ID: 1182524641

View in Genome Browser
Species Human (GRCh38)
Location 22:30907671-30907693
Sequence TACAATGCCCACTGGAGAGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 117}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182524637_1182524641 -5 Left 1182524637 22:30907653-30907675 CCAATGTGTGAAATGCCTTACAA 0: 1
1: 0
2: 3
3: 6
4: 152
Right 1182524641 22:30907671-30907693 TACAATGCCCACTGGAGAGGCGG 0: 1
1: 0
2: 0
3: 10
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182524641 Original CRISPR TACAATGCCCACTGGAGAGG CGG Exonic
902149904 1:14434775-14434797 GACAGTGCCCCATGGAGAGGAGG - Intergenic
903773406 1:25778150-25778172 TACATTGCCGAGTGGCGAGGGGG + Exonic
903847968 1:26289746-26289768 TACCATGCTCAGTGGAGAGGTGG + Intronic
904279059 1:29405627-29405649 TACACTGCCCATTGGAGAAAAGG + Intergenic
910422923 1:87088176-87088198 TACAATGCCCAATTAAGAGTTGG - Intronic
916032034 1:160885251-160885273 CACAATGCCCAGTGCAGGGGAGG + Intergenic
917563185 1:176181526-176181548 TAAGATACCCACTGGAGAGCAGG - Intronic
918831603 1:189405526-189405548 TACAATGCACACAGCTGAGGAGG + Intergenic
919271661 1:195356388-195356410 TACATTGCCCAGTGGAAACGTGG + Intergenic
922125032 1:222713165-222713187 TCCAATGACCAATGGAGATGCGG - Intronic
1071525097 10:86353909-86353931 GACACTGGCCACTGGAGATGGGG + Intronic
1073249813 10:102114623-102114645 TACAATGGCCACTGGGCCGGGGG + Intronic
1078766382 11:14302560-14302582 TCCAATGCCCACTTCAGATGTGG + Intronic
1079361801 11:19776441-19776463 TTCAAGGCCCTCTGGAGAGGAGG - Intronic
1086643062 11:89184103-89184125 TACACTGCATACAGGAGAGGAGG - Intronic
1086951316 11:92892946-92892968 TACCATGGCCACTGCACAGGCGG - Exonic
1088404172 11:109454135-109454157 TACAATGCCTGATGTAGAGGAGG - Intergenic
1090657998 11:128860598-128860620 TACAAGGCCCACCCGTGAGGTGG - Intronic
1091294395 11:134463229-134463251 TACAATGCCCATTGTATAGTAGG + Intergenic
1092583550 12:9874292-9874314 TATCATGTCCAGTGGAGAGGAGG - Intergenic
1101050647 12:100860215-100860237 TATAATGTCCAGTGGAAAGGTGG - Intronic
1107153651 13:37141383-37141405 TACAATAAACAATGGAGAGGAGG - Intergenic
1107978286 13:45711145-45711167 TAGAATGCACACTAGAGAAGAGG - Intronic
1109326001 13:60869035-60869057 TAGAATGCTTGCTGGAGAGGTGG + Intergenic
1110776503 13:79413759-79413781 AACAGTGCCCACTGAAGAGTTGG - Intergenic
1111249397 13:85583749-85583771 TACAATGCCAGCAGGTGAGGTGG - Intergenic
1112180187 13:97070535-97070557 TCTAATGACCACTGGAGAAGAGG + Intergenic
1117080895 14:52150892-52150914 TACAATGCTCCCTGTAGAGAGGG + Intergenic
1120153313 14:81062987-81063009 CTAAATGCCCACTAGAGAGGGGG + Intronic
1120348673 14:83325055-83325077 TACAATGCACTCTGGAGCTGTGG - Intergenic
1121031948 14:90665610-90665632 TCCAAATCCCACTGGGGAGGGGG + Intronic
1122836204 14:104432263-104432285 TACAAGGCCCTCTGGAGACATGG - Intergenic
1125746452 15:42000577-42000599 TAACCTGCCCACTGTAGAGGAGG + Intronic
1128474003 15:67981573-67981595 TGCCAAGCCCATTGGAGAGGTGG - Intergenic
1129191459 15:73940078-73940100 TAGAATGCCATCTGGAGCGGAGG + Intronic
1132282827 15:100634934-100634956 GAGAATGCCCCCTGGAAAGGAGG + Intronic
1133629022 16:7601252-7601274 TACAGTTCCCACTAGAGAGCTGG - Intronic
1133912438 16:10078349-10078371 TATAATGCCCACTTCACAGGTGG + Intronic
1134238468 16:12486318-12486340 TACAGGGGCCACTGCAGAGGAGG - Intronic
1139151957 16:64392856-64392878 GACAATTCCCATTGGAAAGGAGG + Intergenic
1139559054 16:67730161-67730183 TGAAATGCTCACAGGAGAGGAGG + Intronic
1139659207 16:68409473-68409495 TAAAATGCCCACTTCAGAGATGG - Intronic
1140102842 16:71933310-71933332 TACACTGCACACTGGAAAAGGGG - Intronic
1140132886 16:72179699-72179721 TACACTGCAGAATGGAGAGGAGG + Intergenic
1141751258 16:85959931-85959953 CACAGTCCCCACTGGCGAGGGGG - Intergenic
1143321624 17:6072121-6072143 CACAATGCCCACTGAAGAGAGGG - Intronic
1145974637 17:28977151-28977173 AACAATACCCACTGGAGAGTTGG - Intronic
1147715474 17:42504825-42504847 AACAATGCCCCCTGAAGAGGAGG - Intronic
1147781613 17:42947002-42947024 TCCAATGCCCCAGGGAGAGGGGG - Intergenic
1152531744 17:80922950-80922972 AAGAACGCCCGCTGGAGAGGGGG - Intronic
1153130575 18:1851390-1851412 CACAGTGCCCACTGGAGACTGGG - Intergenic
1154316646 18:13309528-13309550 TAGAGTGCCCACAGGAGAAGGGG - Intronic
1155226887 18:23737037-23737059 TACTCTGCCCACTGGAGGAGGGG - Intronic
1158792049 18:60793422-60793444 TAACATGCCCACTGAAGAAGGGG - Intergenic
1163392461 19:17038820-17038842 TAGAAAGCCCACAGGTGAGGTGG + Intergenic
1163392466 19:17038850-17038872 TAGAAAGCCCACAGGTGAGGTGG + Intergenic
1164565700 19:29324362-29324384 GAAAATGCCCACTCCAGAGGTGG - Intergenic
1165756017 19:38293419-38293441 TGCAATGACCACTGGAGAGTGGG - Intronic
933185601 2:79275770-79275792 CACAATGCCCAATGCATAGGAGG - Intronic
937522108 2:122724345-122724367 TACACTGCCTCCTGAAGAGGAGG + Intergenic
939848931 2:147280723-147280745 TACAAAGCCAACAGGAAAGGAGG + Intergenic
940359060 2:152777816-152777838 TACAGTGCCCACTACAGAGTGGG - Intergenic
940508858 2:154587194-154587216 TATAACGGCCACTGGACAGGTGG - Intergenic
940925912 2:159363513-159363535 TACAAGCCCCACAGCAGAGGCGG + Intronic
941117852 2:161492348-161492370 TACATTGCCCACAGAAGAGCAGG - Intronic
943123724 2:183770377-183770399 AATATTGCCCACTGGAGAGTAGG - Intergenic
943466219 2:188232172-188232194 TAAAATGCCCTCTGGTGAGCTGG - Intergenic
943730397 2:191297244-191297266 TTGCATGCCCACAGGAGAGGAGG - Intronic
948459954 2:238124251-238124273 TCCAGTGCCCACTGGAGGGCAGG + Intronic
1169359098 20:4932904-4932926 TGAATTGCCCACTAGAGAGGGGG + Intronic
1174724570 20:52847915-52847937 TACAATGTCCTTTGCAGAGGTGG + Intergenic
1175788312 20:61725695-61725717 GGGAAAGCCCACTGGAGAGGTGG - Intronic
1176053131 20:63131091-63131113 CACAATGCCCACCTGAGAGGAGG + Intergenic
1177553342 21:22655030-22655052 TACAATGCCTAGTGAAGTGGAGG - Intergenic
1178292229 21:31378555-31378577 TAAAATGCCCTTTGGAGAGCAGG - Intronic
1179560562 21:42213499-42213521 GACAATGCCCAGTGGAGGTGTGG + Intronic
1182383254 22:29911644-29911666 TAGAAAGCCCACTGGAGAAATGG - Intronic
1182524641 22:30907671-30907693 TACAATGCCCACTGGAGAGGCGG + Exonic
1182828601 22:33286311-33286333 TACCTTTCCCCCTGGAGAGGTGG + Intronic
951205551 3:19922606-19922628 TACACTGCCCACTGGCTAGAGGG - Intronic
960958705 3:123053760-123053782 GACAATGACCACAGGGGAGGAGG - Intergenic
962060951 3:131926870-131926892 TAAAAAGCCCACTGGAGAGATGG + Intronic
966906818 3:184532223-184532245 TCCAGTGCCCACTTGAGATGTGG - Intronic
968215357 3:196884970-196884992 CACAATGAAAACTGGAGAGGAGG - Intronic
969245134 4:5927039-5927061 TACGATGCCCACTGTGGAAGGGG + Intronic
975632303 4:76416185-76416207 TCCCATGTCCACTGGACAGGGGG - Intronic
978474906 4:109115704-109115726 TACACTGGCCTCTGGAGAAGGGG - Intronic
980441035 4:132845258-132845280 AAAAATGCCCCCTGGAGATGTGG + Intergenic
984688572 4:182699191-182699213 TACAAGGCCCACTGGAAGGCGGG + Intronic
985479057 5:95849-95871 TCCAATGGACACTAGAGAGGTGG - Intergenic
985681675 5:1259009-1259031 GTAAATGCCCACAGGAGAGGGGG + Intronic
985681690 5:1259074-1259096 GTAAATGCCCACAGGAGAGGGGG + Intronic
987550319 5:19371155-19371177 TACATTCCACACTGTAGAGGTGG - Intergenic
999249969 5:150176679-150176701 ACCAATGCCCAGAGGAGAGGAGG + Intronic
999932664 5:156450357-156450379 TCCTATGCACACTGGATAGGGGG + Intronic
1000129979 5:158287729-158287751 TAAAATGCACACTTGAGAGATGG - Intergenic
1001432344 5:171672800-171672822 TACTCTGGCCACTGGAGAGTGGG + Intergenic
1003964717 6:11241909-11241931 TACAAGGCCTGGTGGAGAGGCGG + Intronic
1005891084 6:30138959-30138981 TGCAATGTCCACAGGAGAGTGGG + Intronic
1009557850 6:65197492-65197514 TATTATGCGAACTGGAGAGGTGG + Intronic
1013216283 6:108030367-108030389 TACAATGTAGTCTGGAGAGGAGG + Intergenic
1017720323 6:157239215-157239237 TACAATCCCCACTGGAACTGGGG - Intergenic
1017971559 6:159316097-159316119 TAAAATGCCCATTGCAGACGTGG - Intergenic
1018722258 6:166581781-166581803 TGGAATGCCCACTGGGCAGGTGG + Intronic
1018722300 6:166581901-166581923 TGGAATGCCCACTGGGCAGGTGG + Intronic
1023158082 7:37271647-37271669 TAGATTTCCCACTGCAGAGGAGG - Intronic
1029863152 7:103597249-103597271 TTTAATGCCCACAGGACAGGAGG - Intronic
1032119402 7:129145239-129145261 TACAACGCCCCCTGCAGACGCGG - Intronic
1033474819 7:141681823-141681845 TCCAATGCCCACTGTAGATGTGG + Intronic
1034746569 7:153528674-153528696 GAAAAGGCCCACTGGAGAAGTGG - Intergenic
1034860509 7:154591138-154591160 CACAAGGGCCACTGGAGAAGAGG + Intronic
1041932348 8:63300686-63300708 TACAAAGCCTCCTGGTGAGGGGG + Intergenic
1043464271 8:80488977-80488999 TACATTGTCCACTGGGGCGGGGG - Intronic
1047361533 8:124173765-124173787 TACCATCTCCACTGGAGAGCAGG + Intergenic
1048171409 8:132110164-132110186 TACAGTGCGCTGTGGAGAGGTGG + Intronic
1048854151 8:138672510-138672532 TAGAAGGCCCACTGGAGGGCAGG + Intronic
1049295024 8:141828261-141828283 TTTAATAGCCACTGGAGAGGGGG + Intergenic
1052560730 9:30079609-30079631 TACCATGCCCAGTGGAGGAGTGG + Intergenic
1060494087 9:124105280-124105302 TAGAATGCCCACAGGAGTGGTGG - Intergenic
1061914236 9:133740997-133741019 CACAGTCCCCACTGGAGCGGTGG - Intergenic
1186784685 X:12946500-12946522 TACAATTCACATGGGAGAGGAGG + Intergenic
1186871866 X:13781584-13781606 TACAATTCACATGGGAGAGGAGG - Intronic
1187241979 X:17522131-17522153 TACAAGGGCCACTTGAGAGATGG + Intronic
1191062773 X:56317529-56317551 TGCAATGCACACTGTTGAGGAGG - Intergenic
1192344464 X:70289851-70289873 TGGACTGCCCACTGGTGAGGTGG - Exonic
1192431908 X:71118539-71118561 GACAATACCGACTGCAGAGGAGG - Intronic
1197042021 X:121948716-121948738 TACACTGCCTACTGGAGCTGTGG - Intergenic
1201974343 Y:19832073-19832095 TCAAATGTCCACTGGACAGGGGG + Intergenic