ID: 1182532131

View in Genome Browser
Species Human (GRCh38)
Location 22:30968873-30968895
Sequence CGCGGGCGGCGCGCGGGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182532131_1182532140 4 Left 1182532131 22:30968873-30968895 CCGCCGCCCGCGCGCCGCCCGCG No data
Right 1182532140 22:30968900-30968922 GCGCTAGTTGAGATGGTGACAGG No data
1182532131_1182532138 -3 Left 1182532131 22:30968873-30968895 CCGCCGCCCGCGCGCCGCCCGCG No data
Right 1182532138 22:30968893-30968915 GCGCGCCGCGCTAGTTGAGATGG No data
1182532131_1182532141 25 Left 1182532131 22:30968873-30968895 CCGCCGCCCGCGCGCCGCCCGCG No data
Right 1182532141 22:30968921-30968943 GGATTCAGCAACACGAAATTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182532131 Original CRISPR CGCGGGCGGCGCGCGGGCGG CGG (reversed) Intergenic
No off target data available for this crispr