ID: 1182526900

View in Genome Browser
Species Human (GRCh38)
Location 22:30926227-30926249
Sequence GCTGTTTGGACGCCACAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 128}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182526900 Original CRISPR GCTGTTTGGACGCCACAGCC AGG Intronic
902152979 1:14460091-14460113 GGTGTTTGGATGCCCAAGCCTGG + Intergenic
907450434 1:54542533-54542555 GCTGTCTGGAGGCCAGCGCCGGG - Intronic
908428365 1:64031190-64031212 GCTGTTTGGAGGACACAGCTTGG + Intronic
912633190 1:111267138-111267160 GCTGTCTGGTAGCCAGAGCCTGG + Intergenic
1063149065 10:3320528-3320550 GCTCCTTGGACCCCACAGTCTGG - Intergenic
1064193469 10:13227148-13227170 CCTGTTTGCAGGCCTCAGCCAGG + Intronic
1067068866 10:43118520-43118542 GCTGTATGGAGCCCCCAGCCTGG - Intronic
1070247205 10:74743818-74743840 GCCGGTGGGACGGCACAGCCTGG - Intergenic
1070618012 10:77984099-77984121 GTAGTGTGGACGCCACAGGCTGG + Intronic
1072636119 10:97179713-97179735 GCTGTCTGTCCGCCACAGGCTGG + Intronic
1072871463 10:99124888-99124910 GCAGTTTGGGAGGCACAGCCAGG - Intronic
1075188479 10:120284640-120284662 CCTGTTTGGTCCCCACACCCAGG + Intergenic
1076302981 10:129441866-129441888 GCTGTTTGGAGCCCAGAGACTGG - Intergenic
1076557325 10:131335729-131335751 GCTGTGTGGTCACCACAGCATGG + Intergenic
1077363040 11:2149281-2149303 AGGGTCTGGACGCCACAGCCAGG - Exonic
1079877804 11:25881646-25881668 GCTGTTAGAACACCACAGACTGG - Intergenic
1081245763 11:40764482-40764504 GCTGTCTGGGAGCCAGAGCCTGG - Intronic
1081295479 11:41381513-41381535 GCTGTTTGGAAGGCAGAGGCAGG + Intronic
1082864011 11:57881956-57881978 GCTGTGTGGATGCTACAGTCTGG - Intergenic
1085730102 11:78990332-78990354 GCAGGTGGGAGGCCACAGCCAGG - Intronic
1087039308 11:93783519-93783541 GCTGTCAGCACGCTACAGCCTGG - Intronic
1093866944 12:24238693-24238715 GCTGCTTGAACCCCACTGCCTGG + Intergenic
1098364983 12:69693007-69693029 GCTGTTTGGAAGGCCCAGGCGGG - Intronic
1101390315 12:104294046-104294068 GCTGTCTGGAAGGCAGAGCCAGG + Intronic
1103474823 12:121210476-121210498 GCTGTTTTAAAACCACAGCCTGG + Intronic
1104772400 12:131371731-131371753 GATGTGGGGAGGCCACAGCCTGG - Intergenic
1108618167 13:52156188-52156210 GCTGTGTGGATGCCCCAGCATGG - Exonic
1109747719 13:66648076-66648098 GTTGTCTGGAAGCCAAAGCCTGG - Intronic
1111938588 13:94584619-94584641 GGTGTTTAGAGGCCACAGTCTGG - Intronic
1112442254 13:99432986-99433008 CCTGTTTCGGCTCCACAGCCGGG - Intergenic
1115534035 14:34355832-34355854 GCTGTTTCTCAGCCACAGCCTGG + Intronic
1116889197 14:50250510-50250532 GCTGTCTGGAAGCCACAGATTGG - Intronic
1118887538 14:69879408-69879430 GCAGGTTGGACGCCTGAGCCCGG - Exonic
1118891218 14:69910856-69910878 GCTGTTTGGAAGCCTGAGACTGG + Intronic
1120891117 14:89492214-89492236 GCTATTTGGTCCCCTCAGCCTGG + Intronic
1123118045 14:105903549-105903571 GCTGTGTGCACGCCTCAGCTTGG - Intergenic
1123958691 15:25370014-25370036 CCTGTGTGGACGGCACTGCCTGG - Intronic
1128552012 15:68604012-68604034 GCAGTCTTGACTCCACAGCCTGG - Intronic
1131399623 15:92113917-92113939 CCTGTTTGTGGGCCACAGCCCGG + Intronic
1134045547 16:11098486-11098508 GCTCTTAGGAAGCCACAGCTGGG - Intronic
1135612946 16:23884489-23884511 CCTGTTTGAACACCACATCCAGG + Intronic
1141590816 16:85067409-85067431 CCTGTGTGGACGAGACAGCCTGG + Intronic
1141953807 16:87356497-87356519 GCTGAGTGGAGGCCAGAGCCAGG - Intronic
1144862674 17:18315330-18315352 GCTCCTAGGACGCCACAACCCGG - Exonic
1147718227 17:42522126-42522148 GCTGTTTGGAAGCCATTGGCAGG + Exonic
1152237699 17:79147103-79147125 GCTGTCTGGACACCAGAGCCAGG + Intronic
1152319617 17:79601112-79601134 GGTGTGTAGACGCCCCAGCCGGG - Intergenic
1154388840 18:13919152-13919174 GCTGTAGGGAGGCCATAGCCTGG + Intergenic
1160178824 18:76617305-76617327 GCCATTTGGAGGCCACAGCAGGG - Intergenic
1160943415 19:1630437-1630459 CCTGTTTGGGCCCCACAGCGGGG - Intronic
1161042402 19:2117090-2117112 GCTGATTGGAGGCCTCAGGCGGG - Intronic
1161318875 19:3631987-3632009 GCTGGTTGGAGGCCAGAGCTCGG - Exonic
1162891058 19:13733424-13733446 GCTCATTAGACGCCATAGCCAGG + Intronic
1163157107 19:15445580-15445602 GCTGTCTTGAGGCCCCAGCCTGG - Intronic
1165259268 19:34598513-34598535 GATTTTTGGACACCTCAGCCAGG + Intronic
1165826268 19:38707653-38707675 GCTGTGTGGCCTCCACACCCTGG - Intronic
1167210240 19:48129649-48129671 GCTTTTTGGTCGCCACAGGTTGG - Intronic
930510875 2:52343554-52343576 GTTGTTTGCTTGCCACAGCCTGG - Intergenic
935956104 2:108378062-108378084 TCTGCTGTGACGCCACAGCCTGG + Exonic
936399908 2:112156965-112156987 GGTGTGTGGCCCCCACAGCCAGG - Intronic
938021827 2:127912291-127912313 TCTATTTGCACGCCACAGCCTGG + Intergenic
941728519 2:168890178-168890200 GCTGTTTGGGCCTCACAGCCTGG - Intronic
945030044 2:205654983-205655005 GCTGGTGGGACACCACAACCGGG + Intergenic
949042608 2:241856224-241856246 TCTGTTTTTAAGCCACAGCCGGG + Intronic
1170864036 20:20137371-20137393 GCTGTCTGGGAGCCAGAGCCAGG + Intronic
1172192474 20:33070229-33070251 GGAGTTTGGACTCCACATCCTGG - Intronic
1174368030 20:50068197-50068219 GCCCTTTGGATGGCACAGCCAGG + Intergenic
1175387340 20:58605674-58605696 GCTGGATGGAGGCCACAGCTGGG + Intergenic
1176286054 21:5020316-5020338 GCCGCGTGGAGGCCACAGCCAGG - Intergenic
1176995017 21:15544753-15544775 GCTGTTTGGGAGCCAGGGCCTGG - Intergenic
1179871127 21:44243159-44243181 GCCGCGTGGAGGCCACAGCCAGG + Intergenic
1180146068 21:45919731-45919753 GGTGTGTGGTGGCCACAGCCCGG - Intronic
1180702764 22:17790668-17790690 GTGGTTTGGATGCCACTGCCTGG + Exonic
1180824989 22:18855808-18855830 GCTGTTTCAACGCCACCACCAGG + Intronic
1181125405 22:20698959-20698981 GCTGTTTCAACGCCACCACCAGG + Intergenic
1181187742 22:21118740-21118762 GCTGTTTCAACGCCACCACCAGG - Intergenic
1181211456 22:21291753-21291775 GCTGTTTCAACGCCACCACCAGG + Intergenic
1181398048 22:22635134-22635156 GCTGTTTCAACGCCACCACCAGG - Intergenic
1181476162 22:23168936-23168958 GCTCACTGGAAGCCACAGCCTGG + Intergenic
1181500792 22:23314505-23314527 GCTGTTTCAACGCCACCCCCAGG - Intronic
1181651360 22:24260926-24260948 GCTGTTTCAACGCCACCACCAGG + Intergenic
1181706018 22:24649813-24649835 GCTGTTTCAACGCCACCACCAGG - Intergenic
1182526900 22:30926227-30926249 GCTGTTTGGACGCCACAGCCAGG + Intronic
1183096788 22:35556943-35556965 GCTGTTTGGAGACAACAGGCTGG - Intergenic
1185108371 22:48886869-48886891 GATGTTGGAAGGCCACAGCCTGG - Intergenic
1185419562 22:50727982-50728004 GCTGTTTGGCGGCCGGAGCCTGG + Intergenic
1203215492 22_KI270731v1_random:3678-3700 GCTGTTTCAACGCCACCACCAGG - Intergenic
1203275134 22_KI270734v1_random:81713-81735 GCTGTTTCAACGCCACCACCAGG + Intergenic
950538437 3:13595192-13595214 ACTGTCTGGACACCCCAGCCTGG - Intronic
960568072 3:119156419-119156441 ACTGTGTGGAAGCCCCAGCCAGG + Intronic
967121079 3:186383479-186383501 GCTGTGCGGAAGCCACTGCCCGG + Intergenic
968451776 4:679311-679333 TCTGGTAGGACGCCACAGGCAGG + Intronic
985241839 4:187938304-187938326 GGAGTTTGGACCACACAGCCTGG - Intergenic
985814520 5:2116702-2116724 GCAGCCTGGACTCCACAGCCAGG - Intergenic
985933723 5:3079160-3079182 GCTGTCTGGAAGCCTCATCCAGG + Intergenic
986288228 5:6377050-6377072 GCTGTGTGGTAGGCACAGCCTGG - Intronic
986742904 5:10719405-10719427 GCTGTTTGGAGCCTACAGCAGGG + Intronic
986745695 5:10742764-10742786 GGTGTTTAGACACCACAGTCTGG + Intronic
991410517 5:66341156-66341178 GCTGTCTGCAAGCTACAGCCTGG + Intergenic
992914222 5:81432498-81432520 GCACTTTGGAAGGCACAGCCAGG + Intronic
1000696655 5:164394121-164394143 TTTGTTTAGATGCCACAGCCTGG - Intergenic
1002971862 6:2031241-2031263 CCTGTGTGGAGGCCTCAGCCTGG - Intronic
1003952253 6:11127242-11127264 GCTGTCTGGGAGCCAGAGCCAGG + Intronic
1004020037 6:11769038-11769060 GCTGTGTGGCCCCCAAAGCCAGG + Intronic
1005208496 6:23432370-23432392 TCTGTTTGGAGCCCACAGGCAGG + Intergenic
1007972553 6:46067374-46067396 TCTGATTGGAAGCCACATCCTGG + Intronic
1016606815 6:145938402-145938424 GCTGTTAGGATACCACAGACTGG - Intronic
1019411228 7:907687-907709 GCTGTTGGGGCGGGACAGCCAGG - Intronic
1019614797 7:1954353-1954375 TCAGCTTGGACCCCACAGCCTGG - Intronic
1022093105 7:27120638-27120660 GCCGTTTGGAGGCCCCAGGCTGG - Intronic
1024131488 7:46357106-46357128 ACGGTTGGGAGGCCACAGCCTGG + Intergenic
1024715446 7:52074742-52074764 GCTGGTTGCACTCCTCAGCCAGG - Intergenic
1027234537 7:76290354-76290376 GCCTTCTGCACGCCACAGCCAGG + Intergenic
1034270779 7:149802635-149802657 GCTGTAGGGCCACCACAGCCAGG - Intergenic
1037608800 8:20459225-20459247 GCTGTTGGGATTCCACACCCTGG + Intergenic
1038101975 8:24387912-24387934 GCTCTTTGGACACCAGAGCCAGG - Intronic
1038367268 8:26948707-26948729 GTTGTGTAGACGCCACAGCCAGG - Intergenic
1038542127 8:28398767-28398789 GGTGTCTGGATGACACAGCCAGG + Intronic
1041416080 8:57609927-57609949 GCTGTTCGGGAGCCACAGGCTGG - Intergenic
1052990587 9:34517332-34517354 TCTTTTTGGCCGCCACAGGCTGG - Exonic
1053127986 9:35598519-35598541 GGTGTTTGGATACCACAACCTGG - Intergenic
1059541337 9:115133316-115133338 GCTGTTAGAACACCACAGACTGG + Intergenic
1060304560 9:122398923-122398945 GCTGTTTGGGGACCAGAGCCTGG - Intergenic
1060426229 9:123508890-123508912 GATATTTGGAGGACACAGCCGGG - Intronic
1060810923 9:126611209-126611231 GCTCGGTGGACGCCAGAGCCTGG - Intergenic
1061667646 9:132169709-132169731 GCTGGCGGGACGGCACAGCCCGG + Intronic
1062042795 9:134411864-134411886 GCTGTGTGGGCTGCACAGCCAGG + Intronic
1062399453 9:136366040-136366062 TCTGCTTGGAGGCCACGGCCTGG + Intronic
1062430394 9:136524377-136524399 CCAGCTTGGACTCCACAGCCCGG + Intronic
1187669390 X:21654426-21654448 GCTGTTTACAGGCCACAACCTGG - Exonic
1189411814 X:40779427-40779449 GCTGTTTGGGAGCCAGGGCCTGG + Intergenic
1193925589 X:87479701-87479723 GCTGGTTGGGCTCCACAGTCAGG + Intergenic
1199675192 X:150182809-150182831 GCTGTCTGGACCCCAGTGCCTGG + Intergenic
1200102246 X:153693996-153694018 GCTGCTTGGTCTCGACAGCCAGG + Exonic
1200764468 Y:7068701-7068723 CCTGTTTGTGAGCCACAGCCTGG + Intronic