ID: 1182545822

View in Genome Browser
Species Human (GRCh38)
Location 22:31075922-31075944
Sequence GGTCCCCCATGGTCTCATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 2, 2: 0, 3: 2, 4: 45}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182545822_1182545835 26 Left 1182545822 22:31075922-31075944 CCAATATGAGACCATGGGGGACC 0: 1
1: 2
2: 0
3: 2
4: 45
Right 1182545835 22:31075971-31075993 GGCACTGCCTCCGTGCCATTTGG 0: 1
1: 0
2: 1
3: 8
4: 85
1182545822_1182545831 5 Left 1182545822 22:31075922-31075944 CCAATATGAGACCATGGGGGACC 0: 1
1: 2
2: 0
3: 2
4: 45
Right 1182545831 22:31075950-31075972 CCCCAACTGGCAGTGGCTCCAGG No data
1182545822_1182545827 -2 Left 1182545822 22:31075922-31075944 CCAATATGAGACCATGGGGGACC 0: 1
1: 2
2: 0
3: 2
4: 45
Right 1182545827 22:31075943-31075965 CCCCAGGCCCCAACTGGCAGTGG 0: 1
1: 2
2: 2
3: 42
4: 402
1182545822_1182545825 -8 Left 1182545822 22:31075922-31075944 CCAATATGAGACCATGGGGGACC 0: 1
1: 2
2: 0
3: 2
4: 45
Right 1182545825 22:31075937-31075959 GGGGGACCCCAGGCCCCAACTGG 0: 1
1: 2
2: 0
3: 17
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182545822 Original CRISPR GGTCCCCCATGGTCTCATAT TGG (reversed) Intronic
901500695 1:9651277-9651299 GGTCTCCCATAGTCACATTTTGG + Intergenic
903063503 1:20685703-20685725 GTTCCCCGATGGTGTCATAGGGG + Intronic
915599586 1:156913907-156913929 GGTCCCGGATGGTGGCATATGGG - Exonic
1076689851 10:132217474-132217496 AGTCCCCCATAGTCTTATTTTGG - Intronic
1076919545 10:133444592-133444614 GGTCCCCCAGGGTCTCCCACAGG + Intergenic
1088438550 11:109842324-109842346 GGTTCCCCATGGTGTTACATTGG - Intergenic
1095397485 12:41777310-41777332 GGTTCCCCAAGGTCACACATCGG + Intergenic
1099705367 12:86145860-86145882 GTTCCCCTAGGGTCTAATATTGG - Intronic
1101212933 12:102552607-102552629 GGTCTCCCATGGACTTCTATTGG + Intergenic
1103080967 12:118023615-118023637 GGTACCCAATGTTCTCACATGGG - Intronic
1106410963 13:29511227-29511249 GGTCACCCCTGGACTCGTATTGG + Exonic
1116171389 14:41407203-41407225 GGGATCCCCTGGTCTCATATAGG - Intergenic
1120442576 14:84559044-84559066 GGTCCCCAATTTTCTCACATTGG + Intergenic
1123414294 15:20083646-20083668 GGTCCCCCATGGTCTCATGTTGG + Intergenic
1123523636 15:21090757-21090779 GGTCCCCCATGGTCTCATGTTGG + Intergenic
1137053854 16:35734352-35734374 GGTGCCCCATGGTCTCCGCTTGG + Intergenic
1139419035 16:66837280-66837302 GGTCCCCCATAGCATCATGTAGG - Intronic
1154167160 18:12024591-12024613 TGTCCCCCATGGCCTCCTCTGGG + Intronic
1156696829 18:39777834-39777856 GGTCCTGCAAGGTCTTATATTGG - Intergenic
1164580218 19:29430132-29430154 GGTCCCACATCATCTGATATAGG + Intergenic
1165326106 19:35115459-35115481 GCTCCCCCATGGTCCCAGTTGGG - Intergenic
1165388878 19:35527255-35527277 GGTCCACCATGGTCTCAGTGAGG - Exonic
1165388942 19:35527471-35527493 GGTCCACCATGGTCTCAGTGAGG - Exonic
1165971681 19:39637094-39637116 TGTCCCCCCTGGTCTCACACTGG - Intergenic
1169285538 20:4304276-4304298 GGTCCCTCATGGTCAGATATTGG + Intergenic
1174953382 20:55067431-55067453 AGGCCCTCATGGTCTCATAAGGG + Intergenic
1181749137 22:24976715-24976737 GGTCCCCCATGGGCTCAGCTAGG - Intronic
1182545822 22:31075922-31075944 GGTCCCCCATGGTCTCATATTGG - Intronic
1183412954 22:37666076-37666098 GGTCCCCTATGGATTCATCTTGG + Exonic
951233016 3:20201374-20201396 GGTCCACCATGGTCACAGAGTGG - Intergenic
955594844 3:60577353-60577375 GGTGCCCCATGCTCTCTTTTGGG + Intronic
960367288 3:116788099-116788121 GGTTGCCCAGGGTCTCACATTGG - Intronic
971533950 4:27724380-27724402 GCTATCCCATTGTCTCATATAGG - Intergenic
976069218 4:81222183-81222205 GCTCCCTTATGGACTCATATGGG - Intergenic
976229542 4:82827382-82827404 GGTGCCCCAGGGGCTCCTATTGG - Exonic
982598303 4:157413773-157413795 GGACCCCCAAGGCCTCAGATAGG + Intergenic
987165952 5:15198090-15198112 GTTCCCCAAGGGTCTCTTATTGG + Intergenic
992017690 5:72592551-72592573 TGTCCCCCATGGCCACATCTTGG - Intergenic
1001774185 5:174316299-174316321 GGTCACTCATGGGCTCATGTTGG - Intergenic
1005953510 6:30647821-30647843 GGTCCCCGATGGTGTCCTAGAGG - Exonic
1006734640 6:36264319-36264341 GTTGTCCCATGGTCTCATAATGG + Intronic
1017078349 6:150640848-150640870 GGTCTCCTGTGGTCTAATATTGG + Intronic
1019514370 7:1433274-1433296 GGTGACCCATGGCCTCATCTGGG + Intronic
1022809451 7:33854699-33854721 GGTCACCAAAGGTCTCATGTGGG + Intergenic
1028289984 7:89053888-89053910 GGTCCTCCCTTGTCTCAGATGGG + Intronic
1030545287 7:110886643-110886665 AGTCCCCCGTGGTCACATCTGGG - Exonic
1046691567 8:117291351-117291373 GGTCCCCCGTGGCCACATCTGGG + Intergenic
1049052934 8:140213175-140213197 GAGCCCTCATGATCTCATATGGG + Intronic
1049849390 8:144822697-144822719 GGACCTCCATGTTGTCATATTGG - Intergenic
1054716101 9:68559207-68559229 GGCCCTCCATGGCCTCATAGGGG - Intergenic