ID: 1182517579

View in Genome Browser
Species Human (GRCh38)
Location 22:30867808-30867830
Sequence TGTAAGCAAGAGCTGGTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 447
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 422}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182517579_1182517587 18 Left 1182517579 22:30867808-30867830 CCTCTCACCAGCTCTTGCTTACA 0: 1
1: 0
2: 0
3: 24
4: 422
Right 1182517587 22:30867849-30867871 GGCTGACCCGCATCTGCATTGGG No data
1182517579_1182517585 -3 Left 1182517579 22:30867808-30867830 CCTCTCACCAGCTCTTGCTTACA 0: 1
1: 0
2: 0
3: 24
4: 422
Right 1182517585 22:30867828-30867850 ACAGAGCAGGGGTCACATTTGGG No data
1182517579_1182517586 17 Left 1182517579 22:30867808-30867830 CCTCTCACCAGCTCTTGCTTACA 0: 1
1: 0
2: 0
3: 24
4: 422
Right 1182517586 22:30867848-30867870 GGGCTGACCCGCATCTGCATTGG 0: 1
1: 0
2: 0
3: 3
4: 68
1182517579_1182517584 -4 Left 1182517579 22:30867808-30867830 CCTCTCACCAGCTCTTGCTTACA 0: 1
1: 0
2: 0
3: 24
4: 422
Right 1182517584 22:30867827-30867849 TACAGAGCAGGGGTCACATTTGG 0: 1
1: 0
2: 1
3: 6
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182517579 Original CRISPR TGTAAGCAAGAGCTGGTGAG AGG (reversed) Intronic
900324217 1:2100066-2100088 TGTCAGCAAGACCTGGGGAATGG - Intronic
900978431 1:6032123-6032145 TGAATGCAAGAGTTGGTGAGAGG - Intronic
901157996 1:7153644-7153666 TGTGAGAAAGAGCAGGTGGGAGG - Intronic
901753172 1:11424508-11424530 TGAAAGCAGGAGCAGGGGAGTGG - Intergenic
902208602 1:14888276-14888298 TGGAAGAAAAAGCAGGTGAGGGG - Intronic
902662215 1:17913122-17913144 TGAAAGCTAGATCTGGGGAGGGG + Intergenic
903309949 1:22447380-22447402 TGAAATCAAGACTTGGTGAGTGG + Intergenic
904289223 1:29473392-29473414 TGTGAGCGAGAGCTGGTGTTAGG - Intergenic
905245078 1:36607109-36607131 TGTGAGCCAGAGCTGGGGTGTGG - Intergenic
905429208 1:37909405-37909427 TGTAAGCCAGACCGGGTGTGAGG - Intronic
906049448 1:42858274-42858296 TGTAAGCCAGACCAGGTGTGAGG - Intergenic
907119726 1:51997941-51997963 CGTAAACAGCAGCTGGTGAGAGG - Intergenic
907503631 1:54901817-54901839 TGTAAGCCAGACCAGGTGTGAGG + Intergenic
908592016 1:65645824-65645846 TGTAAGCCAGACCAGGTGTGAGG + Intergenic
909014646 1:70369123-70369145 TGTAAGCTGGACCTGGTGTGAGG - Intronic
909793041 1:79700293-79700315 TGTAAGCCAGACCAGGTGTGAGG + Intergenic
909909895 1:81247200-81247222 TGTAAGCCAGACCAGGTGTGAGG - Intergenic
910841024 1:91561325-91561347 TGTAAGAAGGACCTGGTGAGGGG - Intergenic
911285158 1:95982632-95982654 TTGAAGCAAGAGATGGTAAGTGG + Intergenic
911510686 1:98805228-98805250 TGTAAGCCAGACCGGGTGTGAGG + Intergenic
912424700 1:109576864-109576886 GGGAAGCAAGAGCAGGTCAGTGG + Intronic
913112651 1:115670384-115670406 TGCATGCATGAGCTGGAGAGAGG - Intronic
913299906 1:117359745-117359767 TGTAAGGTAGCGATGGTGAGAGG - Intergenic
913581399 1:120231144-120231166 TGTAAGAAAGAGTTGGTGTTTGG + Intergenic
913626777 1:120667247-120667269 TGTAAGAAAGAGTTGGTGTTTGG - Intergenic
914329955 1:146658515-146658537 AGTATGCAAGAACTGGTGATAGG - Intergenic
914563331 1:148842587-148842609 TGTAAGAAAGAGTTGGTGTTTGG + Intronic
914609496 1:149287636-149287658 TGTAAGAAAGAGTTGGTGTTTGG - Intergenic
916465386 1:165069245-165069267 TCTAAGCAAGAACTGTTGATGGG - Intergenic
917925905 1:179788996-179789018 TGTCAGCATGGGCTGGAGAGTGG - Intronic
918347048 1:183615409-183615431 TGTAAGCCAGACCAGGTGTGAGG - Intergenic
918714473 1:187769446-187769468 TGTAAGCCAGACCAGGTGTGAGG + Intergenic
919464544 1:197913218-197913240 AGGAAGCAAAAGCTGGCGAGAGG + Intronic
920227576 1:204449656-204449678 TGTAACCAAGAGCCACTGAGCGG - Intronic
922048346 1:221967717-221967739 TGTAAGCCGGAGCAGGTGTGAGG - Intergenic
922154136 1:223028353-223028375 TGTAAGCCAGACCAGGTGTGAGG + Intergenic
922906335 1:229176181-229176203 TGTAAGCCAGACCGGGTGTGAGG - Intergenic
923244688 1:232119939-232119961 TGTAAGCCAGACCGGGTGTGAGG - Intergenic
923257339 1:232233152-232233174 TGTAAGCCGGAGCAGGTGTGAGG + Intergenic
923408688 1:233687382-233687404 TGTAAGCCAGACCGGGTGTGAGG + Intergenic
1063364386 10:5480902-5480924 CTGAAGCAAGAGCTGGGGAGTGG - Intergenic
1064527606 10:16274195-16274217 TGCAAGCAACAGCTTGTGAGGGG + Intergenic
1066460827 10:35610786-35610808 TGTATGGAAGGGCTGGGGAGAGG + Intergenic
1067084568 10:43230964-43230986 GGTAGAGAAGAGCTGGTGAGAGG - Intronic
1068058413 10:52037713-52037735 TGTAAGCCAGACCAGGTGTGAGG + Intronic
1068589763 10:58841453-58841475 AGTAATGAAGAGCTGGTAAGTGG - Intergenic
1069886436 10:71626856-71626878 TGAAATCACAAGCTGGTGAGAGG - Intronic
1070000055 10:72369551-72369573 TGTAATGGAGAGATGGTGAGGGG + Intronic
1070812222 10:79304161-79304183 TGCAAGCATGTGCAGGTGAGCGG + Exonic
1071103397 10:82065301-82065323 TGCAGGCCAGACCTGGTGAGAGG - Intronic
1071550860 10:86565223-86565245 TGTAAGCCAGACCGGGTGTGAGG + Intergenic
1071897796 10:90084990-90085012 TGTAAGCCAGAGCAGGTGTGAGG + Intergenic
1072661629 10:97366918-97366940 GGCAAGGAAGGGCTGGTGAGAGG + Intronic
1072777281 10:98211552-98211574 TGTTCGCAAGAGTTGGTGAAAGG + Intronic
1073711177 10:106044437-106044459 TGGATGCTAAAGCTGGTGAGAGG - Intergenic
1076434466 10:130430624-130430646 GGGAAGCAAGAGTGGGTGAGGGG + Intergenic
1077723194 11:4647569-4647591 TGTGAGGATGGGCTGGTGAGGGG + Intronic
1078748886 11:14141142-14141164 AGTAAGCAGGAGCTAGTGCGTGG - Intronic
1079447398 11:20569550-20569572 TGTAAGCCAGACCAGGTGTGAGG - Intergenic
1081356744 11:42122337-42122359 TGTAAGCCAGACCAGGTGTGAGG - Intergenic
1082888900 11:58117587-58117609 TCTAATGAAGATCTGGTGAGAGG - Intronic
1084656876 11:70524850-70524872 TGTGTGCATGAGATGGTGAGAGG - Intronic
1085359508 11:75873811-75873833 TGTAAGGTAGAGTTGGTGAAGGG + Intronic
1086550140 11:88044910-88044932 TGTAAGCCAGACCGGGTGTGAGG - Intergenic
1086945210 11:92837975-92837997 TGTGAGTAAGAGCTATTGAGGGG + Intronic
1087196849 11:95311292-95311314 TGTAAGCCAGACCAGGTGTGAGG - Intergenic
1087677695 11:101181563-101181585 TGTAGGCCAGAGCTGGTGATAGG + Intergenic
1087822793 11:102730801-102730823 TGTGAGGAAGAGCAGGTGTGTGG - Intergenic
1087822799 11:102730844-102730866 TGTGAGGAAGAGCAGGTGTGTGG - Intergenic
1087822830 11:102731032-102731054 TGTGAGAAAGAGCCGGTGTGTGG - Intergenic
1088031940 11:105262037-105262059 GGGAAGAAAGAGCTGGAGAGAGG + Intergenic
1088804290 11:113337791-113337813 TCCAAGCAAGAGGTGGTGATGGG + Intronic
1089359967 11:117879217-117879239 TCTGAGCAAGAATTGGTGAGAGG + Intergenic
1089643711 11:119864364-119864386 GGTCAGTAAGAGCTGGTGGGTGG - Intergenic
1089765346 11:120759160-120759182 GGCAAGCAAGAGCTGGGGAGTGG + Intronic
1089953189 11:122548322-122548344 TGTAAGCCAGACCAGGTGTGAGG - Intergenic
1090755870 11:129791189-129791211 TGACAGCAGGATCTGGTGAGAGG - Intergenic
1090872025 11:130757457-130757479 TGTAAGCCAGACCAGGTGTGAGG + Intergenic
1092531911 12:9352027-9352049 TGTGAGCTAGGGCTGGGGAGGGG - Intergenic
1092723781 12:11466121-11466143 TGTAAGCCAGACCAGGTGTGAGG + Intronic
1093358370 12:18196690-18196712 TGTAAGCCAGACCAGGTGTGAGG - Intronic
1093392528 12:18639743-18639765 TTTAAGGAAGAACTGGGGAGTGG + Intronic
1093578750 12:20765138-20765160 TGTAAGCCAGACCAGGTGTGAGG - Intergenic
1094023654 12:25940648-25940670 TGTAAGAAAGAGAGGGAGAGGGG - Intergenic
1094582955 12:31751116-31751138 TCTTTGGAAGAGCTGGTGAGGGG + Intergenic
1097152055 12:56986434-56986456 TGGAGGCAGGAGCTGGTGGGAGG + Intergenic
1099706053 12:86154201-86154223 TATAAGCAAGAAATGGTGGGGGG - Intronic
1104095272 12:125551367-125551389 TGTAAGCTAGAGCTAGAAAGTGG - Intronic
1105448701 13:20479351-20479373 TGTTATCAAGAGCTGGAAAGGGG + Intronic
1105809573 13:23982995-23983017 TGAAAGGAGGAGCTGGAGAGGGG + Intronic
1105930121 13:25044465-25044487 TGAAAGGAGGAGCTGGAGAGGGG - Intergenic
1106322519 13:28655323-28655345 TGTTAGAAAGAGTTGGTGAAGGG - Intergenic
1106598066 13:31163426-31163448 TGTAAGAAAAAGTTGGTGGGCGG - Intergenic
1106943380 13:34800406-34800428 TGTAAGCCAGACCAGGTGTGAGG - Intergenic
1107075515 13:36318203-36318225 TGTAAGCCAGACCAGGTGTGAGG - Intronic
1108269315 13:48743571-48743593 TGGAAGCAAGAGGTGGGGAGGGG - Intergenic
1108282138 13:48871110-48871132 TGTAAGCCAGACCAGGTGTGAGG + Intergenic
1108919611 13:55658925-55658947 TGTAAGCAGGACCAGGTGTGAGG + Intergenic
1108947369 13:56042073-56042095 TGTAAGCAGGACCAGGTGTGAGG - Intergenic
1109499234 13:63214884-63214906 TGTAAGCCAGACCAGGTGTGAGG - Intergenic
1109748673 13:66661360-66661382 TTTGGGGAAGAGCTGGTGAGGGG - Intronic
1110211976 13:72984536-72984558 TGTAAGAATGAGCTGTTGTGAGG - Intronic
1111126105 13:83912232-83912254 TGTAAGCCAGACCAGGTGTGAGG + Intergenic
1111630377 13:90841206-90841228 TGTAAGCCAGACCAGGTGTGAGG - Intergenic
1112813962 13:103251040-103251062 TGTCAGAAACAGCTGGTGGGGGG + Intergenic
1113324271 13:109267105-109267127 TGTAAGCCAGACCAGGTGTGAGG - Intergenic
1113498752 13:110756355-110756377 TGTTAGGCAGAGCTGCTGAGAGG - Intergenic
1115903731 14:38183936-38183958 TGTAAGCTAGATCTCTTGAGGGG + Intergenic
1116534841 14:46016355-46016377 TGTAAGCCAGACCAGGTGTGAGG + Intergenic
1116569886 14:46502918-46502940 TGAAAGCAAGAGCAAGAGAGAGG + Intergenic
1116952848 14:50894932-50894954 TGTAAGCAGGACCAGGTGTGAGG - Intronic
1117867867 14:60167996-60168018 TGTAAGCCAGAGCTTGTGGAGGG - Intronic
1118438967 14:65795842-65795864 GGGCAGCTAGAGCTGGTGAGAGG + Intergenic
1119535081 14:75396313-75396335 TGTAAAATAGAGCTGTTGAGAGG + Intergenic
1120386878 14:83857664-83857686 TGTAACCAACACCTGGTGACAGG + Intergenic
1120438118 14:84504157-84504179 TGTAAGCCAGACCGGGTGTGAGG + Intergenic
1121413189 14:93761981-93762003 TGTAAGCAATACCATGTGAGGGG - Intronic
1121556297 14:94840313-94840335 TGTAAGCAAGACCTGGAGGTGGG + Intergenic
1121654884 14:95588105-95588127 TGGAGGCAAGAGGTGGTGAGTGG + Intergenic
1123882561 15:24689535-24689557 TGTAAGCAGGACCAGGTGTGAGG + Intergenic
1125045709 15:35240531-35240553 TGTAAGCCAGACCAGGTGTGAGG - Intronic
1125131581 15:36289591-36289613 TGTAAGCTGGAGCAGGTGTGAGG + Intergenic
1125576622 15:40760115-40760137 TGTAAGCAAGCGCAGCTGGGAGG - Intergenic
1125629106 15:41132898-41132920 TGTAAGCCAGACCGGGTGTGAGG - Intergenic
1126912468 15:53430785-53430807 TGTAAGCCAGACCAGGTGTGAGG + Intergenic
1129179171 15:73860801-73860823 TGTGAGCAGGAGCTGTTGTGTGG + Intergenic
1129443270 15:75598072-75598094 TGTAAGAAAGAACTGGTTTGTGG - Exonic
1131882580 15:96875782-96875804 TGTAAGCCAGACCCGGTGTGAGG + Intergenic
1132371630 15:101303396-101303418 TGAAAACAAGAGTGGGTGAGGGG - Intronic
1134453642 16:14378720-14378742 TGGAAGAAAGAGATGGGGAGGGG + Intergenic
1138244609 16:55458170-55458192 TGTAAGGGAGAGCTGAGGAGAGG + Intronic
1140003600 16:71052398-71052420 AGTATGCAAGAACTGGTGATAGG + Intronic
1140489358 16:75321441-75321463 AGTTGCCAAGAGCTGGTGAGGGG - Intronic
1140959080 16:79895451-79895473 TGTAAGCAGGGAGTGGTGAGTGG - Intergenic
1142299860 16:89250402-89250424 GGTAAGGAAGAGCTGGTCAATGG - Intergenic
1143547935 17:7610745-7610767 TGAAGGCAAGAGCAGGTGGGTGG + Intronic
1143723093 17:8827329-8827351 TGGAAGGCAGAGCTGGAGAGAGG - Intronic
1144104605 17:11973668-11973690 TGTAAGCCGGAGCAGGTGTGAGG - Intergenic
1144164712 17:12598834-12598856 TGTAAGCAAAATCTGTTGAAAGG - Intergenic
1145080739 17:19892417-19892439 TGTAAGCCAGATCGGGTGTGAGG + Intergenic
1145263113 17:21366351-21366373 TGAAAACAAGAGCTGGGGTGGGG - Intergenic
1146429156 17:32774093-32774115 TGTAAGCCAGATCGGGTGTGAGG - Intronic
1146910878 17:36647707-36647729 TGTAAGGAAGGGGTGGGGAGGGG + Intergenic
1147248493 17:39138305-39138327 AGTAAGCAAGGGCAGGAGAGGGG + Intronic
1147441584 17:40450859-40450881 TGTAAGCTGGAACTGGGGAGTGG - Intronic
1147713144 17:42484673-42484695 TGGAAGGAAAGGCTGGTGAGTGG + Intronic
1147953497 17:44119959-44119981 TGGAAGAAAGAGTTGGTGTGAGG - Intronic
1148043945 17:44730883-44730905 TTTACACAGGAGCTGGTGAGGGG - Intronic
1148658197 17:49304553-49304575 TTTAAGGAAGAGCTGGTAAATGG + Intronic
1150500957 17:65650387-65650409 TGAAAGCAAGGGCTGGTGTGGGG - Intronic
1150860557 17:68796571-68796593 TGTAAGCCAGACCTGGTATGAGG + Intergenic
1151406293 17:73889054-73889076 TGTTAGCCAGGGCTGGAGAGTGG - Intergenic
1151511504 17:74563476-74563498 TGTGTGCAAGAGCTGGTGTGTGG - Intergenic
1151938082 17:77275838-77275860 AGTAATCAGGAGCTGGTGCGAGG - Intergenic
1152474438 17:80508869-80508891 TGAAGGCAAGAGCTCCTGAGTGG + Intergenic
1153979886 18:10299764-10299786 AGTATGCAAGAGATGGTGTGGGG + Intergenic
1155278716 18:24216127-24216149 TGTAAACAAGAGGTGACGAGAGG - Intronic
1155446351 18:25916786-25916808 TGAAAACAAGAGCTAGGGAGGGG - Intergenic
1155557050 18:27031398-27031420 TGGAAGCAAGTGTTGGGGAGAGG - Intronic
1156915748 18:42463296-42463318 TGTAAGCCAGACCGGGTGTGAGG - Intergenic
1157755611 18:50214583-50214605 TGTAAGCAAGACTGGGAGAGAGG - Intergenic
1157863204 18:51160039-51160061 TGGTAGCAGGAGCTGGGGAGTGG + Intergenic
1159965136 18:74587723-74587745 TGTAAGCAGTGGCTGGTTAGGGG - Intergenic
1160448514 18:78946159-78946181 TGTAAGAAAGACATGGTAAGTGG - Intergenic
1161711969 19:5853835-5853857 TGTAAGCCAGACCGGGTGTGAGG - Intergenic
1163598708 19:18235127-18235149 TGCTAGCAGGAGCTGGGGAGAGG - Intronic
1163944517 19:20523035-20523057 TGTAAGCCAGACCGGGTGTGAGG + Intergenic
1165431086 19:35773613-35773635 ATTAAGCAAGGGCTGGTGAAAGG - Intergenic
1165755191 19:38288791-38288813 TGGAAACCAGAGCTGGTGTGTGG - Intronic
1165912315 19:39236966-39236988 GGTGAGAAAGAGCAGGTGAGGGG + Intergenic
1165913499 19:39244167-39244189 GGTGAGAAAGAGCAGGTGAGGGG + Intronic
1165917459 19:39269456-39269478 GGTGAGAAAGAGCAGGTGAGGGG - Intronic
1166905867 19:46108035-46108057 TGTAAGCCAGACCAGGTGTGAGG + Intergenic
925191111 2:1884433-1884455 GGTCAGCAAGATCTGTTGAGTGG - Intronic
925828885 2:7876609-7876631 TGTAAGCCAGACCAGGTGTGAGG + Intergenic
926506054 2:13717704-13717726 TGTAAGAAAGCACTGGTGACTGG + Intergenic
927084245 2:19658694-19658716 TGTCAGCTAGAGGTGGTGATAGG + Intergenic
928779746 2:34804840-34804862 TGTAAGCCGGACCTGGTGTGAGG + Intergenic
928928503 2:36600798-36600820 TGTAAGCCAGACCAGGTGTGAGG - Intronic
929882267 2:45847313-45847335 TTTACCCAAGGGCTGGTGAGAGG - Intronic
930026390 2:47031736-47031758 AGTCAGCAAGAGATGCTGAGGGG - Intronic
930099190 2:47589991-47590013 TGTAAGCCAGACCAGGTGTGAGG + Intergenic
930955033 2:57194731-57194753 TGTAAGCCAGACCAGGTGTGAGG - Intergenic
931948190 2:67333340-67333362 TGTAAGCAGGACCAGGTGTGAGG - Intergenic
932620509 2:73262467-73262489 TGTATGAAAGAGCTGGTCATTGG - Intronic
933013028 2:77090140-77090162 TGTAAGCCAGACCAGGTGTGAGG - Intronic
933179833 2:79215792-79215814 TGTAAGCCAGACCGGGTGTGAGG + Intronic
933239068 2:79898889-79898911 TCTAAGAAAGAGTTGTTGAGAGG + Intronic
933539797 2:83625096-83625118 TCTTTGCAAGAGCTGGGGAGTGG - Intergenic
933539958 2:83626997-83627019 TCTTTGCAAGAGCTGGGGAGTGG - Intergenic
933901911 2:86856153-86856175 TGCAAGCCAGAGCTGGAGAGAGG + Intronic
935778633 2:106493111-106493133 TGCAAACCAGAGCTGGAGAGAGG - Intergenic
936483996 2:112911117-112911139 TGTAATCAACAGTTTGTGAGTGG - Intergenic
937056752 2:118943959-118943981 TGGCAGCAAGAGATGATGAGGGG + Intronic
937839007 2:126506904-126506926 TGTAAGGAATATCTGATGAGTGG - Intergenic
937961490 2:127463623-127463645 TGTCAGCCACAGCTGGAGAGAGG - Intronic
939565079 2:143777492-143777514 TTTGAACAAGACCTGGTGAGTGG - Intergenic
939625456 2:144471669-144471691 TGTAAGAAACACCTGGTAAGTGG + Intronic
939627718 2:144498541-144498563 GGGAGGCAAGAGCTGGTGAAAGG + Intronic
939678560 2:145102457-145102479 TGGAAGCAAGGCCTGGTGAGAGG - Intergenic
941340336 2:164297616-164297638 TGTAAGCCAGACCAGGTGCGAGG - Intergenic
941353320 2:164460877-164460899 TGTAAGCCGGAGCAGGTGTGAGG - Intergenic
941400960 2:165030529-165030551 TGTAGGAAAGACCTGGTGGGAGG + Intergenic
942451378 2:176109778-176109800 TGTAACCTAGAGGTGGTGGGAGG - Intronic
943606970 2:189987452-189987474 TATAAGTAAGATCTTGTGAGAGG + Intronic
943806583 2:192132183-192132205 TGTAAGCCAGACCAGGTGTGAGG - Intronic
943865283 2:192919795-192919817 TGTAAGCCAGACCAGGTGTGAGG - Intergenic
943951366 2:194134871-194134893 TGTAAGCCAGACCAGGTGTGAGG + Intergenic
944250962 2:197579865-197579887 TGTAAGCCAGACCAGGTGTGAGG - Intronic
945017870 2:205538705-205538727 TGTAAGCCAGATCTGCTCAGGGG + Intronic
945287784 2:208099512-208099534 TGGAAGTGAGGGCTGGTGAGAGG - Intergenic
945394236 2:209300987-209301009 TGTAAGCCGGAGCAGGTGTGAGG - Intergenic
945554624 2:211263221-211263243 TGTAAGCCAGACCGGGTGTGAGG - Intergenic
945858050 2:215091315-215091337 TGTAAGCCAGACCAGGTGTGAGG - Intronic
946375491 2:219306459-219306481 TGGAGTCAAGAGTTGGTGAGGGG - Intronic
946845927 2:223859040-223859062 TGGAGGCAGGAGCAGGTGAGAGG + Intronic
946871830 2:224091822-224091844 TGTAAGCCAGACCAGGTGTGAGG + Intergenic
1169192602 20:3667679-3667701 TTCATGCAAGAGCTGCTGAGTGG - Intergenic
1169252607 20:4072018-4072040 TCTTAGCAATAGCTGGTGGGTGG + Intronic
1173137365 20:40450867-40450889 TGTAAAGAAGAAATGGTGAGGGG + Intergenic
1173302960 20:41820042-41820064 TTTTGGCAAGAACTGGTGAGTGG + Intergenic
1173705539 20:45107755-45107777 TGTAAGCATGGGGTGGGGAGGGG + Intergenic
1174599219 20:51710790-51710812 TTGAAGCAAGAGCTGGGAAGGGG + Intronic
1175983730 20:62754087-62754109 TGGAAGCTAGAGGTGGGGAGTGG + Intronic
1176724370 21:10417928-10417950 TGTAAGGAACAGGTTGTGAGTGG + Intergenic
1177007936 21:15697062-15697084 GGTAAGCTAGAGCTGGAGTGAGG + Intergenic
1177306585 21:19326293-19326315 TGAAAGCAAGAACTGCAGAGAGG - Intergenic
1178246421 21:30957251-30957273 TGTAGGCAGGAGGTGGGGAGGGG + Intergenic
1178807684 21:35852796-35852818 TGTGAGCCAGAGGTGGGGAGAGG - Intronic
1181581564 22:23831684-23831706 CTTAAACAAGAGCTGGCGAGTGG - Intronic
1182517579 22:30867808-30867830 TGTAAGCAAGAGCTGGTGAGAGG - Intronic
1183635745 22:39061471-39061493 TGTAAGCCAGACCCGGTGTGAGG + Intronic
1183730228 22:39614439-39614461 CTGAAGCAAGAGCTGGAGAGAGG - Intronic
1183740868 22:39667834-39667856 TGAAAACAGGAGCTCGTGAGAGG - Intronic
1185227783 22:49662984-49663006 CGGAAGCCAGAGCTGGGGAGGGG + Intergenic
949162161 3:894623-894645 TGTAAGCAGGACCCGGTGTGAGG + Intergenic
949190458 3:1243759-1243781 TGTAAGCCAGACCGGGTGTGAGG + Intronic
949716596 3:6938990-6939012 TTTAAGCAAGAGATCGAGAGGGG - Intronic
949827375 3:8178779-8178801 TGTAAGCCGGAGCAGGTGTGAGG - Intergenic
950109011 3:10406797-10406819 TGTAAGACAGGGCTGGTCAGTGG - Intronic
951771618 3:26263909-26263931 AGCAACCAAGAGCTGGTCAGAGG + Intergenic
953077197 3:39581747-39581769 TGTAAGCCAGACCAGGTGTGAGG + Intergenic
953841235 3:46391720-46391742 TGTAAGCCAGACCAGGTGTGAGG + Intergenic
954536533 3:51363396-51363418 TGGAAGCAAGAGCAAGTGACTGG - Intronic
954626169 3:52023058-52023080 TGTCAGCAAGGACTGGGGAGGGG - Intergenic
954969331 3:54638430-54638452 TGTAAGCCGGAGCAGGTGTGAGG + Intronic
955085818 3:55701708-55701730 TGTGAGAAAGAGCAGGTCAGTGG + Intronic
955236509 3:57144313-57144335 GGAAAGGAAGAGATGGTGAGCGG - Intronic
955516402 3:59730482-59730504 TGTAAGTGAGGGCTGGAGAGTGG + Intergenic
955619485 3:60847315-60847337 TGCAAGCAACAGCTGTTCAGAGG - Intronic
958421886 3:93939527-93939549 TGTAAGCCAGAGCAGGTGTAAGG - Intronic
958803893 3:98786411-98786433 TGTATCCCAGTGCTGGTGAGAGG + Intronic
958946484 3:100368128-100368150 TGGAAGCAAGATCTGGATAGAGG - Exonic
963045803 3:141101846-141101868 AGTGAGCAAGGGCTGGTGCGTGG - Intronic
964067757 3:152598753-152598775 TGTAAGCCAGACCGGGTGTGAGG - Intergenic
964169937 3:153758042-153758064 TGTCAGCAAGAGCTAGTCTGAGG - Intergenic
964906578 3:161725818-161725840 TGTAAGCCAGACCAGGTGTGAGG + Intergenic
964984937 3:162726495-162726517 TGTAAGCCAGACCCGGTGTGAGG + Intergenic
965262721 3:166504760-166504782 TGTAAGCCAGACCTGGTGTGAGG + Intergenic
965624949 3:170676491-170676513 TGTAAGCCAGACCAGGTGTGAGG + Intronic
966012731 3:175100997-175101019 TGTAAGCAGGAGCTGGAGGAGGG + Intronic
966066775 3:175829471-175829493 TGTAAGCCAGACCAGGTGTGAGG - Intergenic
966279232 3:178209267-178209289 TGTAAGCCAGACCAGGTGTGAGG - Intergenic
966697504 3:182806065-182806087 TTTAAGCAAGAGTTCATGAGTGG + Intronic
967467756 3:189827352-189827374 TGTAAGGGGGAGCTGGTGGGGGG - Intronic
969003880 4:4004190-4004212 TGTAAGCTGGAGCTGGTGTGAGG + Intergenic
969810047 4:9640634-9640656 TGTAAGCTGGAGCTGGTGTGAGG - Intergenic
971529472 4:27667082-27667104 TGTTAACAAGAGCTTGTGCGGGG + Intergenic
972071206 4:35020758-35020780 TGTAAGCCAGACCAGGTGTGAGG + Intergenic
972337876 4:38123974-38123996 GGAAAGCAAAAGCAGGTGAGAGG - Intronic
973249685 4:48047988-48048010 TGCCAGCAAGAGCTGGGGTGAGG + Intergenic
973586468 4:52397302-52397324 TGCAAGCAAGCGATGGGGAGTGG - Intergenic
973734074 4:53853090-53853112 TCCAAGCCAGAGTTGGTGAGAGG - Intronic
974428464 4:61768240-61768262 TGTAAGCCAGACCAGGTGTGAGG + Intronic
974535914 4:63174783-63174805 TGTCAGTAATTGCTGGTGAGAGG + Intergenic
975151999 4:71032949-71032971 TGTAAGCCAGACCGGGTGTGAGG - Intergenic
975152054 4:71033263-71033285 TGTAAGCCAGACCGGGTGTGAGG - Intergenic
975865154 4:78717809-78717831 TGTAAGCCAGACCAGGTGTGAGG + Intergenic
976310609 4:83608073-83608095 TGTAAGCAAGCATTGGTGATTGG + Intergenic
976360302 4:84170409-84170431 TGTAAGCAAGTGGTGGGGTGAGG + Intergenic
976664575 4:87576945-87576967 TGGATGCCATAGCTGGTGAGTGG - Intergenic
976696469 4:87923628-87923650 TGTAAGCCAGACCAGGTGTGAGG - Intergenic
977010248 4:91625850-91625872 TGTAAGCCAGACCAGGTGTGAGG - Intergenic
977062574 4:92275443-92275465 TGTAAGCCAGACCAGGTGTGAGG + Intergenic
977198499 4:94088575-94088597 TGTAAGCCAGACCAGGTGTGAGG + Intergenic
977217221 4:94297165-94297187 TGTAAGCCAGACCAGGTGTGAGG + Intergenic
978001187 4:103557714-103557736 TGTAAGCAGGACCAGGTGTGAGG + Intergenic
978438549 4:108710786-108710808 TGTAAGCAGGACCAGGTGTGAGG - Intergenic
978604836 4:110467960-110467982 TGAAAGCAAGAAGTGGAGAGAGG - Intronic
979166518 4:117539453-117539475 TGGAAGAAAGATCTGGAGAGAGG + Intergenic
979451355 4:120874917-120874939 TGTAGGGAAGAGGTGGTGGGAGG + Intronic
979850374 4:125565587-125565609 TGTAAGCCAGACCAGGTGTGAGG + Intergenic
979895231 4:126149088-126149110 TGTAAGCCAGACCAGGTGTGAGG + Intergenic
980003423 4:127515437-127515459 TGTAAGCCAGACCGGGTGTGAGG + Intergenic
980111996 4:128644797-128644819 TGTAAGCCAGACCGGGTGTGAGG + Intergenic
980284883 4:130769093-130769115 TGTAAGCCAGACCAGGTGTGAGG - Intergenic
980491420 4:133533143-133533165 TGTAAGCCAGACCGGGTGTGAGG + Intergenic
981695071 4:147551651-147551673 TGGAAGTGAGACCTGGTGAGAGG - Intergenic
982084033 4:151816553-151816575 TGTAAGCCAGACCAGGTGTGAGG + Intergenic
982180546 4:152745304-152745326 TGTAAGCCGGAGCAGGTGTGAGG + Intronic
982497173 4:156107418-156107440 TGTAAGCCAGACCCGGTGTGAGG + Intergenic
982621666 4:157714853-157714875 TTTAGGAAAGAGCTTGTGAGTGG - Intergenic
983055419 4:163094849-163094871 TGTAAGCCAGACCAGGTGTGAGG - Intergenic
983883832 4:172960363-172960385 TGTAAGCCAGACCGGGTGTGAGG + Intronic
984322119 4:178208880-178208902 TGTAAGCCAGACCAGGTGTGAGG - Intergenic
984437195 4:179722176-179722198 TGTAAGCCAGACCAGGTGTGAGG - Intergenic
984700599 4:182816281-182816303 TGTAAGCCGGAGCAGGTGTGAGG - Intergenic
986193470 5:5517316-5517338 TGTAAGCCAGAGCAGGTGTGAGG - Intergenic
986869516 5:12030293-12030315 TGAAAGCAGGAGCAGGAGAGTGG - Intergenic
987487439 5:18540067-18540089 TGTAAGCCAGACCAGGTGTGAGG - Intergenic
987940619 5:24531211-24531233 TGTAAGCAGGATTTGGTGACTGG - Intronic
988548927 5:32182880-32182902 AGGAAGCAAGAGCGAGTGAGAGG - Intergenic
989615220 5:43331929-43331951 TGTAAGCCAGACCGGGTGTGAGG + Intergenic
989659852 5:43787863-43787885 TGTAAGCCAGACCAGGTGTGAGG - Intergenic
994375863 5:99015290-99015312 TGTAAGCCAGACCAGGTGTGGGG + Intergenic
994532607 5:100988205-100988227 TGTAAGCCAGACCAGGTGTGAGG + Intergenic
994658731 5:102627355-102627377 TCTCAGCAAGGGCTGCTGAGTGG - Intergenic
994812767 5:104543231-104543253 TGAGAGCAGGAGCTGGTGGGAGG + Intergenic
994943766 5:106359132-106359154 TGCAAGCAAGTGATGGGGAGTGG - Intergenic
994989481 5:106980139-106980161 TGTAAGCCAGACCAGGTGTGAGG - Intergenic
995305241 5:110639207-110639229 TGTAATCAGAAGCTGTTGAGTGG + Intronic
995572421 5:113494293-113494315 TATAAGCAAGAGTTGGAGTGAGG + Intergenic
995769310 5:115652255-115652277 TGTAAGCCAGACCGGGTGTGAGG - Intergenic
996008030 5:118447039-118447061 TTTAAGCAAGAGCTGGGGAAGGG + Intergenic
997157164 5:131573226-131573248 TGTAAGCCAGACCAGGTGTGAGG - Intronic
997456342 5:134020346-134020368 GGTAAACAGGAGCTGGGGAGGGG - Intergenic
997746332 5:136303047-136303069 TGTAAGCCAGACCGGGTGTGAGG - Intronic
997770744 5:136550649-136550671 TGTAAGCCAGACCGGGTGTGAGG + Intergenic
998024036 5:138798106-138798128 GGTAAGAAACAGCTGGTGTGTGG + Intronic
998292386 5:140927482-140927504 TGTAAGCACCAGCAGGTGGGTGG - Exonic
999125636 5:149243941-149243963 TGGAAGCAAGTGCTGTTGTGGGG + Intronic
999618933 5:153453661-153453683 TGTAAGCCAGACCAGGTGTGAGG + Intergenic
1000519478 5:162279328-162279350 TGTAAGCCAGACCAGGTGTGAGG + Intergenic
1001290292 5:170452471-170452493 TGTCAACAAAAGCTGGTGATGGG + Intronic
1002611033 5:180418677-180418699 TGTAAGCCAGAGCAGGTGTGAGG + Intergenic
1005994431 6:30922793-30922815 GGTGAGCTAGAGCTGGTGGGGGG - Intronic
1006525449 6:34600707-34600729 AGAAAGCAATAGCTGGTGGGGGG + Intronic
1007462443 6:42028256-42028278 TGGAAGAGAGAGCTGGGGAGAGG + Intronic
1008051519 6:46904732-46904754 TGTATGCAACATCTGGTGATGGG - Intronic
1008260091 6:49355492-49355514 TGTAAGCAGGAGCTAAAGAGTGG + Intergenic
1009464274 6:63951657-63951679 TGTAAGCCAGACCAGGTGTGAGG - Intronic
1011367969 6:86602322-86602344 TGTAAGCCAGACCGGGTGTGAGG + Intergenic
1012306204 6:97661182-97661204 ACTAAGCAATAGCTGGAGAGGGG - Intergenic
1012689509 6:102294684-102294706 TGTAAGCCAGACCAGGTGTGAGG - Intergenic
1012852620 6:104465080-104465102 TGTGAGTTAGAGCTGTTGAGAGG - Intergenic
1013843750 6:114426275-114426297 TGTAAGCTAGACCAGGTGTGAGG + Intergenic
1013891635 6:115033643-115033665 TGTAAGCCAGACCAGGTGTGAGG - Intergenic
1014360228 6:120466218-120466240 TGTAAGCCAGACCAGGTGTGAGG + Intergenic
1014454938 6:121624390-121624412 TGTAAGCCAGACCAGGTGTGAGG + Intergenic
1015483279 6:133740017-133740039 TGTGAGCATGAGCAGGTGAGAGG + Intergenic
1016650360 6:146454367-146454389 TGTAAGCCAGAACGGGTGTGAGG + Intergenic
1016853202 6:148641558-148641580 TGTAAGCCAGACCAGGTGTGAGG - Intergenic
1017713084 6:157187196-157187218 TGTAAGCTGGAGATGGGGAGGGG + Intronic
1018020394 6:159757892-159757914 TGTAATCAAGAGTTTGTGATAGG + Intronic
1018158726 6:161015675-161015697 AGGAAGCAAGAGGTGGTGCGGGG + Intronic
1018962217 6:168457130-168457152 TGGAAGGGAGAGCTGGAGAGGGG - Intronic
1019618841 7:1979659-1979681 TGCAAGCAGGAGCTGGGGTGAGG + Intronic
1020470941 7:8533847-8533869 AGGAAGAAGGAGCTGGTGAGAGG + Intronic
1021343707 7:19495981-19496003 TGTAAGTAAAAGCTCGTGAGGGG - Intergenic
1021546723 7:21821826-21821848 GATAAGGAAAAGCTGGTGAGTGG - Intronic
1022372807 7:29786610-29786632 TGTAAGCCAGACCTGGTGTGAGG - Intergenic
1022854779 7:34303843-34303865 TGTAAGCCAGACCGGGTGTGAGG + Intergenic
1024064648 7:45722167-45722189 TGTATGCAAGAGGCGGTGATGGG - Exonic
1026388957 7:69880275-69880297 TGGAAGTAAGGCCTGGTGAGAGG - Intronic
1027158156 7:75783015-75783037 TGTAAGCCAGACCGGGTGTGAGG - Intronic
1027354347 7:77341422-77341444 TGTAAGCCAGACCAGGTGTGAGG - Intronic
1027421479 7:78021057-78021079 TTAAAGCAACAGCTGGTCAGAGG + Intronic
1027673951 7:81136315-81136337 TGTGAGAAAGAAGTGGTGAGAGG - Intergenic
1029314645 7:99700359-99700381 TGGAAACAAGGGCAGGTGAGAGG - Intronic
1029350749 7:100011259-100011281 AGGAAGGAAGAGCAGGTGAGCGG - Intergenic
1029517743 7:101037251-101037273 TGTCAGCAAGAGTTGTTGAAAGG - Exonic
1029970387 7:104782777-104782799 TATAAGAAAGATGTGGTGAGAGG - Intronic
1030193362 7:106831089-106831111 TGTAAGCCAGACCAGGTGTGAGG - Intergenic
1030679703 7:112422137-112422159 TGCAAGCAATAGGAGGTGAGAGG - Intergenic
1031333428 7:120495938-120495960 TGTAAGCAAATGCTGGGAAGAGG + Intronic
1031343484 7:120634920-120634942 TGTGAGGAAGAGGTGGTGTGAGG - Intronic
1031399920 7:121317330-121317352 TGTAAGCCAGACCAGGTGTGAGG - Intergenic
1032221774 7:129999963-129999985 AGAAAGCAAGAGCTCGTCAGAGG + Intergenic
1033465107 7:141582774-141582796 TGTAAGCCAGACCGGGTGTGAGG + Intronic
1034613441 7:152393491-152393513 TGTAAGGAACAGGTTGTGAGTGG - Intronic
1036472405 8:9063424-9063446 TGTAAGCCAGACCGGGTGTGAGG + Intronic
1037157894 8:15728293-15728315 TCTAGGCAAGAGATGATGAGTGG + Intronic
1037345180 8:17891105-17891127 TGTAAGCACGAAGAGGTGAGTGG + Intronic
1037653818 8:20865929-20865951 TGTGGGCAGGAGCTGGTGACTGG + Intergenic
1039289791 8:36082032-36082054 AGAAAGGAAAAGCTGGTGAGGGG - Intergenic
1040085550 8:43336784-43336806 TGTGAGAAAGACCTGGTGGGAGG + Intergenic
1041349272 8:56932514-56932536 TGTAAGCAACAGATGATAAGGGG - Intergenic
1042815527 8:72874383-72874405 TGTATGAGAGAGGTGGTGAGTGG + Intronic
1044207061 8:89502966-89502988 TGTAGGAAGGAGCTGGTGGGAGG + Intergenic
1044563573 8:93638420-93638442 GGCAAGAAAGAGCTGGTGTGAGG - Intergenic
1046443184 8:114283751-114283773 TGTAAGCCAGACCAGGTGTGAGG - Intergenic
1047718842 8:127620083-127620105 TAAGAGCAAGAGCTGGTCAGCGG + Intergenic
1047829608 8:128615860-128615882 TGTAAGCCAGACCAGGTGTGAGG + Intergenic
1048267885 8:133003806-133003828 TGCAAACCAGAGCTGCTGAGGGG - Intronic
1048728493 8:137412257-137412279 TGTAAGCGAGACCAGGTGTGAGG + Intergenic
1050258179 9:3815150-3815172 TGTAAGCCAGACCAGGTGTGAGG + Intergenic
1050896000 9:10886487-10886509 TGTAAGCCAGACCAGGTGTGAGG - Intergenic
1051566896 9:18509790-18509812 TGAAAGCATGAGCTAGAGAGAGG + Intronic
1052163016 9:25289431-25289453 TGTAAGCCAGACCAGGTGTGAGG - Intergenic
1052816535 9:33106496-33106518 GTTAAGGAAGAGCAGGTGAGAGG + Intronic
1055809980 9:80139168-80139190 TGTAAGCCAGACCAGGTGTGAGG - Intergenic
1056061091 9:82885516-82885538 TGTAAGCCAGACCAGGTGTGAGG - Intergenic
1056323816 9:85460405-85460427 TGTAAGCCAGACCAGGTGTGAGG - Intergenic
1056363631 9:85882414-85882436 TGTAAGCCAGACCAGGTGTGAGG - Intergenic
1056437307 9:86587262-86587284 TGTAAGCCAGACCAGGTGTGAGG + Intergenic
1056681471 9:88722821-88722843 TGTAAGGAATGTCTGGTGAGGGG - Intergenic
1057067986 9:92073050-92073072 TGTAAGCCAGAGCAGGTGTGAGG - Intronic
1057781753 9:98056308-98056330 TATGAGCAGGAGCTGGTGACTGG + Intergenic
1057812650 9:98269797-98269819 TGTAAGCCAGACCGGGTGTGAGG + Intergenic
1058245804 9:102624579-102624601 AGCAAGCAAGAGCTTGTGAAGGG + Intergenic
1059410178 9:114126953-114126975 TGTGAGGAAGGGCTGGTGACAGG + Intergenic
1059410890 9:114131674-114131696 TGTGAGGAAGATCTGGTGTGGGG - Intergenic
1059465480 9:114466598-114466620 TGTGACCAAGAGGGGGTGAGGGG - Intronic
1059574554 9:115475121-115475143 TGTAAGCCAGACCAGGTGTGAGG - Intergenic
1060920202 9:127415045-127415067 TGTAAGCCAGAGCGGGTGTGAGG - Intergenic
1061360674 9:130140275-130140297 TGTCAGTAGGAGCTGGTGGGAGG - Intergenic
1061582989 9:131548811-131548833 TGTAAGCCAGACCGGGTGTGAGG - Intergenic
1061772285 9:132935138-132935160 TGTAATCAAAAGCGGGTTAGGGG + Intronic
1062560750 9:137140813-137140835 TGGAAGCAAGAGCTGGGGGAGGG + Intronic
1186415060 X:9376054-9376076 TGTGTCCAAGAGCTAGTGAGGGG + Intergenic
1186744366 X:12551925-12551947 TGTAACAAAGAGTTGATGAGGGG - Intronic
1187103841 X:16220780-16220802 TGTAAGCCAGACCTGGCGTGAGG + Intergenic
1189198946 X:39175434-39175456 TGCAAGCAAGGGCAGGGGAGAGG - Intergenic
1189297396 X:39928766-39928788 TGTAAGGAGGAGCAGGTGTGGGG + Intergenic
1192541141 X:71973956-71973978 TGTAACATGGAGCTGGTGAGGGG + Intergenic
1192764721 X:74129138-74129160 TGTAAGCCAGACCAGGTGTGAGG + Intergenic
1193176009 X:78393987-78394009 TGTAATCAAAAGCTGGTCAAAGG + Intergenic
1194186315 X:90777269-90777291 TGTAAGCAGGACCAGGTGTGAGG + Intergenic
1194698474 X:97084772-97084794 TGAAAGCAAGAGCTGCTTTGGGG + Intronic
1195539297 X:106044176-106044198 TGTGATCAAGAGCTGGGTAGGGG + Intergenic
1196330757 X:114468523-114468545 TGTAAGCCAGACCTGGTGTGAGG - Intergenic
1196533604 X:116816414-116816436 TGTAAGCTGGAGCAGGTGTGAGG + Intergenic
1196572436 X:117280921-117280943 TGTAAGCCAGACCAGGTGTGAGG - Intergenic
1196992755 X:121346966-121346988 TGTAAGCCAGACCAGGTGTGAGG + Intergenic
1197470891 X:126864838-126864860 TGTAAGCCAGACCGGGTGTGAGG - Intergenic
1198082899 X:133255689-133255711 TGGAAGCAGGGCCTGGTGAGAGG + Intergenic
1198983827 X:142427548-142427570 TGTAAGCAGGACCCGGTGTGAGG + Intergenic
1199071387 X:143479533-143479555 TGAAAGCAAGAGAGAGTGAGAGG + Intergenic
1200182488 X:154159261-154159283 GGCAAGCAAGAGCTGTGGAGGGG + Intergenic
1200188142 X:154196375-154196397 GGCAAGCAAGAGCTGTGGAGGGG + Intergenic
1200193792 X:154233515-154233537 GGCAAGCAAGAGCTGTGGAGGGG + Intergenic
1200199547 X:154271319-154271341 GGCAAGCAAGAGCTGTGGAGGGG + Exonic
1200532907 Y:4359346-4359368 TGTAAGCAGGACCAGGTGTGAGG + Intergenic
1200611209 Y:5328727-5328749 TGTAAGCCGGAGCAGGTGTGAGG + Intronic
1200659547 Y:5942941-5942963 TGTAAGCAGGACCAGGTGTGAGG - Intergenic
1201234316 Y:11895119-11895141 TGTAAGCCAGACCAGGTGTGAGG + Intergenic
1201540741 Y:15102557-15102579 TGTAAGCCAGAACAGGTGTGGGG + Intergenic