ID: 1182515323

View in Genome Browser
Species Human (GRCh38)
Location 22:30855427-30855449
Sequence GCAACCACACGCCTGTGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 123}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182515323_1182515331 14 Left 1182515323 22:30855427-30855449 CCACAGCACAGGCGTGTGGTTGC 0: 1
1: 0
2: 1
3: 15
4: 123
Right 1182515331 22:30855464-30855486 CTTGCCAAATGCTTAATGAACGG 0: 1
1: 0
2: 0
3: 19
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182515323 Original CRISPR GCAACCACACGCCTGTGCTG TGG (reversed) Intronic
900175010 1:1287760-1287782 GTAACCACACGCCCTTCCTGGGG + Exonic
900863424 1:5249952-5249974 ACAACCACAAGCCTATGTTGTGG - Intergenic
904624360 1:31793735-31793757 CCAACCCCACACCTGTCCTGTGG + Exonic
912431293 1:109629804-109629826 GCTTCCACACGTTTGTGCTGAGG + Exonic
913058661 1:115184864-115184886 GAAAGCACACGTCAGTGCTGAGG + Intergenic
915325531 1:155079717-155079739 GCACACACACGCCCGGGCTGGGG + Intronic
916128246 1:161589941-161589963 GCAACCACTGACATGTGCTGAGG - Intronic
917214039 1:172659429-172659451 GGAGACACAGGCCTGTGCTGTGG - Exonic
919128712 1:193427711-193427733 GTAGCCACAGGCCTGTGCTCTGG - Intergenic
923539242 1:234876258-234876280 GCCACCACAGGCCTCTGCTGGGG + Intergenic
1064149222 10:12849042-12849064 GCACCCACACACCTGGGCTTTGG - Intergenic
1067414662 10:46094313-46094335 GCATCCTCACCCCTGGGCTGGGG - Intergenic
1067829300 10:49601015-49601037 GCCAGCACTCGCCTGTGTTGAGG + Intergenic
1068680869 10:59818421-59818443 GAATCCACACGGCTGAGCTGGGG - Intronic
1073035546 10:100562282-100562304 GCAAGAAGACGCCTGTGGTGTGG + Intergenic
1076217361 10:128706871-128706893 GCAAACACACGCCAGTGATGAGG + Intergenic
1076944636 10:133637761-133637783 GCAAGCACCCGCCCGTGCAGCGG - Intergenic
1077049877 11:561756-561778 CCAACAACATGCCTGTCCTGTGG - Exonic
1079371245 11:19854694-19854716 GCTACCACATGCCAGTGCTTAGG - Intronic
1084395413 11:68906102-68906124 GCAAACACACGCCTCGGCTCTGG - Exonic
1086091040 11:83005029-83005051 TCAAACACCCACCTGTGCTGTGG + Intronic
1091669098 12:2439556-2439578 GCACCCACACCCACGTGCTGGGG + Intronic
1092765427 12:11848770-11848792 GTAAACACACGCATGTGCAGAGG - Intronic
1093798358 12:23340890-23340912 GCAACCAAGCTCCTTTGCTGAGG - Intergenic
1098905611 12:76158988-76159010 CCAACCACAGGCCTGTGCGTTGG + Intergenic
1101312944 12:103600317-103600339 TCAAGCACAGGCCTTTGCTGTGG - Intronic
1104113008 12:125721817-125721839 GCAGCCTCACGCCTCTTCTGGGG + Intergenic
1104681030 12:130752031-130752053 GCATCCACATGCCTGCTCTGAGG - Intergenic
1104730986 12:131105186-131105208 CCGACCACACGCCTGTGCTGAGG - Intronic
1105257624 13:18754770-18754792 GCCATGACACGCCTGTGCTCTGG - Intergenic
1108505643 13:51110094-51110116 GCCACCACATGCCTGGTCTGAGG + Intergenic
1122626388 14:103087414-103087436 CCACCCCCACGCCTGTGCTCGGG - Intergenic
1122793467 14:104194157-104194179 ACATCCACACTCCTGAGCTGAGG - Intergenic
1122925476 14:104897605-104897627 GCAGCCAGACGGCTGGGCTGCGG - Intergenic
1128682582 15:69662525-69662547 TTACCCACACACCTGTGCTGCGG - Intergenic
1131057768 15:89385820-89385842 GCAGCCCCAGGGCTGTGCTGTGG + Intergenic
1131172875 15:90190997-90191019 GCACCCACTCGCCTGTCCAGGGG - Intronic
1132538629 16:496631-496653 GCAAGGACACGGCAGTGCTGGGG - Intronic
1133009510 16:2902951-2902973 GCAACCACACACATGGGCGGGGG - Intergenic
1135036829 16:19085825-19085847 TCAACCACAGGCCTGGGCTGTGG - Intergenic
1135322752 16:21507944-21507966 GGAAGCACGCGCCTGTGCTGGGG - Intergenic
1136334236 16:29601107-29601129 GGAAGCACGCGCCTGTGCTGGGG - Intergenic
1136616264 16:31400370-31400392 GAAACCACAGCCCTGTGGTGTGG + Intronic
1137000077 16:35221926-35221948 GAATCCACCCGCCTGTGCAGTGG - Intergenic
1142032557 16:87845808-87845830 GCAGCCACAGCCCTGTGCTGGGG - Intronic
1142034950 16:87856964-87856986 GGAAGCACGCGCCTGTGCTGGGG - Intronic
1142306926 16:89290937-89290959 GCAGCCTCATGGCTGTGCTGAGG - Intronic
1143382033 17:6502595-6502617 GCAGCCACAGGCCTGAGCTCAGG + Intronic
1144033131 17:11340317-11340339 GCAACCACAGGCATGAGCTCAGG - Intronic
1145017371 17:19408101-19408123 GCAGCCAAGAGCCTGTGCTGGGG - Intergenic
1146269788 17:31477310-31477332 GCAACCACACGACTGTGAGGAGG + Intronic
1147948889 17:44096057-44096079 GCAACCACAGGGCAGTGGTGAGG - Intronic
1149440092 17:56666712-56666734 GTAACCACACCACTGGGCTGTGG - Intergenic
1154428486 18:14290309-14290331 GCCATGACACGCCTGTGCTCTGG + Intergenic
1154433433 18:14325957-14325979 GCCATGACACGCCTGTGCTCTGG + Intergenic
1154453987 18:14503934-14503956 GCAACCAGACGCCTCTGCAAGGG - Intergenic
1159467522 18:68803974-68803996 GCATCCACTCGGCTGTGCTGTGG + Intronic
1160605116 18:80044428-80044450 ACATTCACAGGCCTGTGCTGTGG + Intronic
1161497739 19:4596828-4596850 GCAGGCTCACGCCTGTGCTCCGG - Intergenic
1161808464 19:6458498-6458520 GCCACCACAGGTCTGTGCGGTGG + Intronic
1161899988 19:7111197-7111219 ACAGCCTCACTCCTGTGCTGAGG - Intergenic
1162654463 19:12117857-12117879 GCAACCTCGCGTCTGTGCGGGGG + Intronic
1162792631 19:13070938-13070960 GCATCCACACGCGTGTGCACGGG + Intronic
1163755942 19:19106176-19106198 GCACCCGCACGTCTCTGCTGGGG - Intronic
1168388478 19:55986556-55986578 ACCACCACACACCTGTGCTGAGG - Intronic
925194323 2:1911063-1911085 CCAAAAATACGCCTGTGCTGAGG + Intronic
925589347 2:5494046-5494068 TCGACCACCCGCCTGTCCTGAGG + Intergenic
925743810 2:7028347-7028369 GGAAGCACAGGCCTCTGCTGGGG - Intronic
926607582 2:14913242-14913264 CAGACCACAGGCCTGTGCTGTGG + Intergenic
928396146 2:30944643-30944665 GCCAGCAGAGGCCTGTGCTGAGG - Intronic
934674052 2:96237055-96237077 GCAGCCACAGGCATGAGCTGAGG - Intergenic
935637967 2:105264633-105264655 GCAGCCACCTGCCTGTGCTCCGG + Exonic
936708220 2:115101093-115101115 GCAGCCACAGGTATGTGCTGTGG + Intronic
937011856 2:118570007-118570029 AAATCCACAAGCCTGTGCTGTGG + Intergenic
948947624 2:241229089-241229111 GCACCCTGACACCTGTGCTGAGG + Exonic
1169335469 20:4752218-4752240 GGAAGCCCACACCTGTGCTGAGG + Intergenic
1172028867 20:31967998-31968020 GCCCCCACCCGCCTGAGCTGCGG - Exonic
1172939361 20:38644032-38644054 GAAAACACAGGCCTGTGCAGAGG - Intronic
1173392623 20:42648586-42648608 GCAATTCCATGCCTGTGCTGAGG + Intronic
1173545510 20:43894776-43894798 GCACCCCCAGGCCAGTGCTGAGG + Intergenic
1174038433 20:47682609-47682631 ACAACCAGCTGCCTGTGCTGTGG + Intronic
1174409126 20:50322181-50322203 ACAAGCACCAGCCTGTGCTGCGG - Intergenic
1175720468 20:61283531-61283553 GCATTTACACGCGTGTGCTGTGG + Intronic
1175934252 20:62507824-62507846 GCAACCCCCTGCCTGTGATGCGG + Intergenic
1178971427 21:37181288-37181310 GCAACCACAAGGTTATGCTGAGG - Intronic
1182515323 22:30855427-30855449 GCAACCACACGCCTGTGCTGTGG - Intronic
1183826479 22:40391899-40391921 GGAACCAAATGCCTGGGCTGTGG + Intronic
1184026704 22:41863053-41863075 GCACCCACATGCCTGTGTAGTGG + Intronic
1184351431 22:43946537-43946559 GCAACCTTTCGCCTGTGCAGCGG + Exonic
1184927095 22:47650584-47650606 GGAAACACACTTCTGTGCTGGGG + Intergenic
1185218111 22:49615173-49615195 GAAACCACACCCCAGGGCTGCGG + Intronic
952871203 3:37902827-37902849 ACAGCCACAGGCCTGTGTTGAGG - Intronic
954583620 3:51716899-51716921 GCCACCACACCTCTGTCCTGGGG - Intronic
954639809 3:52091135-52091157 GAGAGCACACGCCTGTCCTGTGG - Intronic
961281444 3:125767855-125767877 GCAACCCCAAGACTGTGCAGGGG - Intergenic
966739950 3:183223289-183223311 GAAACCAGACGCCTGCACTGTGG - Intronic
967327745 3:188258986-188259008 GCAACCAAAAGTCAGTGCTGTGG + Intronic
968298062 3:197592535-197592557 GCAACCAGCGGCGTGTGCTGAGG + Intergenic
968446159 4:653352-653374 GCAACCAGGGGCCTGTGCAGCGG + Intronic
968707988 4:2092218-2092240 TGACCCACAGGCCTGTGCTGAGG - Intronic
975640585 4:76496166-76496188 TCACTCACACACCTGTGCTGTGG - Intronic
981747874 4:148068442-148068464 GCAACCACATCGCTGGGCTGTGG - Intronic
985448022 4:190038271-190038293 GCAAGCACCCGCCCGTGCAGCGG - Intergenic
998370775 5:141659668-141659690 GCCACCAGAGGCCTGGGCTGGGG + Intronic
1003583104 6:7360294-7360316 GCTACCACACACCTGTTATGAGG + Intronic
1005313339 6:24580418-24580440 CCAACCCCTCACCTGTGCTGAGG - Intronic
1006516158 6:34546866-34546888 GCAAACACTCGTGTGTGCTGTGG + Intronic
1007087638 6:39160605-39160627 GGAAACACACCCCTGTCCTGGGG - Intergenic
1007728776 6:43933134-43933156 GCACCCACATGCCTGTACTGGGG - Intergenic
1007897637 6:45378453-45378475 ACATCCACACGCCTGTACTGCGG - Intronic
1009047806 6:58249817-58249839 GCATACACACCCCTGTGATGTGG + Intergenic
1009223608 6:61004113-61004135 GCATACACACCCCTGTGATGTGG + Intergenic
1012328927 6:97960031-97960053 GCAAGCACACTCCTGTCTTGGGG - Intergenic
1013601442 6:111708810-111708832 GATACCACACTGCTGTGCTGTGG - Intronic
1016046042 6:139481540-139481562 GGAACCACCAGCCTCTGCTGGGG - Intergenic
1018933635 6:168259068-168259090 GCATCCGCACGCATGAGCTGTGG - Intergenic
1019145284 6:169971934-169971956 GCGACCACATGTCAGTGCTGAGG + Intergenic
1031717847 7:125130705-125130727 GCAACAACAAACATGTGCTGTGG + Intergenic
1037087937 8:14876074-14876096 GCTACCACACCACTGAGCTGGGG - Intronic
1037744167 8:21629991-21630013 GCCCCCACAGGGCTGTGCTGGGG + Intergenic
1038586057 8:28790237-28790259 ACCACCACAAGCCTGTGCTGAGG - Intronic
1044781907 8:95752212-95752234 GCGAACTCAGGCCTGTGCTGGGG - Intergenic
1044794662 8:95884870-95884892 GCAACAAAACACCTGTACTGTGG + Intergenic
1048194561 8:132321747-132321769 ACTACCACACCCCTGTGCTTTGG + Intronic
1049428525 8:142548663-142548685 GCACCCACACTCCTGAGATGTGG + Intergenic
1051260886 9:15263496-15263518 GAAACCACACCGCTGTGCTTTGG + Intronic
1054864506 9:69986328-69986350 GCTACCAAACTCCTGGGCTGTGG + Intergenic
1057547835 9:96031397-96031419 GCACCCACAGGTCTGTGCTAGGG + Intergenic
1057676312 9:97138728-97138750 GCCATCACACCCCTGTGCTCTGG - Intergenic
1061035847 9:128114047-128114069 GCAACCAGACTCCTGGGCAGGGG + Intergenic
1061303384 9:129718964-129718986 GCAGCCACACCCCTGCCCTGTGG - Intronic
1061645109 9:131994821-131994843 GCAACCACAGGCATGAGCTGGGG - Intronic
1061653255 9:132068130-132068152 ACAACAACGGGCCTGTGCTGGGG + Intronic
1061970340 9:134041555-134041577 GCAGCCACCCACGTGTGCTGTGG + Intronic
1062167197 9:135113780-135113802 GCTTCCACACCCGTGTGCTGGGG - Intronic
1062651580 9:137580536-137580558 TCAACCACACACCTCTGCGGGGG + Intergenic
1189425244 X:40894831-40894853 GCAACCATAGGCCTATGCTGAGG - Intergenic
1199708590 X:150451885-150451907 ACAAAGACAGGCCTGTGCTGAGG - Intronic
1199881416 X:151976369-151976391 GCAAACACGCGGCTTTGCTGAGG + Intergenic
1200136055 X:153875385-153875407 GCTGCCACACCCCTGTGGTGGGG + Intronic