ID: 1182532489

View in Genome Browser
Species Human (GRCh38)
Location 22:30970583-30970605
Sequence CTGTTATCTGCTGCTTGTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182532483_1182532489 18 Left 1182532483 22:30970542-30970564 CCTATTTAAATAAGCCTATTTTA No data
Right 1182532489 22:30970583-30970605 CTGTTATCTGCTGCTTGTACTGG No data
1182532486_1182532489 -6 Left 1182532486 22:30970566-30970588 CCTTTGGCCCGTCAACTCTGTTA No data
Right 1182532489 22:30970583-30970605 CTGTTATCTGCTGCTTGTACTGG No data
1182532485_1182532489 4 Left 1182532485 22:30970556-30970578 CCTATTTTATCCTTTGGCCCGTC No data
Right 1182532489 22:30970583-30970605 CTGTTATCTGCTGCTTGTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182532489 Original CRISPR CTGTTATCTGCTGCTTGTAC TGG Intergenic
No off target data available for this crispr