ID: 1182534094

View in Genome Browser
Species Human (GRCh38)
Location 22:30987147-30987169
Sequence CAGAAACAGCAGAATTAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182534094_1182534099 21 Left 1182534094 22:30987147-30987169 CCGGCCTAATTCTGCTGTTTCTG No data
Right 1182534099 22:30987191-30987213 AGAATGGCAAAGATGAGCCCAGG No data
1182534094_1182534096 -2 Left 1182534094 22:30987147-30987169 CCGGCCTAATTCTGCTGTTTCTG No data
Right 1182534096 22:30987168-30987190 TGTTCCACTTCTGTTGACTCAGG No data
1182534094_1182534098 5 Left 1182534094 22:30987147-30987169 CCGGCCTAATTCTGCTGTTTCTG No data
Right 1182534098 22:30987175-30987197 CTTCTGTTGACTCAGGAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182534094 Original CRISPR CAGAAACAGCAGAATTAGGC CGG (reversed) Intergenic
No off target data available for this crispr