ID: 1182517120

View in Genome Browser
Species Human (GRCh38)
Location 22:30865198-30865220
Sequence CTCTGGCTGAGGAGGCCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 407
Summary {0: 1, 1: 0, 2: 8, 3: 55, 4: 343}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182517120_1182517125 -8 Left 1182517120 22:30865198-30865220 CCCTGTGGCCTCCTCAGCCAGAG 0: 1
1: 0
2: 8
3: 55
4: 343
Right 1182517125 22:30865213-30865235 AGCCAGAGCCACCTATTACAGGG 0: 1
1: 0
2: 1
3: 9
4: 116
1182517120_1182517139 27 Left 1182517120 22:30865198-30865220 CCCTGTGGCCTCCTCAGCCAGAG 0: 1
1: 0
2: 8
3: 55
4: 343
Right 1182517139 22:30865248-30865270 CCTGAGTGGGGAATGGGGTGTGG 0: 1
1: 0
2: 6
3: 69
4: 628
1182517120_1182517131 13 Left 1182517120 22:30865198-30865220 CCCTGTGGCCTCCTCAGCCAGAG 0: 1
1: 0
2: 8
3: 55
4: 343
Right 1182517131 22:30865234-30865256 GGGTCAAGGAGATCCCTGAGTGG No data
1182517120_1182517141 29 Left 1182517120 22:30865198-30865220 CCCTGTGGCCTCCTCAGCCAGAG 0: 1
1: 0
2: 8
3: 55
4: 343
Right 1182517141 22:30865250-30865272 TGAGTGGGGAATGGGGTGTGGGG 0: 1
1: 0
2: 5
3: 111
4: 961
1182517120_1182517128 -1 Left 1182517120 22:30865198-30865220 CCCTGTGGCCTCCTCAGCCAGAG 0: 1
1: 0
2: 8
3: 55
4: 343
Right 1182517128 22:30865220-30865242 GCCACCTATTACAGGGGTCAAGG 0: 1
1: 0
2: 0
3: 2
4: 80
1182517120_1182517140 28 Left 1182517120 22:30865198-30865220 CCCTGTGGCCTCCTCAGCCAGAG 0: 1
1: 0
2: 8
3: 55
4: 343
Right 1182517140 22:30865249-30865271 CTGAGTGGGGAATGGGGTGTGGG No data
1182517120_1182517124 -9 Left 1182517120 22:30865198-30865220 CCCTGTGGCCTCCTCAGCCAGAG 0: 1
1: 0
2: 8
3: 55
4: 343
Right 1182517124 22:30865212-30865234 CAGCCAGAGCCACCTATTACAGG 0: 1
1: 0
2: 0
3: 13
4: 129
1182517120_1182517126 -7 Left 1182517120 22:30865198-30865220 CCCTGTGGCCTCCTCAGCCAGAG 0: 1
1: 0
2: 8
3: 55
4: 343
Right 1182517126 22:30865214-30865236 GCCAGAGCCACCTATTACAGGGG No data
1182517120_1182517136 22 Left 1182517120 22:30865198-30865220 CCCTGTGGCCTCCTCAGCCAGAG 0: 1
1: 0
2: 8
3: 55
4: 343
Right 1182517136 22:30865243-30865265 AGATCCCTGAGTGGGGAATGGGG 0: 1
1: 0
2: 2
3: 16
4: 252
1182517120_1182517134 20 Left 1182517120 22:30865198-30865220 CCCTGTGGCCTCCTCAGCCAGAG 0: 1
1: 0
2: 8
3: 55
4: 343
Right 1182517134 22:30865241-30865263 GGAGATCCCTGAGTGGGGAATGG No data
1182517120_1182517142 30 Left 1182517120 22:30865198-30865220 CCCTGTGGCCTCCTCAGCCAGAG 0: 1
1: 0
2: 8
3: 55
4: 343
Right 1182517142 22:30865251-30865273 GAGTGGGGAATGGGGTGTGGGGG 0: 1
1: 0
2: 12
3: 132
4: 1212
1182517120_1182517133 15 Left 1182517120 22:30865198-30865220 CCCTGTGGCCTCCTCAGCCAGAG 0: 1
1: 0
2: 8
3: 55
4: 343
Right 1182517133 22:30865236-30865258 GTCAAGGAGATCCCTGAGTGGGG No data
1182517120_1182517135 21 Left 1182517120 22:30865198-30865220 CCCTGTGGCCTCCTCAGCCAGAG 0: 1
1: 0
2: 8
3: 55
4: 343
Right 1182517135 22:30865242-30865264 GAGATCCCTGAGTGGGGAATGGG 0: 1
1: 0
2: 0
3: 12
4: 181
1182517120_1182517132 14 Left 1182517120 22:30865198-30865220 CCCTGTGGCCTCCTCAGCCAGAG 0: 1
1: 0
2: 8
3: 55
4: 343
Right 1182517132 22:30865235-30865257 GGTCAAGGAGATCCCTGAGTGGG 0: 1
1: 0
2: 1
3: 12
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182517120 Original CRISPR CTCTGGCTGAGGAGGCCACA GGG (reversed) Intronic
900122220 1:1053654-1053676 CCCCAGCTGCGGAGGCCACAAGG - Intronic
900277174 1:1838320-1838342 GTCTGGGTGAGGAGGGTACATGG - Intronic
900560731 1:3304814-3304836 CTGAGGAGGAGGAGGCCACAGGG - Intronic
900585889 1:3432171-3432193 CTCTGGCTGAGGAGGCCAGGTGG - Intronic
900847286 1:5114062-5114084 ACATGGCTGGGGAGGCCACATGG + Intergenic
900897627 1:5494795-5494817 CTCTGGGTTGGGAGGCCACACGG - Intergenic
901271528 1:7955529-7955551 CTCTGCCTGTGGAGGTCACAAGG - Intronic
901372541 1:8811918-8811940 CTCCTGCTGAGGAGGCAACAAGG + Intronic
901465190 1:9416901-9416923 CTGTGGCTGAGGGAGGCACAGGG - Intergenic
901664807 1:10820088-10820110 CTCAGGGTGAGGAGGAAACAAGG + Intergenic
902359992 1:15937185-15937207 CACAGGCTGAGGAGGCTGCAGGG - Exonic
903499563 1:23793792-23793814 CTTGGGCTGAGGGAGCCACAGGG + Intronic
904016737 1:27427408-27427430 CTCTCTCTGAGAAGGCCAAATGG - Intronic
904385865 1:30141724-30141746 CCCTGGCTGATGGGGCCCCAGGG - Intergenic
904432596 1:30474425-30474447 CTCTGGACAAGGATGCCACAAGG + Intergenic
904970665 1:34417276-34417298 CTCTGACTGATGAGGTCACGAGG + Intergenic
904972162 1:34427577-34427599 CTCTGGCTGAGGTGGCAGCAGGG - Intergenic
905023189 1:34831992-34832014 CTCTGGCTGTGGAGGCAGCTGGG - Intronic
905329129 1:37179863-37179885 CTCTGGCTGAGTAGGACAGCAGG - Intergenic
905950882 1:41949616-41949638 CATTGGCTGAGGAGGCCCCAGGG - Intronic
905975473 1:42170954-42170976 CTCTTCCTGGTGAGGCCACAGGG - Intergenic
906298293 1:44662531-44662553 CTCAGGCTGCGGCGGCCTCATGG + Intronic
906326742 1:44850905-44850927 CTGTGGCTTTGGAGGCCAAAAGG + Exonic
906533630 1:46539002-46539024 CTCTGGTTAGGGAGGCCTCATGG + Intergenic
906980108 1:50620955-50620977 CTCTGCCTGAGGGGGCCCCATGG - Intronic
909038883 1:70627081-70627103 GCATGGCTGAGGAGGCCTCAGGG + Intergenic
909360942 1:74757916-74757938 ATGTGGCTGGGGAGGCCTCATGG - Intronic
909495961 1:76279065-76279087 TGCTGGCTGAGGGGGCCACTTGG + Intronic
911967641 1:104387595-104387617 CTGTGGCTGAGGAGTCAACCTGG - Intergenic
915593987 1:156886095-156886117 CTCAGGAACAGGAGGCCACAGGG - Intergenic
919747992 1:201020566-201020588 ATCTAGCTGGGGAGGCCACAAGG + Intronic
919983429 1:202656887-202656909 GTCTGGCAGTGGAAGCCACAGGG - Intronic
919987920 1:202688855-202688877 GGCTGGGTGAGGAGGCCACCCGG - Intronic
920040539 1:203092480-203092502 CCCTAGCTGAGGAGGCTCCATGG - Intronic
920732741 1:208503234-208503256 CTCTGTCAGAGCATGCCACATGG - Intergenic
920797627 1:209155799-209155821 TGCTGGCTAAGGAGCCCACAAGG - Intergenic
921485759 1:215713512-215713534 CTCTGCTTCAGGAGGTCACATGG - Intronic
921949891 1:220918540-220918562 CTCTGGCTGATGAGAACACTTGG - Intergenic
922182977 1:223250705-223250727 CTCTAGCTCTGGAGGCCTCAAGG - Intronic
923011983 1:230095453-230095475 GCCTGGCTGAGGAGCCCGCAGGG - Intronic
923243486 1:232108812-232108834 GTTTGGCTGTGGAGGCCCCAGGG + Intergenic
923347317 1:233066863-233066885 TCCTGGGTAAGGAGGCCACATGG + Intronic
924419793 1:243897413-243897435 CTCTGCATGAGGAGGCACCAGGG - Intergenic
1062787687 10:278857-278879 GCTTGGCTGAGGAGGCCAGAAGG + Intronic
1065329046 10:24574594-24574616 CACTGGCTGGAGAGGCCAAAGGG + Intergenic
1065602783 10:27386990-27387012 CTCTAGCTTAGGATGCCACACGG - Intergenic
1066668598 10:37812731-37812753 CTCTAGATGAGGAGGGCATAAGG + Intronic
1067275819 10:44833199-44833221 CTGTGGAAGAGAAGGCCACATGG + Intergenic
1067699118 10:48555920-48555942 CTCTGGCTCCTGAGGCAACATGG + Intronic
1068690231 10:59906597-59906619 CTCTGGCAGAGGAGGTCCCTTGG - Exonic
1068950831 10:62775467-62775489 CTGAGGCTGAGGAGGCAGCATGG - Intergenic
1070831233 10:79419214-79419236 ATCTGGCTCAGGAAGCCCCACGG + Intronic
1071565719 10:86670418-86670440 CCCAGGCAGGGGAGGCCACAGGG - Intronic
1073616196 10:104998708-104998730 CTCAGGCAGAGGAGGCCAGCTGG + Intronic
1074626340 10:115191777-115191799 GCATGGCTGAGGAGGCCTCAGGG - Intronic
1074955556 10:118385010-118385032 TTCTTGCTCAGGAGGCCCCAGGG - Intergenic
1075310172 10:121407232-121407254 CTCTGGCTGCCGAGGCCAGCAGG + Intergenic
1075777704 10:124998973-124998995 CTCTGGCTGAGGAGGGTAAATGG - Intronic
1076426446 10:130370654-130370676 CTCTTGCTGAAGAGGCCAACAGG - Intergenic
1076518202 10:131061978-131062000 TCCAGGCCGAGGAGGCCACATGG - Intergenic
1076673668 10:132136676-132136698 ATTTGGGAGAGGAGGCCACATGG + Intronic
1076794875 10:132793579-132793601 CTCTGGCTGGGGAGGCCCTGGGG + Intergenic
1076849798 10:133087200-133087222 CTCTTGCTGAGGCTGCCACCAGG + Intronic
1077414337 11:2417851-2417873 TCCTGGCTGAGGCGGCCCCATGG - Intronic
1077920688 11:6639924-6639946 CTGTGGCAGAGGAGGCTAGAGGG + Exonic
1078708933 11:13771433-13771455 CTCTGGCTCAGGAGTGCCCAGGG + Intergenic
1078916573 11:15783967-15783989 CTCAGGCAGAAGAGGCCACTGGG + Intergenic
1084385229 11:68839510-68839532 CTGTCGCTGGGGTGGCCACAGGG - Intronic
1084470089 11:69354261-69354283 CCCTGGCTGAGGCGGTCAGAGGG - Intronic
1084693815 11:70742169-70742191 CCCTGGCCCATGAGGCCACAGGG - Intronic
1085879716 11:80451955-80451977 CTTTGGCTGAGCAGGAGACAAGG - Intergenic
1086649916 11:89275634-89275656 CTCTAGCTGAGGAAGCTACCTGG - Intronic
1088361240 11:108992220-108992242 ATCTGTCTGAGGAGGGCACTGGG + Intergenic
1088460176 11:110074713-110074735 CTCCTTCTGAGGAGGCCTCAGGG + Intergenic
1088785112 11:113174563-113174585 CTCTGGCTCAGGAGGAGCCAGGG - Intronic
1089381712 11:118037442-118037464 CATTGGCTGAGGGGGCCCCAGGG + Intergenic
1089581903 11:119486696-119486718 CTGTGGCTGAGCAAGTCACATGG - Intergenic
1091174554 11:133546754-133546776 CACTGAAGGAGGAGGCCACACGG - Intergenic
1091309446 11:134562209-134562231 CTAGGGTTGATGAGGCCACAGGG + Intergenic
1091813054 12:3415787-3415809 CGCAGGCTCAGGAGGCCACATGG + Intronic
1092491431 12:8949356-8949378 ATCTGGCTGAGGAGCCCTAAGGG - Intronic
1092902327 12:13071546-13071568 GTGTGGCTCAGGAGGACACAGGG - Intronic
1095988240 12:48015053-48015075 CTCTGACAGAGGAGGCCACCTGG + Intergenic
1096351345 12:50903610-50903632 CATTGGCTGAAGAGGCCCCAGGG + Intergenic
1096520633 12:52182711-52182733 CTCTGGCAGAGAAGGACACCAGG + Intronic
1097054191 12:56240108-56240130 CTATGGCTCAGGGGGCCACGGGG + Exonic
1097664856 12:62466947-62466969 CTCTGGCCGAGAAACCCACAAGG - Exonic
1099016022 12:77345249-77345271 CTCTGGATGTGGAGGCCACATGG + Intergenic
1101465321 12:104943340-104943362 CATTGGCTGAGGAGGCCCCAGGG - Intronic
1101802131 12:108031701-108031723 ATCCTGCTGAAGAGGCCACATGG + Intergenic
1102513377 12:113430520-113430542 CACTGGCTGGGGAAGACACAGGG - Intronic
1103043793 12:117718530-117718552 GTCTGCCTGAGGAGGTGACAAGG - Intronic
1104977811 12:132560093-132560115 CTCCGGCTGAGCAGGGCACGCGG + Intronic
1105899292 13:24742126-24742148 CTCTTGCTGGGGAGGTCACTTGG + Intergenic
1106303139 13:28487435-28487457 CTCTGCCTGTGTAGTCCACATGG + Intronic
1106386559 13:29291248-29291270 CCCTGGAGGAGGAGACCACAGGG - Intronic
1106670138 13:31896540-31896562 CCCTGGCAGAGGAGGCAGCAAGG + Intergenic
1106969088 13:35114489-35114511 CTGGGGCTGAGGAGACAACAAGG - Intronic
1111562825 13:89974394-89974416 GCATGGCTGAGGAGGCCTCAGGG + Intergenic
1111607926 13:90564327-90564349 GTCTGGCTGCGGAGCCCACAGGG + Intergenic
1113541067 13:111110170-111110192 CCCTGGCTGAGCAGGCAGCATGG + Intergenic
1113905966 13:113819320-113819342 CTGTGGCTTTGAAGGCCACAGGG - Intergenic
1114610204 14:24035374-24035396 GTCTGGCTTAGGAGGCCAGTGGG + Intergenic
1114840726 14:26259819-26259841 CATTGGCTGAGGAGGCCCCAGGG - Intergenic
1115163879 14:30426264-30426286 CTCTGCCTGAGGAGGTGGCATGG + Intergenic
1116019408 14:39442190-39442212 CTCTGGCTTAGGAAGCCCCAAGG - Intergenic
1116446724 14:45020168-45020190 CACTGGCTGAGGAGGCCCCAGGG + Intronic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1118498127 14:66329078-66329100 CTCTGGCTGTGGAAGCCAACTGG - Intergenic
1119390198 14:74286572-74286594 CGCTGGCAGAGGAGGCCACTCGG + Intronic
1119401462 14:74365470-74365492 CTCTGCCTGCGGAGACCACTGGG + Intergenic
1121117455 14:91353610-91353632 CACCGGCTGAGGAAGCCAGAAGG - Intronic
1121891212 14:97592896-97592918 GCCTTGCAGAGGAGGCCACATGG + Intergenic
1122092648 14:99350367-99350389 CTCTGGCTGAGTTGTGCACACGG - Intergenic
1122420737 14:101575571-101575593 CTGTGGCTGGAGAGTCCACATGG - Intergenic
1122549051 14:102540092-102540114 CTCTGGAGGAGGAGGCCGGATGG - Intergenic
1123119265 14:105909311-105909333 CCCAGGCTGAGGTGGCCCCAGGG - Intergenic
1123162797 14:106295812-106295834 CTGTGGCTGAGGAGATTACAGGG - Intergenic
1124370817 15:29103771-29103793 CTCCGCCTGACGAGGCCACCTGG - Intronic
1124612138 15:31215985-31216007 CTCGGGCTGAGGAGGCAGGAGGG - Intergenic
1124846954 15:33300612-33300634 CACTGGCTGAGGTGGTCAGAAGG - Intergenic
1126103415 15:45133343-45133365 CTCTGGCTGAGCAGAGCCCAGGG - Intronic
1126117723 15:45224141-45224163 CTGTGGCTCAGAAAGCCACAAGG + Intergenic
1127148588 15:56050535-56050557 CTCTGGCTGGGATGGCCACTGGG + Intergenic
1128660071 15:69493636-69493658 GTCTGGCAGAGAAGGCCAGATGG - Intergenic
1129193593 15:73951762-73951784 CCCTGGCTGAGGAGGCCACGGGG + Intronic
1129226430 15:74173056-74173078 CACTGGCTGGGGAGGAAACAGGG - Intergenic
1129542878 15:76365168-76365190 CCCTGGCTGTGGATGTCACAAGG + Intronic
1130550724 15:84888663-84888685 CCCTGGCTGAGGAGGGGACTGGG - Intronic
1131531300 15:93194873-93194895 ATCTGGCTGATGAGAACACATGG - Intergenic
1132842981 16:1987261-1987283 CTCTGGCTGGGGAGGCCCAAAGG - Exonic
1134655217 16:15942963-15942985 GTCTGGCAGGGGAGGCCATATGG + Intergenic
1135209523 16:20512372-20512394 CTCTTGCAGGGGAGGCCAGAGGG + Intergenic
1135986874 16:27190353-27190375 CTCTGGCTGAGGGAGCCCCTAGG - Intergenic
1136592034 16:31223351-31223373 CTGTGGCTGGGGAGGCCCAAGGG + Intronic
1137231123 16:46568882-46568904 CTCTGGCTTCGGGGGCCAGAAGG - Intergenic
1137380153 16:47990851-47990873 TCCTGGATGAGGAGACCACAGGG + Intergenic
1138421123 16:56899795-56899817 CTGGGGCTGAGGGGACCACAGGG + Intronic
1139144334 16:64306690-64306712 CTCTGGTTTAGGAGACAACAGGG + Intergenic
1139166989 16:64578323-64578345 GTATAGCTGAGGAGGCCTCAGGG + Intergenic
1139256464 16:65547591-65547613 CTCTGGCTGCAGGGGCAACAAGG + Intergenic
1139529240 16:67534592-67534614 TTGTGACTGAAGAGGCCACAAGG - Intronic
1141227317 16:82130181-82130203 CTGTGGTGGCGGAGGCCACAGGG - Intergenic
1141811257 16:86377884-86377906 TTCAGGCTGAGCAGGCCACCAGG - Intergenic
1141887036 16:86899249-86899271 CTGTGGCTGAGCAGACCTCAGGG - Intergenic
1141936030 16:87238407-87238429 GTCTGTCTGGGGAGGTCACAGGG - Intronic
1142014274 16:87735738-87735760 CTCTGGCTGAGGAGGACATGTGG - Intronic
1142760543 17:2039679-2039701 CGCTGGCTTAGAAGTCCACAGGG - Intronic
1143058593 17:4180930-4180952 CTATGGCTGGGGAGACCAGATGG - Intronic
1144648026 17:16988535-16988557 CTCTGTGTGAGGAAGCCCCATGG + Intergenic
1146615754 17:34356258-34356280 TTCTGGCTGTTCAGGCCACAAGG - Intergenic
1146769037 17:35551859-35551881 CATTGGCTGAGGAGGCCCCAGGG - Intronic
1146997797 17:37335977-37335999 CATTGGCTGAGGAGGCCCCAGGG - Intronic
1147755650 17:42765795-42765817 ATCTGGCTGAGAAGATCACAAGG + Intergenic
1148178457 17:45586562-45586584 GTCTGGCTGTGGGGACCACAAGG - Intergenic
1148235181 17:45964002-45964024 CTCTGGGTGAGGAGGTGAGAGGG + Intronic
1148270703 17:46259893-46259915 CTCTGGCTGTGGGGACCGCAAGG + Intergenic
1149516500 17:57284867-57284889 TTCTGGTTGAGGAGGGCATAGGG - Intronic
1149555847 17:57572987-57573009 CTCCGTCTGAGGATCCCACATGG + Intronic
1149980684 17:61308993-61309015 CTCTGCTGGGGGAGGCCACATGG - Intronic
1151024476 17:70661138-70661160 CTCAGGCTGAGAAGGGCACCTGG - Intergenic
1151310825 17:73291554-73291576 CTATGGTTTGGGAGGCCACAGGG + Intronic
1153197563 18:2617429-2617451 TTCTGGCTTTGCAGGCCACATGG - Intergenic
1153809662 18:8740863-8740885 CTATGGCTGTGGATTCCACAAGG - Intronic
1153993574 18:10420930-10420952 CTATTGTTGAGGAGGTCACAAGG - Intergenic
1157331293 18:46705624-46705646 CTCTGCCACAGGAGGCCAGAGGG - Intronic
1158240427 18:55371294-55371316 ATCTGGATGAGGGGGCCATAGGG + Intronic
1158628734 18:59093692-59093714 CTCCTGCTGGAGAGGCCACATGG - Intergenic
1160010899 18:75106513-75106535 CTTAGGCTGCTGAGGCCACACGG + Intergenic
1160099897 18:75910576-75910598 TTCTGGCTGAAGATGCTACACGG - Intergenic
1160297937 18:77654914-77654936 TTCTGGCTGAGGAGTCCAGGTGG + Intergenic
1160385290 18:78493056-78493078 CTGTGGCTGAGGAGGGCACGGGG + Intergenic
1160414127 18:78696026-78696048 ATATGGCTGTGGAGGCCTCACGG + Intergenic
1160678643 19:403768-403790 CTGGGGCTGAAGAGGCTACAAGG + Intergenic
1161429774 19:4224757-4224779 GTCTGGATGTGGAGGACACAGGG - Exonic
1162068234 19:8138363-8138385 CTGTGGGTGAGGAGGGGACAGGG - Intronic
1162799067 19:13101151-13101173 CTGTGCCTGAGGCGGGCACATGG + Exonic
1163314384 19:16532255-16532277 CCGTGGCTGAGAAGGCAACAAGG + Intronic
1163421562 19:17216216-17216238 CTCTGGCTGTGGTTGGCACACGG - Exonic
1165215665 19:34270437-34270459 CTCAAGCTGCAGAGGCCACAGGG - Intronic
1165714759 19:38037203-38037225 CTCTGGCAGAGGAGCCCAGAGGG + Intronic
1165984491 19:39756100-39756122 CTCTGAGTGAGGAGGTCACCCGG + Intergenic
1166014668 19:39971112-39971134 CCCTGGCTGAGGAGGCTTCTGGG - Exonic
1166716133 19:44968951-44968973 CTCTGCCTGTAGAAGCCACAAGG - Intronic
1166749507 19:45158327-45158349 CTCTGGCTCAGCAGGGTACAGGG - Intronic
1167267308 19:48489989-48490011 CTCTGGGAGAGCAGGGCACACGG - Intronic
1167960208 19:53099009-53099031 GTCGGGCTGAGGAGTCCTCAGGG - Intronic
1168132731 19:54331673-54331695 CTGTGGGAGAGGAGACCACAGGG + Intergenic
1168403769 19:56100405-56100427 CCCTGTCTGAGGACCCCACAAGG + Intronic
925127549 2:1470854-1470876 CATCGGCAGAGGAGGCCACAGGG + Intronic
926392101 2:12403838-12403860 CCATGGCTGGGGAGGCCTCATGG - Intergenic
926445874 2:12942370-12942392 CCATGGCTGGGGAGGCCTCATGG + Intergenic
926745385 2:16152644-16152666 CTCTGGCTCAGGATCTCACATGG + Intergenic
926992065 2:18690583-18690605 CTCTGGCTGAGGATGCAGAATGG - Intergenic
927050257 2:19321234-19321256 CTCTGCTTGAGGAGGGCACCGGG + Intergenic
927940473 2:27100140-27100162 CCCTGGCTGGGGAGGACACTCGG + Exonic
929067749 2:37996951-37996973 CTCTGGGTCAGGAGGCCAGTTGG + Intronic
929529881 2:42743028-42743050 CTCTGATAGAGGAGCCCACAGGG - Intronic
930675381 2:54195569-54195591 CTGGGGCTGCGGGGGCCACATGG - Intronic
930877809 2:56239313-56239335 CTCTGGATGATGAAGCCCCAAGG + Intronic
931247921 2:60506421-60506443 AGCTGGCTCAGGACGCCACATGG + Intronic
931635492 2:64337550-64337572 CTCTGGCTGAGCCTGGCACAGGG + Intergenic
932056481 2:68448542-68448564 CTCAGGCTGAGTGGGCAACATGG + Intergenic
932703414 2:74005649-74005671 TGCTGGCTGAGGAAGCCCCATGG + Intronic
933950064 2:87321410-87321432 CACTGGCTGAGGCGGACACATGG - Intergenic
934051874 2:88218101-88218123 CTCTGGCCTCGGAGGCCACGTGG - Intergenic
934144027 2:89074361-89074383 ATATGGCTGGGGAGGCCTCACGG - Intergenic
934225217 2:90126197-90126219 ATATGGCTGGGGAGGCCTCACGG + Intergenic
934963949 2:98703641-98703663 CACTGGATATGGAGGCCACAGGG - Intronic
936330124 2:111540187-111540209 CACCGGCTGAGGCGGACACATGG + Intergenic
937241465 2:120465100-120465122 CCCAGGCTGAGGAGGCCTCATGG + Intergenic
937476227 2:122217885-122217907 CCAGGGCTGAGGTGGCCACAGGG - Intergenic
938528693 2:132162137-132162159 CTCAGGTTGAGGAGGGGACAGGG - Intronic
938944826 2:136202567-136202589 CATTGGCTGAGGAGGCCCCAGGG + Intergenic
941060045 2:160836708-160836730 CTCTGCCTGGGGAGGACACAGGG - Intergenic
942374783 2:175325826-175325848 CATTGGCTGAGGAGGCCCCAGGG - Intergenic
942834464 2:180277237-180277259 CTGTGGCAGTGGTGGCCACAGGG - Intergenic
946134404 2:217633912-217633934 CTTGGGCTGAAGAGGCCACATGG + Intronic
946515928 2:220411836-220411858 CTCTGTCTGAGGGAGCCCCATGG - Intergenic
946592209 2:221262970-221262992 CCTTGGCTGTGGAGGTCACAGGG - Intergenic
947831673 2:233146006-233146028 TTCTGGCAGATGAGGACACAGGG - Intronic
1169118420 20:3081952-3081974 CTCTGGCTGAGGGGCCCTAATGG + Intergenic
1169875961 20:10297284-10297306 CTCTTGCTGAAGAGGCCACATGG - Intronic
1170299992 20:14872824-14872846 GTATGGCTGGGGAGGCCTCAGGG + Intronic
1170683491 20:18547651-18547673 ACGTGGCTGAGGAGGCCACAGGG - Intronic
1171395172 20:24828527-24828549 ACCTGGCTGTGGAGGCCAGAGGG - Intergenic
1172785171 20:37464001-37464023 CCCAGGGAGAGGAGGCCACATGG - Intergenic
1173021139 20:39269055-39269077 GGCTGGCTGAGGGGGCCACCAGG + Intergenic
1173252866 20:41373928-41373950 CTCTAGCTGTGGTGGGCACAGGG - Intergenic
1174431563 20:50473632-50473654 TTCTGGCTTACGTGGCCACATGG + Intergenic
1175419884 20:58824688-58824710 TTCTGGCAGGGGAGACCACAAGG - Intergenic
1175971835 20:62690226-62690248 CTCTGTCTCAGGGGCCCACAGGG + Intergenic
1176047597 20:63100883-63100905 AACTGCCTGAGGGGGCCACACGG + Intergenic
1176297618 21:5082700-5082722 CTATGGCTGAGCAGACCATAAGG + Intergenic
1176372628 21:6071599-6071621 CTATGGTTGCAGAGGCCACAAGG - Intergenic
1176386253 21:6139850-6139872 CTCTGGGGGAGGTGACCACAGGG + Intergenic
1177320541 21:19514030-19514052 CTCTGCCTGAGGGAGCCACATGG + Intergenic
1177896586 21:26860896-26860918 CATTGGCTGAGGAGGCCCCAGGG - Intergenic
1178589726 21:33899094-33899116 CTCTGGCTGGGGTGGCAAGAGGG + Exonic
1178821942 21:35983304-35983326 CTCGGGCTGTGGAGGCATCAAGG - Intronic
1179020943 21:37640444-37640466 CTCTGCCTGAGGACACCACTAGG + Intronic
1179159208 21:38878119-38878141 CTCTGGCTTTGGAGGTCATATGG + Intergenic
1179249929 21:39664193-39664215 AGGTGGCTGGGGAGGCCACAGGG - Exonic
1179522690 21:41955400-41955422 CTCTGCAAGAGGAGGGCACAGGG - Intergenic
1179737220 21:43398402-43398424 CTCTGGGGGAGGTGACCACAGGG - Intergenic
1179750848 21:43466646-43466668 CTATGGTTGCAGAGGCCACAAGG + Intergenic
1179859411 21:44179249-44179271 CTATGGCTGAGCAGACCATAAGG - Intergenic
1180868465 22:19133118-19133140 CACTGGGTGGGGAGGGCACACGG - Exonic
1181421709 22:22803733-22803755 CTCTGCCTGAGGAGGCAACATGG + Intronic
1181463061 22:23096630-23096652 CTCAGGGTGTGGAGGCCACAGGG + Intronic
1181468765 22:23125363-23125385 CATTGGCTGAGGTGTCCACATGG - Intronic
1182517120 22:30865198-30865220 CTCTGGCTGAGGAGGCCACAGGG - Intronic
1182518286 22:30871271-30871293 CCCTGGCTCTGGAAGCCACACGG + Intronic
1183236377 22:36621724-36621746 CACTGGCAGGGGAGGACACAGGG - Intronic
1183717152 22:39540201-39540223 CTGTGGCTGAGGAAACCCCAGGG - Intergenic
1183801149 22:40165654-40165676 ACATGGCTGAGGAGGCCTCAGGG + Intronic
1183827308 22:40398443-40398465 ATCTGGCTGTGGAGGCCTGAAGG - Intronic
1184370591 22:44079511-44079533 CCCAGGCTGAGGAGGACAGAGGG + Intronic
1184590391 22:45478188-45478210 CTCTGGCTGTGCACGCCCCAGGG + Intergenic
1184602495 22:45551958-45551980 CTCAGGCTTAGGAGGCGCCAGGG - Intronic
950141815 3:10620924-10620946 CTGTGAGTGAGGAGGACACAGGG - Intronic
950496738 3:13338297-13338319 CTCTGACTGAGCAGGGTACAGGG + Intronic
950656721 3:14441222-14441244 TTCTGGGTGAGGAGGCTCCAGGG + Intronic
951702456 3:25509961-25509983 GTCTTGCTGAGGAGGCCACAGGG - Intronic
951838388 3:27006403-27006425 CATTGTCTGAGGAGGCCCCAGGG - Intergenic
952962188 3:38599141-38599163 CTCAGGCTGGGGATGCCACAGGG + Intronic
953079962 3:39607980-39608002 CTGTGTCTGAGGAAGCCCCATGG - Intergenic
953440016 3:42908874-42908896 CTCTGGATGGAGAGGCCCCAAGG + Exonic
954213530 3:49111633-49111655 CTATGGCTGAGGGGGACACAGGG - Exonic
958629343 3:96667507-96667529 CATTGGCTGAGGAGGCCCCAGGG + Intergenic
959368406 3:105492058-105492080 GTATGGCTGGGGAGGCCTCAGGG + Intronic
959917727 3:111836674-111836696 ACATGGCTGAGGAGGCCTCAGGG + Intronic
960374622 3:116884253-116884275 CTCTGGCTGAGGACCCAAAAAGG - Intronic
960740390 3:120826843-120826865 CTCTGTATGAGGATGCCTCAGGG - Intergenic
961330702 3:126136327-126136349 CTTTGGCTCATGATGCCACAAGG + Intronic
961484867 3:127209569-127209591 ACCTGGCTGAGGGGGACACAGGG + Intergenic
963126394 3:141820826-141820848 CATTGACTGAGGAGGCCCCAAGG - Intergenic
963908179 3:150791503-150791525 CTCTGTGTGTGGAGGGCACATGG - Intergenic
967368521 3:188715829-188715851 TTCTGGCTGAGGAGCCCTCAAGG + Intronic
968579077 4:1381367-1381389 GTATGGCTGAGGAGGCCAGAGGG - Intronic
968878569 4:3286940-3286962 CTCGGGCTGGGGAGGCCTCGGGG + Intergenic
969207309 4:5656546-5656568 CTCTCTCTTAGGAGGCCACTTGG - Intronic
974004046 4:56538056-56538078 CTCTGGCTGCGGTAGCCATAGGG - Intronic
975313336 4:72926779-72926801 CATTGGCTGAGGAGGTCCCAGGG + Intergenic
976190061 4:82478959-82478981 CATTGGCTGAGGAGGTCCCAGGG - Intergenic
976474499 4:85468303-85468325 CTCAGGCTGGGGAGGGCAAATGG - Intergenic
977368271 4:96101413-96101435 ACATGGCTGAGGAGGCCTCAGGG + Intergenic
977945915 4:102913919-102913941 CTCTGTCTAAGCAGGGCACAAGG - Intronic
980276739 4:130662089-130662111 ATATGGCTGACGAGGCCTCATGG - Intergenic
981074262 4:140575857-140575879 CACTGGCTGAGAAGGCCTCCTGG - Intergenic
982066376 4:151658141-151658163 ATGTGTCTAAGGAGGCCACATGG - Intronic
982790696 4:159587800-159587822 GCATGGCTGAGGAGGCCTCAGGG + Intergenic
983147896 4:164241146-164241168 TTCTGGGTGAGGGGGTCACAGGG - Intronic
983181869 4:164657462-164657484 CATTGGCTGAGGAGGCCCCAGGG - Intergenic
984955741 4:185043739-185043761 TTCTGGCTGAGGAAGCTACCAGG + Intergenic
985644463 5:1078440-1078462 CCCTTCCTGGGGAGGCCACAGGG - Intronic
986525746 5:8673205-8673227 ACCTGGCTGGGGAGGCCTCAGGG + Intergenic
987744232 5:21948986-21949008 GCATGGCTGAGGAGGCCTCATGG - Intronic
988193904 5:27975975-27975997 ATGTGGCTGAGGTGGCCTCATGG - Intergenic
989688321 5:44113918-44113940 CATTGGCTGAGGAGGCCCCAGGG - Intergenic
991686909 5:69189775-69189797 CCCCGGCTGAGGAGGCCAAAGGG - Intronic
991764434 5:69959123-69959145 GCATGGCTGAGGAGGCCTCATGG - Intergenic
991782890 5:70159024-70159046 GCATGGCTGAGGAGGCCTCATGG + Intergenic
991843666 5:70834195-70834217 GCATGGCTGAGGAGGCCTCATGG - Intergenic
991875333 5:71159351-71159373 GCATGGCTGAGGAGGCCTCATGG + Intergenic
992492150 5:77255647-77255669 CTCTGGCTGAGGCAGCAACCTGG + Intronic
992950875 5:81857043-81857065 CTCTGCCAGAGGAGGCCTGATGG - Intergenic
997356631 5:133266863-133266885 CACTGAGTGAGGAGCCCACAAGG - Intronic
998753814 5:145353546-145353568 GCATGGCTGAGGAGGCCTCAGGG + Intergenic
999194432 5:149772379-149772401 ATTTGGCTGAGGAGGCTGCATGG + Intronic
1001234866 5:170021152-170021174 ATCTGGCTGAGTAGGTCAAATGG + Intronic
1001531966 5:172469691-172469713 CAGTGGCAGTGGAGGCCACATGG - Intergenic
1001636164 5:173211801-173211823 CACTGGCTGTAGAGGCCAGAGGG + Intergenic
1002067784 5:176660874-176660896 CTCTGGGTGAGGTGGTCATATGG + Intergenic
1002890890 6:1330728-1330750 CATTGGCTGAGAAGGCCCCAGGG + Intergenic
1004181014 6:13380583-13380605 GGCTGGCTGGGGTGGCCACAGGG + Intronic
1004989887 6:21125337-21125359 TTATGGCTGGGGAGGCCTCAGGG - Intronic
1005417671 6:25619078-25619100 CTATGACTGAGGAGGTCACCTGG + Intronic
1006336328 6:33422733-33422755 ATCTGGCTGTGGAGGCCCCAGGG - Intronic
1008382032 6:50846823-50846845 CTATGGGTGTGGAGGCCAGAAGG - Exonic
1008723408 6:54386538-54386560 CTCTGTGTGAGGGAGCCACATGG - Intronic
1010628407 6:78167652-78167674 ATGTGGCTGGGGAGGCCTCAGGG + Intergenic
1011600068 6:89051779-89051801 TCATGGCTGAGGAGGCCTCAGGG + Intergenic
1012100955 6:95084786-95084808 CCCTGGCTCAGGAAGCCCCAAGG - Intergenic
1012316816 6:97791234-97791256 CTCTGTCTGAGGGAGCCCCAAGG + Intergenic
1012549702 6:100455562-100455584 GATTGGCTGCGGAGGCCACACGG + Intronic
1012618063 6:101302425-101302447 ATATGGCTGAGGAGGCCTCAGGG - Intergenic
1013022713 6:106235106-106235128 CATTGGCTGAGGAGGCCCCAGGG - Intronic
1014865200 6:126521025-126521047 CTGTGGTGGAGGTGGCCACAGGG - Intergenic
1015495891 6:133882970-133882992 GTCAGGTTGAGGAAGCCACATGG + Intergenic
1015683747 6:135836026-135836048 CTCTGGAGGAGGCAGCCACAAGG - Intergenic
1016154044 6:140781182-140781204 CTGTGGTGGTGGAGGCCACAAGG + Intergenic
1018523425 6:164679189-164679211 CCATGGCTGGGGAGGCCTCAGGG + Intergenic
1019129069 6:169860271-169860293 CTCTGGCTCAGGGATCCACACGG - Intergenic
1019146604 6:169979282-169979304 CTCTGGCTGAGAAGGCATCTAGG - Intergenic
1019390779 7:785680-785702 CTCTGGCTCAGGTGGGGACAAGG - Exonic
1019750416 7:2725646-2725668 CTCTGGGAGTGGAGCCCACAGGG - Intronic
1019901193 7:4021953-4021975 CTGAGGCTGAGGAGCCCTCAGGG - Intronic
1019978531 7:4604368-4604390 CTCAGGCTGAGGAGCCTGCAGGG - Intergenic
1021413912 7:20359968-20359990 ATCTGGAGGAGGTGGCCACATGG - Intronic
1021901194 7:25287537-25287559 CTCTGGCTCAGGAGGCTGCCTGG + Intergenic
1022386662 7:29905765-29905787 CTCTGGCTGAAGTGGCCTCCTGG + Intronic
1023929833 7:44698522-44698544 CCCTTGCTGAGGAGCTCACATGG - Intronic
1026302713 7:69111786-69111808 CTATGGCTGGGGAGGCCTCAGGG + Intergenic
1028587839 7:92469051-92469073 CATTGGCTGAGGAGGCCCCAGGG + Exonic
1031569131 7:123336413-123336435 GCATGGCTGAGGAGGCCTCAGGG + Intergenic
1032876178 7:136040836-136040858 CTCTTGATGAAGAGGCCAGATGG - Intergenic
1034276854 7:149827656-149827678 CTGTGGCTGAGAAGGCAAGATGG + Intergenic
1034737792 7:153445229-153445251 CTCTGGCTGGGAAAGGCACAGGG - Intergenic
1034845290 7:154438890-154438912 CTCTGGCTGAGGAGGAGAGGAGG + Intronic
1034901253 7:154909379-154909401 CTCTGGCAGAGGAGGGGACTGGG + Intergenic
1035458202 7:159023251-159023273 ATCTTGCTGGGGAGGCCACTGGG + Intergenic
1035473312 7:159125385-159125407 CCCTGGGTGAGGAGGACACAAGG + Intronic
1035577248 8:715664-715686 CCTTGGCTGGGGAGTCCACAGGG + Intronic
1035621239 8:1036981-1037003 CACTGGCTCAGGAGGCTCCACGG - Intergenic
1035697915 8:1614290-1614312 CTCTGGCTGCAGAGGCCCCACGG - Intronic
1037392436 8:18407912-18407934 CTCCGTCTGGGGAGGCCTCAGGG - Intergenic
1037921775 8:22811666-22811688 CTCTGGTTCAGGAGGTCACAGGG + Intronic
1039289306 8:36077091-36077113 CTCTGGCTGGGCAGTCCCCATGG + Intergenic
1043555214 8:81422267-81422289 ATTTGGGTGAGGAGGACACAGGG - Intergenic
1044900340 8:96937318-96937340 CTATGGCTGAGTGGGCCAGATGG + Intronic
1045505234 8:102773548-102773570 CTATTGCTGGGGAGACCACATGG - Intergenic
1046211300 8:111080658-111080680 CTCAGGTGGAGGTGGCCACAGGG - Intergenic
1046834373 8:118783043-118783065 CTCTGGGTAAGTAAGCCACATGG - Intergenic
1048272417 8:133040162-133040184 CACTGGCTGAGGCGTCCCCAGGG - Intronic
1048334590 8:133493047-133493069 CTCTGTCTGAGCTGGCCACCAGG + Intronic
1049245272 8:141559097-141559119 CTCTTGCTGAGGGCACCACATGG - Intergenic
1049265919 8:141667859-141667881 CTGGAGCTGAGGAAGCCACAGGG + Intergenic
1049470880 8:142774546-142774568 CTCTGCCTCAGCAGGCCCCAGGG - Intronic
1050890651 9:10820129-10820151 ATATGGCTGAGGATGCCTCAGGG + Intergenic
1051054172 9:12964322-12964344 CCTTCGCAGAGGAGGCCACAAGG - Intergenic
1051242569 9:15075362-15075384 CCATGGCTGGGGAGGCCTCAGGG + Intergenic
1053352910 9:37425015-37425037 CACAGGCTGAGGGGCCCACAGGG - Intronic
1055233826 9:74094404-74094426 ACATGGCTGAGGAGGCCTCAGGG - Intergenic
1056329341 9:85509003-85509025 GCCTGGCTGAGCAGGCCAGAGGG + Intergenic
1056480507 9:86998967-86998989 CTCTGCCTGAGAAGTCAACATGG + Intergenic
1057044622 9:91875842-91875864 CTGTGGCTGAGGGAGCCACTTGG - Intronic
1057058352 9:91981376-91981398 CATTGGCTGAGGAGGCCGCAGGG - Intergenic
1057455668 9:95207635-95207657 CTCTGACTGAGCAGGTCAGACGG + Intronic
1057484194 9:95469353-95469375 GTCAGTCTGAGGAGGCCACATGG + Intronic
1058522753 9:105828404-105828426 CTCGGGCAGTGGTGGCCACAGGG - Intergenic
1059089194 9:111337478-111337500 CATTGGCTGAGGAGGCCCCAGGG - Intergenic
1059524743 9:114980233-114980255 CTATGGCTGAGGACTCCACAGGG + Intergenic
1060214151 9:121728309-121728331 CTCTAACTGATGAGCCCACAGGG - Intronic
1061323839 9:129849958-129849980 CACGGACTGAGGAGGACACATGG + Intronic
1061391034 9:130317102-130317124 CTCTGGCTGGGGCAGCCACCAGG + Intronic
1061584667 9:131558084-131558106 CCCAGGCTGAGGAGGCCTCGCGG + Intergenic
1061587759 9:131579566-131579588 ACCTGGCTGAGGAGGCCCTATGG - Exonic
1062572366 9:137191543-137191565 CTCTGCAGGAAGAGGCCACATGG - Intergenic
1185469445 X:373821-373843 CTCAGGCTGAGGAGGGCGCATGG + Intronic
1186253948 X:7699848-7699870 CATTGGCTGAGGAAGCCCCAGGG + Intergenic
1186664323 X:11702928-11702950 TTCTGACTGAGGAGTCCACCAGG + Intergenic
1187064204 X:15816998-15817020 CACTGGCCGAGGAGGCCATGTGG + Intronic
1187225752 X:17374726-17374748 CTCTGGCTGCTCTGGCCACATGG + Intergenic
1188016430 X:25112277-25112299 CTAAGGCTGAGCAGGGCACAGGG + Intergenic
1188495359 X:30777865-30777887 CTGCTGCTGGGGAGGCCACAGGG - Intergenic
1189122324 X:38407937-38407959 CTCTGGGTGAGGAGACATCATGG - Intronic
1191083920 X:56544715-56544737 TTATGGCTGAGGAGGCCTCAGGG + Intergenic
1192213188 X:69140545-69140567 CTCTGGCTGATGATGACCCAGGG - Intergenic
1194212448 X:91084515-91084537 GCATGGCTGAGGAGGCCTCATGG + Intergenic
1194435221 X:93860976-93860998 GCCTGGCTGGGGAGGCCTCAGGG - Intergenic
1194895419 X:99433556-99433578 TTATGGCTGCGGAGGCCTCAGGG - Intergenic
1195250981 X:103046837-103046859 GTATGGCTGAGGAGGCCTCAGGG - Intergenic
1195624382 X:106992388-106992410 CTCTAGTTCAGGAAGCCACAGGG + Intronic
1197861849 X:130979551-130979573 CTCTGGGTGAGGTGGGCAAAAGG - Intergenic
1198766030 X:140080121-140080143 CACTGGCTGAGGAGGCCCCAGGG - Intergenic
1199170606 X:144731093-144731115 GCATGGCTGAGGAGGCCTCAGGG + Intergenic