAGTAGGCAGACAGACGCAGG - Intergenic
1185344249 22:50304486-50304508 CCTGGTAGGCAGAGAAAGGCAGG + Intronic
1203226365 22_KI270731v1_random:80776-80798 CCAAGCAGGCAGAGGGCAGGTGG + Intergenic
1203264386 22_KI270734v1_random:5500-5522 CCAAGCAGGCAGAGGGCAGGTGG - Intergenic
949352530 3:3139048-3139070 CCAAGTAGGGAAAGGGATGAGGG + Intronic
950016953 3:9761104-9761126 CCAAGCAGGAATAGGGAGACGGG - Intronic
950098790 3:10345033-10345055 CCACGAGGGCAGAGGGAGGCAGG - Intronic
950188223 3:10958458-10958480 CCAAGTGGGCTGAGGGGAGCTGG + Intergenic
950491171 3:13305880-13305902 CCAAGTGGGCAGAGCCTGGCAGG + Intergenic
950680495 3:14581826-14581848 CCAAGAAGGCAGTAGCAGGCAGG - Intergenic
950980251 3:17296521-17296543 ACAAGTGGTCAGTGGGAGGCTGG + Intronic
952041843 3:29270097-29270119 CCCTGTAGGCAGAGAGACGCAGG + Intergenic
952130574 3:30356977-30356999 CCAAGTGGGCAAGTGGAGGCAGG - Intergenic
952851771 3:37735279-37735301 ACAAGAAGGAAGAGAGAGGCAGG - Intronic
953173699 3:40530117-40530139 CCAAGTAGCCTGATGGAGGGTGG + Intronic
953377606 3:42441856-42441878 CCAAGCAGCAAGAGGGAGGAAGG + Intergenic
953391955 3:42539138-42539160 CCAAGTAGGGAGTGGGAGGAGGG - Intergenic
954034671 3:47844914-47844936 CCATGTAGGGATTGGGAGGCGGG + Intronic
954670863 3:52290737-52290759 CCAGATAGATAGAGGGAGGCAGG - Intronic
954985371 3:54786002-54786024 CCATGATGGCAGAGGGTGGCTGG - Intronic
955673960 3:61430703-61430725 ATGAGTAGGCAGAGGAAGGCAGG - Intergenic
956793952 3:72701579-72701601 CCAAGGCTGCAGAAGGAGGCTGG - Intergenic
959163013 3:102741884-102741906 CCAAGTAGGCACTGGGCAGCAGG + Intergenic
959565262 3:107826661-107826683 CCAAGGAGACAGGGGAAGGCAGG - Intergenic
959976993 3:112472124-112472146 CAAGGTAGGGGGAGGGAGGCTGG + Intronic
960723263 3:120645308-120645330 CCAAATATGCAGAGGAAGGTGGG - Intronic
960742394 3:120849537-120849559 CCGAGTAGCCAAAAGGAGGCTGG - Intergenic
960997396 3:123349110-123349132 CCAGGTGGGCAGCTGGAGGCTGG - Intronic
961471286 3:127114797-127114819 CCATGCAGGCAGGGAGAGGCAGG - Intergenic
961550598 3:127668625-127668647 CCAGGAGGGCAGTGGGAGGCGGG + Intronic
961812578 3:129530400-129530422 CCGAGAAGGGAGAGGGAGGAAGG + Intronic
962285885 3:134085245-134085267 CCAATGGGGCAGAGGAAGGCAGG - Intronic
962316448 3:134362432-134362454 CCATGTAGCCAGAGGCAGCCTGG - Intronic
962843960 3:139259217-139259239 CCCAGATGGCAGAGAGAGGCTGG - Intronic
963918851 3:150886726-150886748 CCAGGGAAGCAGAGGGAGGAGGG - Intronic
964377278 3:156060620-156060642 GCAGGAAGGCAGAGAGAGGCAGG - Intronic
964494286 3:157271647-157271669 ACCAGTAAGCAGAGGGAGGGAGG - Intronic
964499779 3:157335942-157335964 AACAGCAGGCAGAGGGAGGCTGG - Intronic
964652782 3:159029882-159029904 CCAAGTAGGCAGTTGGATACAGG + Intronic
964858701 3:161175729-161175751 ACAGGAAAGCAGAGGGAGGCTGG + Intronic
965827508 3:172745641-172745663 TCATGCAGACAGAGGGAGGCAGG + Intergenic
967391197 3:188956461-188956483 CCAAGTAGCCAGAGGCCAGCAGG + Intronic
967742144 3:193015202-193015224 CCAAGTTGGCAGAGGAACACAGG + Intergenic
969467434 4:7366136-7366158 CCAAGGAGGAGGAGGGTGGCAGG - Intronic
969485586 4:7470765-7470787 CCCACAAGGCAGTGGGAGGCAGG + Intronic
970550592 4:17177188-17177210 CAAACTGAGCAGAGGGAGGCAGG + Intergenic
970650053 4:18167794-18167816 CCAAGGTGGCAGGGTGAGGCTGG + Intergenic
971198440 4:24491438-24491460 GCCAGTGGGGAGAGGGAGGCAGG - Intergenic
971377916 4:26069865-26069887 CCAGCTAGGCAGAGGTGGGCAGG - Intergenic
972225679 4:37008420-37008442 CCAAGCAGGCATAGGGCAGCAGG - Intergenic
972388009 4:38586517-38586539 AAAAGAAGGAAGAGGGAGGCAGG - Intergenic
972552187 4:40144168-40144190 CCATGTGGGCAGCTGGAGGCTGG - Intronic
974607585 4:64173548-64173570 CCATGGAGCCAGCGGGAGGCAGG + Intergenic
975455379 4:74584382-74584404 AGTAGTAGGCAGAGGGAGGGAGG + Intergenic
975809611 4:78153207-78153229 CAAAGTAGGCAGAGGGTGAGGGG - Intronic
976072212 4:81254439-81254461 ACAGGAAGGGAGAGGGAGGCGGG - Intergenic
977840193 4:101693808-101693830 TCAAATAGCCAGAGGCAGGCAGG + Intronic
978421480 4:108537987-108538009 TCAAGAAAGAAGAGGGAGGCTGG - Intergenic
981662164 4:147180589-147180611 GGAAGTAGGCAGAGGGAGAAAGG - Intergenic
981833593 4:149029521-149029543 CCAAGCAGGCATAGGGCAGCAGG - Intergenic
982415271 4:155123935-155123957 CCAGAAAGGGAGAGGGAGGCAGG - Intergenic
982716505 4:158814479-158814501 GCATGTAGGCAGGGGAAGGCTGG - Intronic
983168271 4:164505774-164505796 CCTAGTAGGCATAGGCAGGTAGG + Intergenic
984833651 4:183999472-183999494 CCCAGTGGCCAGAGGGAGACAGG - Intronic
984887368 4:184461978-184462000 CCTAGAAGGCAGACGGAGGCTGG - Intronic
985263504 4:188137109-188137131 CCAATTTGGAATAGGGAGGCTGG - Intergenic
985647380 5:1091292-1091314 CCAAGTAGGGTGAGAGAAGCTGG + Intronic
986677266 5:10196998-10197020 CAAAGTAGGCAAAGGAAGGTGGG + Intergenic
988796084 5:34655141-34655163 CCTAGTAGGGAGAGGGAGGAAGG + Intergenic
989464699 5:41741196-41741218 CAAAGGAGGCCGAGGCAGGCAGG - Intronic
992546107 5:77815506-77815528 CCATGGAGGCAGGGGGAGCCCGG + Intronic
993332161 5:86614636-86614658 GTAAGTAGGGAGAGGGAGACAGG - Intergenic
993899905 5:93578450-93578472 CCAGGAAGGCAGAGGAAGGAAGG + Intergenic
994197528 5:96936288-96936310 CCACGAGGGCTGAGGGAGGCAGG + Intronic
995380954 5:111532673-111532695 ACAGTTAGCCAGAGGGAGGCTGG - Intergenic
998385766 5:141756331-141756353 CCATGTGGGCAGAGCCAGGCGGG + Intergenic
998532561 5:142899456-142899478 AGAAGGAGGCACAGGGAGGCGGG + Intronic
999159680 5:149485063-149485085 CCCAGAAGGTGGAGGGAGGCAGG - Intergenic
999212847 5:149905282-149905304 CCACTTAGGGAGAGGGAGACAGG - Intronic
1000341377 5:160279652-160279674 CCAGGTGGGCAGCGGGAGGGAGG + Intronic
1000825289 5:166037266-166037288 CCCAGCAGTCAGAGGGAGGGAGG - Intergenic
1001089391 5:168726349-168726371 GCAGGGAGGGAGAGGGAGGCAGG + Intronic
1001089398 5:168726367-168726389 GCAGGGAGGGAGAGGGAGGCAGG + Intronic
1001089404 5:168726385-168726407 GCAGGGAGGCAGAGGGAGGCAGG + Intronic
1001089410 5:168726403-168726425 GCAGGGAGGCAGAGGGAGGCAGG + Intronic
1001089416 5:168726421-168726443 GCAGGGAGGAAGAGGGAGGCAGG + Intronic
1001089449 5:168726501-168726523 GCAGGGAGGGAGAGGGAGGCAGG + Intronic
1002419842 5:179139736-179139758 CCAGGTAGGGTGAGGCAGGCGGG + Intronic
1002484541 5:179525030-179525052 ACATGCAGGCAGATGGAGGCAGG + Intergenic
1002763123 6:217293-217315 GCATGTAGGTGGAGGGAGGCTGG - Intergenic
1003064374 6:2890775-2890797 CCAAGCAGTCAGAGGCAGGAAGG + Intronic
1003480587 6:6528518-6528540 CCAAGGAGGAAGAGAGATGCAGG + Intergenic
1004017234 6:11743467-11743489 CCAAGGGGGCTGAGGGAGGGAGG - Intronic
1005572510 6:27158800-27158822 CCAAGTAGACTGGGTGAGGCGGG + Intergenic
1005592470 6:27343258-27343280 CCAAGGAGGCAGAGGTAGCAGGG - Intergenic
1006825089 6:36928771-36928793 CCCAGGGAGCAGAGGGAGGCAGG + Intronic
1006984574 6:38168225-38168247 CAAAGCAGGCACAGAGAGGCCGG - Intergenic
1007082303 6:39116431-39116453 GGAAGGAGGGAGAGGGAGGCAGG + Intergenic
1007446267 6:41908755-41908777 GCAAGTAGGAAGCGGGAAGCTGG - Intronic
1008932572 6:56955296-56955318 GCAATTTGGCCGAGGGAGGCTGG - Exonic
1009029373 6:58038196-58038218 CCAAGAAGGCAGAGGAGGGGTGG - Intergenic
1009204916 6:60789586-60789608 CCAAGAAGGCAGAGGAGGGTTGG - Intergenic
1009913988 6:69969804-69969826 CCAGGTTGGCTGAGGGTGGCTGG + Intronic
1010258928 6:73793167-73793189 CCAAGAAAACAGAGGGAGCCAGG + Intronic
1011303542 6:85901827-85901849 GAGAGTAGGCAGAGTGAGGCAGG + Intergenic
1011442068 6:87398004-87398026 CCAAGCAGGCATAGGGTAGCAGG + Exonic
1013626960 6:111948109-111948131 AAAAATAGGCAGAGGGAGGTGGG + Intergenic
1014307412 6:119759081-119759103 CCAAGGAGGGAGAGGGAGGGAGG - Intergenic
1015626296 6:135182895-135182917 CGGAGTAGGCATAGGGAGCCCGG - Intronic
1017999470 6:159566125-159566147 GAAAGTAGGGAGAGGCAGGCAGG + Intergenic
1018557464 6:165063987-165064009 GCAAGAATGCAGAAGGAGGCCGG + Intergenic
1018787454 6:167119167-167119189 CCAGGTAGGCAGGGGGAGGAAGG - Intergenic
1018799432 6:167210707-167210729 CCAAGTGGGCAGAGGGAGCAGGG + Intergenic
1019344555 7:522887-522909 CCAAATAGGCCGAGCGAGGGGGG + Intergenic
1019454764 7:1121101-1121123 CCGCGTAGGCAGCGGGAGGCCGG - Intronic
1019742056 7:2679932-2679954 CCTCGTAGGCAGAGGGACCCCGG + Intronic
1019895720 7:3981326-3981348 CCAAGGAGACGGAGGGAGACAGG - Intronic
1020340216 7:7101893-7101915 CTGAGTAGGCAGAGGGAGGTTGG - Intergenic
1022665215 7:32404459-32404481 CCCAGGAGGCAGAGGCAGGAGGG - Intergenic
1023074900 7:36472986-36473008 CCAAGCAGGCACAGGGCAGCAGG - Intergenic
1023333690 7:39146339-39146361 GCAGGAAGGCAGAGGGAGGCAGG + Intronic
1023444978 7:40222089-40222111 GCAAGCAGGCAGAAGGAAGCTGG + Intronic
1023508115 7:40921427-40921449 CCATGGAGGTAGAGAGAGGCTGG + Intergenic
1023629417 7:42148854-42148876 CCAGGCAGGCAAAGGGAAGCTGG - Intronic
1023878538 7:44306033-44306055 CCAAATACCCAGAGGGAGGGGGG + Intronic
1023880045 7:44313154-44313176 CCAGCTAGGCAGCGGGAGGTGGG - Intronic
1024332673 7:48171621-48171643 GCCAGGAGGCAGAGGCAGGCAGG - Intronic
1024511759 7:50210022-50210044 CTCAGTAGGGAGAGGGAGCCAGG - Intergenic
1025014422 7:55427396-55427418 CCCAGTAGGAAGAATGAGGCGGG + Intronic
1026579464 7:71601833-71601855 CCAAGAGGGAAGAAGGAGGCAGG + Intronic
1026896605 7:74013258-74013280 CCAAGTGGGGAGAGGGAGATTGG + Intergenic
1026907986 7:74074000-74074022 CAAAGAAGGCAGAGACAGGCTGG - Intergenic
1027681818 7:81232177-81232199 CCAAGCAGGCAGAATGAGCCTGG - Intergenic
1028268255 7:88755630-88755652 CCAAGGATTCAGAGGGAGACAGG + Intergenic
1029388167 7:100257305-100257327 CCAAGTTTGCAGAGGGGGTCAGG + Intronic
1029609319 7:101618277-101618299 CCAAGCAGGCAGGGGGTAGCAGG + Intronic
1029806387 7:103001620-103001642 CAAAGCAGGCAGAAGGAGGTGGG + Intronic
1030097859 7:105917048-105917070 CCAACTGGGCAGAGAAAGGCTGG + Intronic
1031547531 7:123068543-123068565 GCAAGTAGGCATAGCCAGGCTGG + Intergenic
1032240097 7:130153601-130153623 CCAGGCAGGGAGAGGGAGGAAGG - Intergenic
1034111753 7:148544068-148544090 ACAAGTAGGCACAGGGCGTCTGG + Intergenic
1034401150 7:150862504-150862526 CCAGGTAGGGAGATAGAGGCTGG + Intergenic
1035370154 7:158374667-158374689 GCAAGTGGACAGATGGAGGCTGG + Intronic
1035580315 8:735894-735916 GGAAGTAGGGAGAGAGAGGCAGG - Intronic
1036448137 8:8841397-8841419 CCCAGGAGGCAGAGTGAGCCGGG + Intronic
1036612968 8:10365904-10365926 GCAAGTATGCAGAGGTAGGAAGG - Intronic
1037082074 8:14799642-14799664 CCTACTAGGCAGAGGAAGGAGGG + Intronic
1037540979 8:19871122-19871144 GCAAGTTGGCAGAGGGAGCCGGG - Intergenic
1038611775 8:29065577-29065599 CTGAGAAGGGAGAGGGAGGCCGG - Intergenic
1039834230 8:41243707-41243729 ACCAGAAGGCAGAGAGAGGCGGG + Intergenic
1041457018 8:58072008-58072030 CACAGCAGGCAGAGGGAGGGAGG - Intronic
1042426640 8:68656753-68656775 CCAGGAAGGCAGAGGGATCCAGG - Intronic
1045588120 8:103562553-103562575 CCATGAAGGCAGCGGGAGGGAGG - Intronic
1046583196 8:116119049-116119071 CCCAGGAGGCAGAGGCAGCCTGG + Intergenic
1047184671 8:122622000-122622022 ACAAAAAGGCAGAGGAAGGCTGG + Intergenic
1047690328 8:127345858-127345880 CCAAGTGGGTGGAGGGAGGAAGG - Intergenic
1048048562 8:130796050-130796072 ACAGGGAGGCAGAGGGAGGGAGG - Intronic
1048933843 8:139339108-139339130 CCAAGCAGTCAGAGGGATGCCGG + Intergenic
1049414426 8:142488822-142488844 CCACGTGGGAAGAGGGAGACCGG - Intronic
1049748760 8:144273855-144273877 GCGAGCAGGCGGAGGGAGGCGGG - Intronic
1049783334 8:144438946-144438968 TCAAGTGGGCAGAGGGATGGTGG - Intronic
1050095371 9:2059414-2059436 CCTGGTATGGAGAGGGAGGCAGG - Intronic
1050858039 9:10386925-10386947 ACAAGATGGAAGAGGGAGGCAGG + Intronic
1050877486 9:10656894-10656916 CCATGTAGGCAGAGGAAGGGTGG + Intergenic
1052219135 9:25998351-25998373 CCAAGGATGGAGAGAGAGGCAGG - Intergenic
1052238653 9:26245718-26245740 CCACATATTCAGAGGGAGGCTGG - Intergenic
1053611751 9:39721003-39721025 ACAAGCAGGCAGAGGGAATCAGG - Intergenic
1053869787 9:42479005-42479027 ACAAGCAGGCAGAGGGAATCAGG - Intergenic
1054086504 9:60750152-60750174 ACAAGCAGGCAGAGGGAATCAGG + Intergenic
1054241770 9:62621390-62621412 ACAAGCAGGCAGAGGGAATCAGG + Intergenic
1054354842 9:64050471-64050493 CAAAGCAGGCAGAGGAAGGTGGG + Intergenic
1054555893 9:66655913-66655935 ACAAGCAGGCAGAGGGAATCAGG + Intergenic
1054760902 9:69003133-69003155 TAACGTGGGCAGAGGGAGGCGGG + Intronic
1054851221 9:69848636-69848658 CCAAGGAGATAGAGGGAGGTGGG + Intronic
1055335590 9:75230013-75230035 CCAAGCAGGCATAGGGCAGCAGG + Intergenic
1055829667 9:80363126-80363148 CCTAGAAGGGAGAGGGAGGGGGG - Intergenic
1057786191 9:98089150-98089172 CTAAGTAGGAAGTGGGAGACAGG - Intronic
1058388618 9:104468276-104468298 CCAAGGAGGCTGAGAGATGCTGG + Intergenic
1059237030 9:112769793-112769815 TCAAGAAGGCAGTGGGAGACAGG - Intronic
1059409689 9:114124256-114124278 CCAAGTAGCCAGGGGTAGGGTGG - Intergenic
1060382991 9:123194349-123194371 CCAAGTAGGCAAAAGGAGGTGGG - Intronic
1060395593 9:123314241-123314263 GCAGGGTGGCAGAGGGAGGCTGG - Intergenic
1061249837 9:129420286-129420308 CTAGGTGGGCAGAGGGAGCCGGG + Intergenic
1061503792 9:131019293-131019315 ACAGGTAGGGAGAGAGAGGCAGG - Intronic
1061517480 9:131098053-131098075 CCGAGAAGGCTGTGGGAGGCGGG + Intronic
1061928229 9:133818066-133818088 CAAAAAAGGCAGAGGGCGGCCGG + Intronic
1062009776 9:134260825-134260847 GCAAGCAGGCAGTGGGAGGCGGG - Intergenic
1062167846 9:135117101-135117123 GCAGTTAGGCAGAGGGAGTCTGG - Intronic
1062356566 9:136167369-136167391 TCAAGAAGGCAGAGGGAAGATGG - Intergenic
1062395619 9:136351460-136351482 CCAAGGAAGGAGTGGGAGGCTGG + Intronic
1203743179 Un_GL000218v1:19601-19623 CAAAGCAGGCAGAGGAAGGTGGG + Intergenic
1185652209 X:1656159-1656181 CAAAGGAGGAAGATGGAGGCTGG - Intergenic
1185687391 X:1940567-1940589 AGAAGGAGGCAGAGGGAGACTGG - Intergenic
1185828657 X:3277141-3277163 CCAAGTGGACAGAGGCAGGGAGG + Intronic
1187378975 X:18783126-18783148 AAAAGAAGGCAGAGGGAGGGTGG + Intronic
1188043569 X:25399289-25399311 ACTAGAAGGCAGAGGGAGGAAGG + Intergenic
1188284860 X:28315217-28315239 CCAAGGAAGGAGAGGGAAGCAGG + Intergenic
1190625694 X:52336637-52336659 CCAAGCAGGCAGGGGGAGGGAGG - Intergenic
1192146568 X:68686639-68686661 ACAAGGAGGCAGAGGGAGCAGGG - Intronic
1196187066 X:112755707-112755729 CCAATCAGGCAAAAGGAGGCTGG - Intergenic
1197782652 X:130172626-130172648 ACCTGTGGGCAGAGGGAGGCAGG + Intronic
1199500589 X:148501583-148501605 CCAAGGAAGCAGAGGGCTGCTGG - Intronic
1199541282 X:148960348-148960370 CCAAGCAGGCATAGGGCAGCAGG - Intronic
1199692477 X:150319290-150319312 CCAACTAGGCCCAGGGAGGCTGG - Intergenic
1200065216 X:153501575-153501597 CCATGAAGTCAGAGGGAGCCAGG - Intronic
1200205826 X:154315552-154315574 CCAAGTTGGCTGAGGGCAGCAGG + Intronic
1200384245 X:155873899-155873921 CAAAGTAGGCAGAGGAAGGAAGG - Intergenic
1201156708 Y:11137068-11137090 CAAAGCAGGCAGAGGAAGGTGGG + Intergenic