ID: 1182520315

View in Genome Browser
Species Human (GRCh38)
Location 22:30881211-30881233
Sequence GGGGGTAGGCAGAAGGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182520298_1182520315 16 Left 1182520298 22:30881172-30881194 CCCAACACCCCTTTCACCAGAAC No data
Right 1182520315 22:30881211-30881233 GGGGGTAGGCAGAAGGGGCAGGG No data
1182520295_1182520315 23 Left 1182520295 22:30881165-30881187 CCATACCCCCAACACCCCTTTCA No data
Right 1182520315 22:30881211-30881233 GGGGGTAGGCAGAAGGGGCAGGG No data
1182520309_1182520315 -7 Left 1182520309 22:30881195-30881217 CCTCTGTGCAGCACTTGGGGGTA 0: 1
1: 0
2: 1
3: 6
4: 136
Right 1182520315 22:30881211-30881233 GGGGGTAGGCAGAAGGGGCAGGG No data
1182520301_1182520315 8 Left 1182520301 22:30881180-30881202 CCCTTTCACCAGAACCCTCTGTG 0: 1
1: 0
2: 2
3: 27
4: 255
Right 1182520315 22:30881211-30881233 GGGGGTAGGCAGAAGGGGCAGGG No data
1182520296_1182520315 18 Left 1182520296 22:30881170-30881192 CCCCCAACACCCCTTTCACCAGA No data
Right 1182520315 22:30881211-30881233 GGGGGTAGGCAGAAGGGGCAGGG No data
1182520294_1182520315 24 Left 1182520294 22:30881164-30881186 CCCATACCCCCAACACCCCTTTC 0: 1
1: 0
2: 2
3: 30
4: 319
Right 1182520315 22:30881211-30881233 GGGGGTAGGCAGAAGGGGCAGGG No data
1182520299_1182520315 15 Left 1182520299 22:30881173-30881195 CCAACACCCCTTTCACCAGAACC 0: 1
1: 0
2: 1
3: 22
4: 307
Right 1182520315 22:30881211-30881233 GGGGGTAGGCAGAAGGGGCAGGG No data
1182520303_1182520315 0 Left 1182520303 22:30881188-30881210 CCAGAACCCTCTGTGCAGCACTT 0: 1
1: 0
2: 0
3: 16
4: 228
Right 1182520315 22:30881211-30881233 GGGGGTAGGCAGAAGGGGCAGGG No data
1182520297_1182520315 17 Left 1182520297 22:30881171-30881193 CCCCAACACCCCTTTCACCAGAA 0: 1
1: 0
2: 1
3: 17
4: 236
Right 1182520315 22:30881211-30881233 GGGGGTAGGCAGAAGGGGCAGGG No data
1182520302_1182520315 7 Left 1182520302 22:30881181-30881203 CCTTTCACCAGAACCCTCTGTGC 0: 1
1: 0
2: 1
3: 24
4: 216
Right 1182520315 22:30881211-30881233 GGGGGTAGGCAGAAGGGGCAGGG No data
1182520300_1182520315 9 Left 1182520300 22:30881179-30881201 CCCCTTTCACCAGAACCCTCTGT No data
Right 1182520315 22:30881211-30881233 GGGGGTAGGCAGAAGGGGCAGGG No data
1182520308_1182520315 -6 Left 1182520308 22:30881194-30881216 CCCTCTGTGCAGCACTTGGGGGT 0: 1
1: 0
2: 0
3: 19
4: 148
Right 1182520315 22:30881211-30881233 GGGGGTAGGCAGAAGGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182520315 Original CRISPR GGGGGTAGGCAGAAGGGGCA GGG Intronic
No off target data available for this crispr