ID: 1182524244

View in Genome Browser
Species Human (GRCh38)
Location 22:30905825-30905847
Sequence CCACCGCCACAGGGAGAACG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 94}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182524233_1182524244 11 Left 1182524233 22:30905791-30905813 CCGGCTCACACCGCAGCCACCGC 0: 1
1: 0
2: 1
3: 22
4: 267
Right 1182524244 22:30905825-30905847 CCACCGCCACAGGGAGAACGCGG 0: 1
1: 0
2: 0
3: 12
4: 94
1182524235_1182524244 -5 Left 1182524235 22:30905807-30905829 CCACCGCCACCGCCACCACCACC 0: 10
1: 119
2: 2471
3: 5698
4: 13824
Right 1182524244 22:30905825-30905847 CCACCGCCACAGGGAGAACGCGG 0: 1
1: 0
2: 0
3: 12
4: 94
1182524236_1182524244 -8 Left 1182524236 22:30905810-30905832 CCGCCACCGCCACCACCACCGCC 0: 4
1: 98
2: 2453
3: 5787
4: 13747
Right 1182524244 22:30905825-30905847 CCACCGCCACAGGGAGAACGCGG 0: 1
1: 0
2: 0
3: 12
4: 94
1182524232_1182524244 26 Left 1182524232 22:30905776-30905798 CCGGGTAGGTGTGGTCCGGCTCA 0: 1
1: 0
2: 0
3: 6
4: 64
Right 1182524244 22:30905825-30905847 CCACCGCCACAGGGAGAACGCGG 0: 1
1: 0
2: 0
3: 12
4: 94
1182524234_1182524244 1 Left 1182524234 22:30905801-30905823 CCGCAGCCACCGCCACCGCCACC 0: 1
1: 41
2: 138
3: 801
4: 6764
Right 1182524244 22:30905825-30905847 CCACCGCCACAGGGAGAACGCGG 0: 1
1: 0
2: 0
3: 12
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182524244 Original CRISPR CCACCGCCACAGGGAGAACG CGG Exonic
900962691 1:5935324-5935346 CCCCCGTCACAGGGTGAGCGGGG + Intronic
901089570 1:6632387-6632409 CCCCCGCCTCAGGGAGGACCTGG - Exonic
901628735 1:10638292-10638314 CCTCCGCCCCAGGGAAACCGAGG - Exonic
902257385 1:15198794-15198816 CCTCCAGCACAGGGAGAAGGAGG + Intronic
904079965 1:27866024-27866046 CCCCAGCCACTGGGGGAACGGGG - Intergenic
907596703 1:55726937-55726959 CCACTACCACAAGGAGAATGAGG - Intergenic
914455624 1:147833708-147833730 CCTTCTCCACAGGGAGAAGGAGG - Intergenic
918686246 1:187419184-187419206 CCACCGTCACAGTGAGAGCATGG + Intergenic
919362119 1:196608879-196608901 CCATCTCCACAGGGAGATTGCGG - Exonic
920931578 1:210393824-210393846 CCCCAGCCACAGGCAGAACCCGG - Intronic
1069545012 10:69321429-69321451 CCAGCCCCACAGGAAGAACAGGG - Intronic
1072269895 10:93766141-93766163 CAACCACCACAGGGAGAGCCTGG - Intronic
1083592094 11:63901833-63901855 CCACCACCAGAGGGAGAGCAGGG - Intronic
1089338796 11:117743842-117743864 CCGCCGCCATGGGGAGAAGGTGG + Intronic
1091296218 11:134475690-134475712 CCACCTCCACAGGGTGCAGGGGG - Intergenic
1094739717 12:33275043-33275065 CCACCACGGCAGGGAGAAGGAGG - Intergenic
1095963471 12:47850837-47850859 CCACCCCCACAGGCAGAGCCCGG + Intronic
1096092553 12:48912848-48912870 CCACCGCCCCTGGCAGAACCTGG - Intronic
1101374160 12:104156603-104156625 CCACCGCCTTAGGGAGTAGGAGG - Intergenic
1106517048 13:30465017-30465039 CCGCCCCCGCACGGAGAACGCGG + Intronic
1114847647 14:26343215-26343237 CCACTGCCAGAGGCAGAACGTGG + Intergenic
1120522922 14:85545849-85545871 TCACCTCCACAGGGAAAAAGAGG - Intronic
1120720072 14:87881051-87881073 CCTCCGCCAGAGGGGGAAAGAGG + Intronic
1122959284 14:105087248-105087270 CCACGGGCGCAGGGAGGACGGGG + Intergenic
1125609936 15:40963197-40963219 CCCCCTCCACATGGACAACGTGG + Intergenic
1128161342 15:65424584-65424606 CCAAGGCCACAGTGAGAAAGTGG - Intergenic
1128383968 15:67134122-67134144 CGAGTGCCACAGGGAGAAAGTGG + Intronic
1129122385 15:73408433-73408455 CCACCGCTACTGGTAGAACCGGG + Intergenic
1129910176 15:79220399-79220421 CCACCCCCACAGGGAAGAGGAGG + Intergenic
1130107385 15:80939181-80939203 CCTCCGCCCCAGGGAGCACTGGG + Intronic
1132504746 16:302155-302177 TCACCGCCACAGGGACCACGCGG + Intronic
1132524137 16:406002-406024 CCAGCCCCACAGGGAGAAGGGGG + Intronic
1133008680 16:2898293-2898315 CCACCGGCTCTGGGAGGACGGGG - Intronic
1133728650 16:8559713-8559735 CCACCCTCACAAGGAGAAGGTGG + Intergenic
1137252148 16:46748247-46748269 CCACCGCCTGAGTGAGAACCAGG - Exonic
1137825784 16:51493689-51493711 CCAGGGCCACAGGGAGCAGGTGG + Intergenic
1139484928 16:67250000-67250022 CCAGCACAACAGGGAGAAGGAGG - Intronic
1140779527 16:78282033-78282055 CAAAAGCCACAGGGAGAACCAGG + Intronic
1142002706 16:87672431-87672453 CCACCCTCACAGTGAGAACAGGG - Intronic
1142523242 17:519590-519612 CCACCTGCACAGGGAGGATGGGG - Intronic
1142700061 17:1654006-1654028 CCATCCCCACAGTGTGAACGTGG - Exonic
1149997513 17:61412649-61412671 CCACCGACACAGGCAGAGCCGGG + Exonic
1150001599 17:61443898-61443920 CGAGAGCCACAGTGAGAACGAGG + Intergenic
1152904802 17:82964622-82964644 GCACCCCCACGGGGAGGACGGGG + Intronic
1152904926 17:82964986-82965008 GCACTCCCACAGGGAGGACGGGG + Intronic
1152904937 17:82965027-82965049 GCACACCCACAGGGAGGACGGGG + Intronic
1156487970 18:37478601-37478623 GCACAGCCCCAGGGAGAAGGAGG + Intronic
1156899641 18:42286079-42286101 CCAACTCCACAGTGAGAAGGAGG - Intergenic
1160165099 18:76504192-76504214 CCAGCGCTACAGGGAGACCCCGG - Intergenic
1160364645 18:78313772-78313794 CCACCACCACAGGGAGATCATGG + Intergenic
1162322308 19:9977462-9977484 TCCCCACAACAGGGAGAACGTGG - Exonic
1162519313 19:11170095-11170117 GCACGGCCACAAGGAGATCGCGG - Exonic
1165741888 19:38209740-38209762 CCCCCGCCACCGGGCGAAGGGGG + Intergenic
1166393501 19:42423318-42423340 CCACTGCCACAGGGAGTTGGGGG - Intronic
1167523177 19:49969161-49969183 CCAGCTCCACAGGGAGAAGGGGG - Intergenic
927200132 2:20572973-20572995 CCACCGCAACATAGAGAATGTGG + Intronic
932401376 2:71483096-71483118 GCACAGCCACAGAGAGAAGGTGG - Intronic
935385710 2:102498074-102498096 CCACAGCCCCATGGAGAACAAGG - Intronic
941663498 2:168219442-168219464 CCACTTCCTCAGGGAGAAGGAGG + Intronic
946691605 2:222312450-222312472 CCACTGCCACTGGGACACCGGGG - Intergenic
1180747839 22:18103718-18103740 CCACAGCCACAGTGAGAGCCTGG + Exonic
1182524244 22:30905825-30905847 CCACCGCCACAGGGAGAACGCGG + Exonic
1183305025 22:37078183-37078205 CCACAGTCACAGGGAGATTGTGG + Intronic
951080446 3:18445206-18445228 CCACCGCCAGGGGGAGAAGCCGG - Intronic
960987860 3:123292273-123292295 CCACCACCACAGGGACAGCCAGG - Intronic
961901101 3:130212811-130212833 CTTCTTCCACAGGGAGAACGAGG + Intergenic
962276361 3:134017675-134017697 GCGCCGCCACAGGCAGAAAGGGG + Intronic
963936430 3:151058713-151058735 GCACAGCCACAGGGAGGAAGAGG - Intergenic
966872419 3:184299490-184299512 CCACCGCGCCAGGGAGAGGGCGG + Intronic
968123655 3:196143284-196143306 CCACAGCCACAGAGAGAAGGAGG + Intergenic
968649848 4:1756202-1756224 CCTCCGCCACAGGAAGAGCCGGG - Intergenic
969725072 4:8913913-8913935 CCATGTCCACAGAGAGAACGTGG + Intergenic
972777923 4:42260557-42260579 CCACCGACCCAGGGAGAGCCTGG - Intergenic
977590565 4:98821754-98821776 ACACACGCACAGGGAGAACGTGG - Intergenic
980516324 4:133867158-133867180 CCAGGCCCACAGGGAGAACTAGG - Intergenic
981691633 4:147515348-147515370 CCACCACCACAGGGAACACTTGG - Intronic
992019303 5:72606527-72606549 CCACAGCCACAGGGGGACTGTGG - Intergenic
992834213 5:80624237-80624259 CCGCCGTCACAGGGATAAAGGGG - Intergenic
998165256 5:139838934-139838956 CCACATCAACAGGGAGACCGAGG + Intronic
999189338 5:149734972-149734994 CCCCTGCCACATGGAGAACTGGG + Intronic
1001894310 5:175365370-175365392 CCACCGGCAGATGGAGAACAGGG + Intergenic
1002298057 5:178242118-178242140 CCTCCTGCACAGGGAGAACGAGG - Exonic
1004015932 6:11731980-11732002 CCACTGCCTCAGGGAGAACTAGG + Intronic
1004043928 6:12009100-12009122 CCACCGCCACGCGGAGATCCCGG - Intronic
1004989798 6:21124633-21124655 CCATTGCCACAAAGAGAACGAGG - Intronic
1017129143 6:151093261-151093283 ACACAGACACAGGGAGAACGTGG - Intronic
1017781177 6:157716497-157716519 CCAGTGCCACAGGAAGAACGTGG - Intronic
1019154822 6:170031899-170031921 CCACGGTCACAGGGAGAACTGGG + Intergenic
1027225521 7:76241276-76241298 CCACCTCCACAGGGAGCAAGTGG + Intronic
1028602559 7:92617936-92617958 CCACAGCCACATGGAGCAGGAGG - Intronic
1029548062 7:101221804-101221826 GCACCGCCACAGGGTGGACAGGG + Intronic
1030463518 7:109871259-109871281 CCACTGTCACAGGGAGATGGCGG - Intergenic
1033363242 7:140652713-140652735 CCACGGACACAGTGAGAAGGCGG + Intronic
1041393483 8:57368486-57368508 CCACCTGCAAAGGGAGAATGAGG - Intergenic
1048036569 8:130682928-130682950 GCAGAGCCACAGGGAGCACGGGG - Intergenic
1048951583 8:139501180-139501202 CCACCTCCAGAGGTAGAACTTGG + Intergenic
1049990722 9:989217-989239 CCACCGCCACGGGTGGCACGAGG - Intronic
1051002050 9:12294382-12294404 CCATAGCCACTGGGAGAACAAGG - Intergenic
1057439733 9:95074211-95074233 AGACTGCCACAGGGAGGACGGGG - Intronic
1058365080 9:104200149-104200171 CCTGCAGCACAGGGAGAACGAGG - Intergenic
1062027084 9:134345511-134345533 CCAAGGCCACAGGCAGGACGGGG + Intronic
1062566299 9:137165407-137165429 CGGCCGCCACAGGGAGACAGGGG - Intronic
1203770246 EBV:46305-46327 ACACCGCCACAAGGACAAGGTGG + Intergenic
1187501286 X:19841136-19841158 CCACCGCCATAGTGAGAAGCTGG - Intronic
1196098349 X:111823528-111823550 CCACAGCCACAGGGAGTAAACGG - Intronic
1199745946 X:150772060-150772082 CCACTGCCACATGGAGATGGCGG - Intronic
1199876790 X:151937879-151937901 CCACAACCACAAGGAGAATGTGG + Intergenic