ID: 1182549096

View in Genome Browser
Species Human (GRCh38)
Location 22:31091427-31091449
Sequence GGCCTGTGGAGGCCTGGCCA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 589
Summary {0: 1, 1: 0, 2: 7, 3: 49, 4: 532}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182549096_1182549102 -4 Left 1182549096 22:31091427-31091449 CCGTGGCCAGGCCTCCACAGGCC 0: 1
1: 0
2: 7
3: 49
4: 532
Right 1182549102 22:31091446-31091468 GGCCGGGTGCTGCTGCCCACAGG 0: 1
1: 0
2: 1
3: 28
4: 272
1182549096_1182549107 11 Left 1182549096 22:31091427-31091449 CCGTGGCCAGGCCTCCACAGGCC 0: 1
1: 0
2: 7
3: 49
4: 532
Right 1182549107 22:31091461-31091483 CCCACAGGCAACCAGAGGGCAGG 0: 1
1: 0
2: 3
3: 40
4: 280
1182549096_1182549104 6 Left 1182549096 22:31091427-31091449 CCGTGGCCAGGCCTCCACAGGCC 0: 1
1: 0
2: 7
3: 49
4: 532
Right 1182549104 22:31091456-31091478 TGCTGCCCACAGGCAACCAGAGG 0: 1
1: 0
2: 1
3: 24
4: 239
1182549096_1182549109 15 Left 1182549096 22:31091427-31091449 CCGTGGCCAGGCCTCCACAGGCC 0: 1
1: 0
2: 7
3: 49
4: 532
Right 1182549109 22:31091465-31091487 CAGGCAACCAGAGGGCAGGTAGG 0: 1
1: 0
2: 4
3: 39
4: 330
1182549096_1182549105 7 Left 1182549096 22:31091427-31091449 CCGTGGCCAGGCCTCCACAGGCC 0: 1
1: 0
2: 7
3: 49
4: 532
Right 1182549105 22:31091457-31091479 GCTGCCCACAGGCAACCAGAGGG 0: 1
1: 0
2: 1
3: 20
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182549096 Original CRISPR GGCCTGTGGAGGCCTGGCCA CGG (reversed) Exonic
900014382 1:138209-138231 GGCCTCTGCAGGCCTCGACAAGG - Intergenic
900044247 1:493411-493433 GGCCTCTGCAGGCCTCGACAAGG - Intergenic
900065655 1:728317-728339 GGCCTCTGCAGGCCTCGACAAGG - Intergenic
900126047 1:1069383-1069405 GGCCTGTGCGGGCGTCGCCATGG + Intergenic
900472896 1:2863374-2863396 GCCATGTGGGGTCCTGGCCATGG + Intergenic
900621585 1:3590079-3590101 GGGCTGTGCTGGCCTGGCCCAGG - Intronic
900624661 1:3602711-3602733 GTGCCGTGGAGGCCTGGCCACGG - Intronic
900752189 1:4405562-4405584 GGCCTTGGGGGGCCTGGGCAGGG + Intergenic
900793161 1:4692549-4692571 GGCCTGCGGAGGCCAGGCTGGGG - Intronic
900992247 1:6103440-6103462 GGCCTGTGGCGGTCAGGGCAGGG - Exonic
901212634 1:7535076-7535098 GGCCTGTGGGTGGCTGGCCCGGG - Intronic
901325086 1:8360863-8360885 GGCCTTGGGAGGCCTGGGGAGGG + Exonic
901477535 1:9500911-9500933 GACGTCTGGAGGCCTGGACAGGG + Intergenic
901626416 1:10627598-10627620 GGCCTGTGAAGACCTGGTCAGGG + Intronic
901641939 1:10697043-10697065 AGCCTGTGGCTACCTGGCCAGGG - Intronic
902174175 1:14636995-14637017 GACCTCTGGAGGGCTGGACATGG + Intronic
902554291 1:17237916-17237938 GGCTTGGGAAGGCATGGCCAGGG + Intronic
902672589 1:17985108-17985130 GACCTGTGGAGTCCAGGCCTTGG + Intergenic
902728369 1:18352154-18352176 GGCCTGGGGTAGCCTGGCTAAGG + Intronic
903024533 1:20417972-20417994 GGGCTGGGGAGGCCTGGCTCAGG + Intergenic
903182415 1:21611620-21611642 GCCCCATGGAGGCCTGGCCAGGG - Intronic
903226481 1:21896702-21896724 GGCAGGTGGAAGGCTGGCCAGGG + Intronic
903331276 1:22598304-22598326 GGCCTGTGGTGTCCAAGCCAGGG - Intronic
903848264 1:26291122-26291144 GGCCTGTGGAGGGTGAGCCAGGG - Intronic
904033797 1:27548758-27548780 GGGCTATGGAGGCCTGGACTGGG - Exonic
904040289 1:27580312-27580334 GCCCTCTGGAAGCCAGGCCAGGG + Intronic
904259536 1:29280392-29280414 GGACTGTCCAGGCCTGTCCAGGG + Intronic
904266428 1:29320821-29320843 GGCCAGTGGAGGCCTCACCCAGG - Exonic
904492555 1:30870028-30870050 GGCCTGGGGAGGCAAGTCCAGGG + Intronic
904609702 1:31718714-31718736 TGCCTGTGCAGGCCTGGGAAGGG - Intergenic
904614645 1:31743229-31743251 CCCCTGTGGACGCCTGGACAAGG + Intronic
904625230 1:31798599-31798621 AGGCTGTGGAGGCCAGGGCAGGG + Exonic
905036015 1:34918754-34918776 GCACTGTGGGGCCCTGGCCAGGG - Intronic
905362728 1:37431445-37431467 GCCCTGGGGAGGCCTGGCCAAGG + Intergenic
906264434 1:44417783-44417805 GCCCCGGGGAGGCCAGGCCACGG + Intronic
906675360 1:47689105-47689127 GGGAGGTGGGGGCCTGGCCAGGG - Intergenic
906698061 1:47838038-47838060 GGGCTGTGCCGGCCTGCCCAGGG - Intronic
908096662 1:60746549-60746571 GGCCTGGGGAGGCCTGCTCCAGG - Intergenic
909606266 1:77511725-77511747 AGCCTATGGTGGCCTGGGCAGGG + Intronic
910852836 1:91665501-91665523 AGACTGTGGGGCCCTGGCCAAGG - Intergenic
911041214 1:93592422-93592444 GGCCTGGTGTGGCCTGGGCAGGG - Intronic
911061504 1:93751838-93751860 AGGCTGGGGAGGCCTTGCCAGGG - Intronic
911524888 1:98972801-98972823 GGCTAGTGTAGGCCTGGGCATGG + Intronic
911657508 1:100461595-100461617 GGCCTTTGCAGGCCTTGCAATGG - Intronic
912384822 1:109266015-109266037 GGCCTGGGGAGGCCTAGGGAGGG + Intronic
914244068 1:145872938-145872960 GGCCCTAGGAGGCCTGGCAAAGG - Exonic
915107791 1:153545182-153545204 GGCTGCTGGAGGCCTGCCCAGGG + Intronic
915293086 1:154899432-154899454 AGACTGTGGTGGCCTGGGCATGG - Intergenic
916010865 1:160704340-160704362 GGCATTTTGAGGTCTGGCCAAGG + Intronic
916010974 1:160705389-160705411 GGCATTTTGAGGTCTGGCCAAGG - Intronic
916058493 1:161083751-161083773 GGCCCGTGGGGGCCTGGCCAGGG - Intronic
916487019 1:165269023-165269045 AGCCTTTGGAGGCTTAGCCAGGG - Intronic
917197333 1:172480325-172480347 GGCCTGTGGTGTCATGGCCATGG + Intergenic
918042450 1:180921578-180921600 GGCCTGTGGGGGCAGGGACAGGG - Intronic
918647284 1:186919004-186919026 AGACTGTGGGGCCCTGGCCAAGG - Intronic
919919090 1:202157760-202157782 GGTCCTTGGAGGCGTGGCCAGGG + Exonic
920528306 1:206684831-206684853 GGCCTGGGGAGGCGTGGCGTGGG - Intergenic
921338569 1:214111871-214111893 GGCATGGGGAGGGCTGGGCAGGG - Intergenic
922100439 1:222473866-222473888 GGCCTCTGCAGGCCTCGACAAGG - Intergenic
922262055 1:223951704-223951726 GGCCTCTGCAGGCCTCGACAAGG - Intergenic
922734213 1:227970874-227970896 GGCCTCTGCAGGCCTCGACAAGG + Intergenic
922975256 1:229778782-229778804 GGGCTGGGGAGGCCAGGTCAGGG + Intergenic
924858949 1:247901374-247901396 AGACTGTGGGGCCCTGGCCAAGG - Intergenic
1062909087 10:1200331-1200353 GGCCTGTGGAGCCCAGTCCCAGG - Intronic
1064418388 10:15169098-15169120 GCCCTGTGCAGGGCTGGCCAGGG - Intergenic
1064750025 10:18519193-18519215 GGCCAGTGGTGTCCTGCCCAAGG - Intronic
1064966676 10:21021419-21021441 AGTCTGCAGAGGCCTGGCCATGG - Intronic
1065931143 10:30480151-30480173 AGACTGTGGGGCCCTGGCCAAGG + Intergenic
1065939808 10:30554071-30554093 GGGCTGTGCAGGCATTGCCAAGG - Intergenic
1066452403 10:35542609-35542631 AGCCTGGGGAGGCCTTGGCAGGG + Intronic
1067053531 10:43038603-43038625 GGGCCATGGAGGACTGGCCAGGG - Intergenic
1067548876 10:47219242-47219264 GGCTTGAGCAGGCCTGGTCAGGG - Intergenic
1067800235 10:49353638-49353660 GGCCAGAGGAGGGCTGGCCTAGG + Intergenic
1067942782 10:50670111-50670133 GGCCTGGGGAGGGCAGGCCAAGG - Intergenic
1068671672 10:59729518-59729540 AGACTGTGGGGCCCTGGCCAAGG - Intronic
1069569563 10:69486126-69486148 TGCCTGTGAAGGACTGGGCACGG + Intronic
1069590996 10:69641731-69641753 GGTCTGTGGAGGACTGGGCGGGG + Intergenic
1069630475 10:69894420-69894442 GGCATGGGAAGACCTGGCCATGG + Intronic
1070741616 10:78907238-78907260 GGGCTGTGGAAGCCTGGTAAGGG - Intergenic
1070845775 10:79521863-79521885 GTCCCTTGGAGGCTTGGCCAGGG + Intergenic
1070864025 10:79695074-79695096 GGCCTGGGGAGGGCAGGCCAAGG - Intergenic
1070891571 10:79945317-79945339 GGCTTGGGGAGGGCTGTCCAGGG - Intronic
1070928018 10:80238455-80238477 GTCCCTTGGAGGCTTGGCCAGGG - Intergenic
1071555673 10:86599694-86599716 GGCCTGTGGTGGCCTGTCCTGGG - Intergenic
1071630922 10:87217300-87217322 GGCCTGGGGAGGGCAGGCCAAGG - Intergenic
1071695454 10:87864162-87864184 GGCCTCCGGAGCCCGGGCCACGG - Exonic
1072267658 10:93745911-93745933 GGCCTGTGGAGGGCAGGCGGGGG - Intergenic
1072334935 10:94389547-94389569 AGACTGTGGGGCCCTGGCCAAGG + Intergenic
1072540324 10:96393592-96393614 GGCATGTGCAGGCTGGGCCAGGG + Intronic
1073456167 10:103637990-103638012 GACCAGGGGAGGCCTGGCCGAGG - Intronic
1074831745 10:117254466-117254488 CGCCTTGGGAGGCCTGGCCATGG + Exonic
1075132703 10:119754169-119754191 GGCCAGGGGACTCCTGGCCAGGG + Intronic
1075693657 10:124418469-124418491 GGCCTGTGGAGGCCAGGACTCGG - Intronic
1075872009 10:125777963-125777985 GGCCAGGCGAGGCCAGGCCACGG - Intergenic
1076198613 10:128540265-128540287 GGCCTCTGGAGCCCTGACCAGGG - Intergenic
1076199309 10:128545864-128545886 GGCCTGGGGAGGCCAGGCAGGGG - Intergenic
1076473883 10:130739114-130739136 GCCCTGTGGATGTCTGGGCAGGG + Intergenic
1076686334 10:132199994-132200016 GGCCGGGGGTGCCCTGGCCATGG - Intronic
1076762951 10:132614726-132614748 GGCCTCAGGAGGCCTGGCTCTGG + Intronic
1076904459 10:133355245-133355267 GGCCCCTAGAGCCCTGGCCAGGG + Exonic
1076970579 11:129886-129908 GGCCTCTGCAGGCCTCGACAAGG - Intergenic
1076997616 11:306409-306431 GGCCTGTAGAGGCCTGGACATGG + Intergenic
1077033098 11:479031-479053 GGGCCGTGGAGGCCTGGACCGGG + Intronic
1077046736 11:550016-550038 GGGCTGGGGAGGCCTGGGCTGGG + Intronic
1077088065 11:764568-764590 GGCCTGTTGAGGCCATCCCAGGG + Intronic
1077119605 11:900768-900790 GGGCTGTGAATGCCAGGCCAGGG + Intronic
1077171028 11:1165803-1165825 AGCCTGTGGGAGGCTGGCCATGG - Intronic
1077364182 11:2154891-2154913 GCCCTGTGGAGGCCGGGCTGGGG + Intronic
1077394812 11:2315640-2315662 GGCCTGTGGAGGCCTCCGCAGGG - Intronic
1077476015 11:2790872-2790894 GGATTCAGGAGGCCTGGCCAGGG - Intronic
1077547623 11:3182332-3182354 GGCCTCTACAGGCCAGGCCAGGG + Intergenic
1077672164 11:4166721-4166743 GGTCAGTAGGGGCCTGGCCAGGG + Intergenic
1079075782 11:17384799-17384821 GGCCTGGGCAGTCCAGGCCAAGG + Intergenic
1081440195 11:43072305-43072327 GGCCTGTGGACTCCTGGGGAGGG + Intergenic
1081967273 11:47177465-47177487 GCCCTCTGGTGGCCTGGCAAGGG + Intergenic
1081968515 11:47183657-47183679 GGCCTTTGGAGGGCAGGCCCGGG - Intronic
1082051478 11:47773937-47773959 GGCCTGTTGAGGCCTGGTACAGG - Intergenic
1083596528 11:63920497-63920519 GGCCACTGATGGCCTGGCCAGGG - Intergenic
1083780116 11:64913422-64913444 GGCCTGGGGTGGCCAGGGCACGG - Intronic
1083887720 11:65580998-65581020 GGCCTGTGGGGCCCTGCCCTGGG + Intronic
1084031047 11:66480672-66480694 GGCTTCTGGAGGCCGGGGCAGGG + Intronic
1084403996 11:68960633-68960655 GGGCTGTGCATGGCTGGCCACGG + Intergenic
1084547319 11:69820903-69820925 GCCCTGTGCAGGCCTGGGCTGGG + Intergenic
1084589733 11:70083800-70083822 GGACCCCGGAGGCCTGGCCAGGG - Intronic
1084714216 11:70863434-70863456 CGCCTGTGAACTCCTGGCCACGG + Intronic
1084870826 11:72097612-72097634 GGCCTTTGAAGCTCTGGCCAGGG - Exonic
1084963160 11:72727749-72727771 GGCCTCTGGGGGCCTGGCCCTGG + Intronic
1086734054 11:90283743-90283765 GCCTGGTGGAGACCTGGCCATGG + Intergenic
1086973329 11:93106561-93106583 AGACTGTGGGGCCCTGGCCAAGG - Intergenic
1087684639 11:101249234-101249256 AGACTGTGGGGCCCTGGCCAAGG + Intergenic
1088588373 11:111379560-111379582 GGCCTGGGGAGGGCTTGACACGG - Exonic
1089347802 11:117802271-117802293 GACCAGAGGAGGCCTGGTCAGGG - Intronic
1089790119 11:120936842-120936864 GGCAGGTGGGGGCCAGGCCAGGG - Intronic
1090034700 11:123238610-123238632 GGCCTCTGGAGGCCTGGGCTTGG + Intergenic
1090652438 11:128819332-128819354 TGCCTGTGGAGGCGTTGCCTGGG - Intergenic
1090751522 11:129750383-129750405 GGCCCTTGGAGGACTGGCCGGGG + Intergenic
1090923480 11:131229501-131229523 GGCCTCTCGAGGCCTGGGCTTGG + Intergenic
1092429402 12:8396902-8396924 GGCCAGAGCGGGCCTGGCCACGG - Intergenic
1092782511 12:12000044-12000066 GGCCTGGGGAGACCAGGCAAGGG - Intergenic
1093593988 12:20940095-20940117 AGACTGTGGGGCCCTGGCCAAGG - Intergenic
1094849142 12:34374571-34374593 GGCCTGCGGTGGCCAGGTCAAGG - Intergenic
1094851738 12:34385373-34385395 GGCCTATGGGGGCCAGCCCAAGG - Intergenic
1094854367 12:34396382-34396404 GGCCCATGGAGGCCAGCCCAAGG + Intergenic
1094854417 12:34396571-34396593 GGCCTATGGGGGCCAGCCCAAGG + Intergenic
1094856601 12:34405658-34405680 GGCCCATGGAGGCCAGCCCAAGG + Intergenic
1096127131 12:49128203-49128225 GCCTGGTGGAGACCTGGCCAAGG - Exonic
1096134083 12:49185255-49185277 GCCTGGTGGAGACCTGGCCAAGG - Exonic
1097193730 12:57232644-57232666 GGCCCGGAGAGGCCTGCCCAAGG - Intronic
1097214655 12:57401284-57401306 GGCCTCTTGAGGCCTGGGCTCGG - Intronic
1097981725 12:65742463-65742485 GGCGGGGGGAGGCCGGGCCAGGG + Intergenic
1098748551 12:74268418-74268440 AGACTGTGGGGCCCTGGCCAAGG + Intergenic
1101446817 12:104742632-104742654 GGCTTCCGGAGGCCTGGGCAGGG - Intronic
1101597139 12:106177620-106177642 GCATTGCGGAGGCCTGGCCAGGG - Intergenic
1101983562 12:109428218-109428240 GGCCTGTGGGGCACTGCCCACGG - Intronic
1102897951 12:116613537-116613559 GGGCTCTGCGGGCCTGGCCAAGG + Intergenic
1102950288 12:117026562-117026584 GGCCTGTGTGGGCTGGGCCAGGG - Intronic
1102951282 12:117033212-117033234 GGCCTGTGGCGACTTGGACAAGG + Intergenic
1103271965 12:119680767-119680789 TCCCTGTTGAGGCCTGGCTATGG + Exonic
1103369614 12:120408836-120408858 GTCCTGTGGGAGCCTGGACAGGG + Intergenic
1103556145 12:121767726-121767748 GGCTTGTGAATGCCGGGCCAGGG + Intronic
1103750440 12:123155372-123155394 GGGCTGTGGACCCCTGGCCTGGG + Exonic
1104623806 12:130337558-130337580 GGCCTGTGGGGGCCTGGGCGTGG + Intergenic
1104978093 12:132561045-132561067 GCCCTCTGGGGGCCTGGCCCAGG - Intronic
1105781128 13:23706028-23706050 GGCCAGTGGTGACATGGCCAGGG + Intergenic
1106319386 13:28624038-28624060 GGTCTGTGGAGCCCTAGCCAGGG - Intergenic
1106410511 13:29508066-29508088 AGCCTGTGGAGCCATGGCCTGGG - Intergenic
1106588918 13:31081496-31081518 GGGCCGTAGAGGCCTGGCTAAGG + Intergenic
1107046932 13:36002915-36002937 GGGCTGGGGAGGCCTTGTCAGGG + Intronic
1110515718 13:76410436-76410458 GGTTGGTGGAGGACTGGCCAAGG + Intergenic
1113792990 13:113040643-113040665 GGCAGGTGGAGGCCAGGACACGG - Intronic
1113800731 13:113085195-113085217 GTGCTGGGGAGGCCGGGCCACGG - Intronic
1115885478 14:37966955-37966977 GGCCTTGGGAGGTCTGGCCTTGG + Intronic
1119483638 14:74974873-74974895 GGCTTCGGGAGGCCTGGCCTTGG - Intergenic
1119634231 14:76261095-76261117 GGTCTGGGGAGGCCTCTCCAAGG + Intergenic
1119853252 14:77881203-77881225 GTCCTATGGAGGCCTGGCAGGGG + Intronic
1120873157 14:89355971-89355993 GGCCTGTTCTGCCCTGGCCAGGG + Intronic
1121008166 14:90503684-90503706 AGGCTGGGGAGGCCTGGGCAGGG + Intergenic
1121175968 14:91890840-91890862 GGCCTGAGGAGGGTTGGTCAGGG - Intronic
1121274690 14:92659532-92659554 GGGCTCTGGAGTCCTGGTCAGGG - Intronic
1121844832 14:97163667-97163689 GGGGTGTGGAGCCCAGGCCAGGG - Intergenic
1122125335 14:99575710-99575732 GGCCAGTGGAAGCCTGGAGAGGG - Intronic
1122502846 14:102212685-102212707 GGCCTGGGGAGGGGTGGCCGCGG + Intronic
1125833053 15:42729717-42729739 TGCCTGGGGAGGCCCAGCCAGGG - Intronic
1127096398 15:55515742-55515764 AGACTGTGGGGCCCTGGCCAAGG - Intergenic
1127560050 15:60127295-60127317 GGGCTGGGCTGGCCTGGCCAGGG - Intergenic
1128306056 15:66599814-66599836 ACCCTGTGGAGTCCTGGCTAGGG + Intronic
1128497160 15:68205211-68205233 GGTCTGTGTCGGCCTGGCCAGGG - Intronic
1129176909 15:73846923-73846945 GGCCACTGGAGGCTTTGCCAAGG + Intergenic
1129410435 15:75347867-75347889 GCCCTGTGGGTGCCAGGCCAGGG + Intronic
1129694787 15:77734572-77734594 GGCCTGTGGGGGACAGGCCAGGG - Intronic
1130540456 15:84817668-84817690 GGCCCCTGGAGGCCTGGGCTGGG + Intronic
1131835673 15:96388347-96388369 ACCCGGTGGAGACCTGGCCAAGG - Intergenic
1132351619 15:101142894-101142916 GGCAGGTGGGGGCCTGGCCTGGG - Intergenic
1132372783 15:101309701-101309723 GGCAAGTGGAGGCAGGGCCAGGG + Intronic
1132578144 16:673336-673358 AGCCGGTGGAGGCCAGGCCCTGG - Intronic
1132668925 16:1094863-1094885 TGCCCGTGGGGGCCTGGCCCGGG - Exonic
1132745704 16:1435364-1435386 GCCCTGCGGGGACCTGGCCAGGG + Intronic
1132843009 16:1987372-1987394 GGCCTGAGGCGGCCATGCCAAGG - Exonic
1132865894 16:2092571-2092593 GGTCTGAGGAGCTCTGGCCATGG - Exonic
1132883232 16:2171429-2171451 GGGCTGTGGCGCCCTGGCCTTGG + Intronic
1133116412 16:3580256-3580278 GGCCAGGGGAGGCATGGCCTGGG - Intergenic
1133629105 16:7602277-7602299 GGCCCCTTGAGTCCTGGCCACGG + Intronic
1133770267 16:8863653-8863675 GGCCAGAGTAGGCCTGGCCAAGG + Intronic
1134247791 16:12552866-12552888 GGCCTGGGGAGACATGGACATGG + Intronic
1138088362 16:54154439-54154461 GTTCTGGGGAGGCCCGGCCAGGG - Intergenic
1138248283 16:55483148-55483170 GGCTTGGGGAGGCAGGGCCATGG + Intronic
1138345877 16:56319823-56319845 GGCCTGTGGAGACAGGGCCCAGG - Intronic
1139529328 16:67535257-67535279 GGGCAGTGAGGGCCTGGCCAAGG + Intronic
1140475082 16:75235748-75235770 GGCTTGCGGCGGCCTGGCCCGGG - Exonic
1141280966 16:82629019-82629041 GGACTGTGAAGTCCTGGACAAGG - Intronic
1141422516 16:83926095-83926117 GGGCTGTGGAACCCTGGGCAAGG - Exonic
1141573449 16:84948598-84948620 GACCGGAGGAAGCCTGGCCAGGG - Intergenic
1141597777 16:85107803-85107825 GGCCTGGGGCTGCCGGGCCAGGG - Intronic
1141623734 16:85250460-85250482 GGTCGGGGGAGGCCTGGCCCTGG - Intergenic
1141912228 16:87067896-87067918 GGTGTGTGGAGCCCGGGCCAGGG + Intergenic
1142140022 16:88468703-88468725 GGACAGTGGTGCCCTGGCCATGG - Intronic
1142373153 16:89694107-89694129 GTCCTGTGGAGGCCTGGGCTGGG + Intronic
1142380597 16:89729778-89729800 GGACCGTGGCTGCCTGGCCATGG - Intronic
1142449669 16:90167596-90167618 GGCCTCTGCAGGCCTCGACAAGG + Intergenic
1142457419 17:64249-64271 GGCCTCTGCAGGCCTCGACAAGG - Intergenic
1143114924 17:4576911-4576933 GGGGTGGGGAGGCCAGGCCAAGG - Intergenic
1143359055 17:6352486-6352508 GGCAGGTGGAGGCCGGGTCAGGG + Intergenic
1143473560 17:7190853-7190875 GGCCAGAGGACACCTGGCCAAGG + Intronic
1143604872 17:7977150-7977172 GGCCTCTGGAATCCTGCCCAAGG + Intergenic
1143782052 17:9234090-9234112 GGGCTCTGGAGGGCTGGCCGTGG - Intronic
1144654885 17:17029132-17029154 GGCCTCTGGACGCCTGCCCTAGG + Intergenic
1144777183 17:17790851-17790873 GCCCTGTGGCAGTCTGGCCAGGG + Intronic
1144838672 17:18172147-18172169 GCGCTGAGGAGGCCTGGGCAGGG - Exonic
1145773195 17:27508210-27508232 GGACTTTGGAGGCGTGGACATGG + Intronic
1145816392 17:27798009-27798031 GGCCTGTGTAGCTCTGGCAAGGG + Intronic
1146398987 17:32488881-32488903 GGCCTCTGGCTGCCTGGCCCAGG + Exonic
1146475678 17:33160785-33160807 GGCCTGTGGAGTGCTGTTCATGG + Intronic
1146911891 17:36653715-36653737 GGCCTTAGGAGGCCTGGGGAGGG - Intergenic
1147177251 17:38663600-38663622 GGGCTGGGGAGGAATGGCCAGGG - Intergenic
1147582236 17:41634045-41634067 GGCCTGTGGACACCTGGCGGGGG - Intergenic
1148085295 17:44990263-44990285 GCCCAGTGGAGGTCAGGCCAAGG + Intergenic
1148845198 17:50525951-50525973 AGGCTGAGGAGGCCAGGCCAGGG + Exonic
1149076036 17:52596862-52596884 AGACTGTGGGGTCCTGGCCAAGG + Intergenic
1149321162 17:55482430-55482452 AGCCTGTGGAAGCCTGGAGAAGG - Intergenic
1149624182 17:58067932-58067954 GGCCTGTCCAGGCCTGGAGAGGG + Intergenic
1149646612 17:58245877-58245899 GGCCTGTGCAGGACTTGCAAAGG - Intronic
1150388227 17:64776636-64776658 GGCCTCTGTAGGTCTGCCCAAGG - Intergenic
1150610773 17:66731415-66731437 TGGCTGTGGAGGTCTAGCCAGGG + Intronic
1150791229 17:68201317-68201339 GGCCTCTGTAGGTCTGCCCAAGG + Intergenic
1151437264 17:74105593-74105615 ACCCTTTGGAGGACTGGCCATGG + Intergenic
1151470028 17:74312226-74312248 TGCCTGTAGGGGCCTGGACAGGG + Exonic
1151598494 17:75091919-75091941 GGACTTTGGAGGCCTGGTTATGG + Intronic
1151921075 17:77155973-77155995 TGGGTGTGGAGGCCTCGCCATGG - Intronic
1151954295 17:77373020-77373042 CGGATGTGGAGGCCGGGCCATGG - Intronic
1152070789 17:78132684-78132706 ACCCTGGGGAGGCCTGGGCAGGG - Intronic
1152399063 17:80053307-80053329 GGCCTCTTGAGGCCGGGCCTGGG + Intronic
1152460994 17:80442373-80442395 GGCCTGTGGAGCCCAGAGCAGGG + Intergenic
1152608114 17:81303113-81303135 GGCTTCTGGAGCTCTGGCCAAGG - Intergenic
1152637934 17:81437816-81437838 AGCCGGAAGAGGCCTGGCCATGG + Intronic
1152737543 17:82004799-82004821 GGCCTTTGGAAGCCGGGCCCAGG + Intronic
1152774021 17:82188620-82188642 GGGCTCTGGAGGGCAGGCCAGGG - Intronic
1156472890 18:37388510-37388532 GGCCAGTGGTGCCCTGGCCCTGG + Intronic
1156509207 18:37621368-37621390 GGCCTATGTATGCCTGGCCGAGG + Intergenic
1157535530 18:48454616-48454638 GGCCTGTGAAGGTCTGACCTTGG + Intergenic
1157570223 18:48707321-48707343 TGCTTCTGGTGGCCTGGCCAGGG - Intronic
1157594919 18:48858641-48858663 GGCCTGGGGGGCACTGGCCAGGG + Intronic
1157617722 18:48997065-48997087 GCCCTGGGGAGGGCAGGCCAGGG + Intergenic
1158292148 18:55954515-55954537 AGACTGTGGGGTCCTGGCCAAGG + Intergenic
1159608471 18:70499394-70499416 AGCCTGATGAGGCCTGCCCACGG - Intergenic
1160867728 19:1263092-1263114 GGCCTGTGGAGGGCTGTCCCGGG - Intronic
1160877204 19:1302246-1302268 GGCCTGTGCATGGCTGGCCCTGG + Intergenic
1160965839 19:1746546-1746568 GCCCTGTGGGGCCCTGGGCAGGG - Intergenic
1160979871 19:1812004-1812026 GGACTCTGGAGCCCTGTCCAGGG - Intronic
1161017472 19:1990522-1990544 GGCCTGTGGCCTCCTGGCCAAGG + Intronic
1161227198 19:3152179-3152201 GGTCTGGGGAGGCCTGGTCTGGG + Intronic
1161323757 19:3653206-3653228 GGCCTGGGCAGGCAGGGCCAGGG - Intronic
1161342834 19:3752416-3752438 GGGCTGGAGAGACCTGGCCAGGG + Intronic
1161545486 19:4877955-4877977 GCCAGGTGGAGGCCTGGCCCGGG - Intergenic
1161596564 19:5153853-5153875 GTTCTCTGGAGGCCTGGCCCTGG + Intergenic
1161707556 19:5829243-5829265 CCCCCGTGGAGGCCCGGCCAGGG - Intergenic
1161872664 19:6882355-6882377 GGCCAGAGGAGGCCTGACCCAGG - Intergenic
1162019315 19:7861497-7861519 GGCCTGGTGTGGCCTGGCCTGGG + Intronic
1162282024 19:9706498-9706520 AGACTGTGGGGCCCTGGCCAAGG + Intergenic
1162284298 19:9726772-9726794 AGTCTGTGGGGCCCTGGCCAAGG - Intergenic
1162567870 19:11454111-11454133 GTGCTGGGGAGGCCTGGGCAAGG + Exonic
1162633195 19:11945046-11945068 AGACTGTGGGGCCCTGGCCAAGG - Intronic
1163441238 19:17323664-17323686 GGCGGGTGGGGGCCCGGCCATGG + Exonic
1163503252 19:17688310-17688332 GGCCGGTGGCGGCCGGGCCCCGG - Intronic
1163710739 19:18845249-18845271 GGCCTATGGGGGCCATGCCAGGG + Intronic
1163712101 19:18852919-18852941 GGCATGTGGAGGCCAGGCCCGGG + Intronic
1163843196 19:19624104-19624126 TGCCTGGGGAGGCCTGGCAGTGG + Exonic
1163862234 19:19748484-19748506 GGCCGGGGGAGGCCCGGGCAGGG - Intergenic
1163863550 19:19754861-19754883 GGTCACTGGAGGCCTGGCCGTGG - Intergenic
1163943299 19:20514479-20514501 AGACTGTGGGGTCCTGGCCAAGG - Intergenic
1164121432 19:22268901-22268923 AGGCTGTGGGGCCCTGGCCAAGG - Intergenic
1164216830 19:23157895-23157917 AGACTGTGGGGCCCTGGCCAAGG - Intergenic
1164457083 19:28417838-28417860 GGCCTGTGGGGTGGTGGCCATGG - Intergenic
1164473399 19:28554538-28554560 GGACTGTGGAGTTCTGGGCAGGG - Intergenic
1164502427 19:28831270-28831292 GGCCCAGGGAGTCCTGGCCAGGG + Intergenic
1165152978 19:33771783-33771805 GGCCTTTGGGTGCCGGGCCAGGG + Intronic
1165734053 19:38164669-38164691 GGGCCGTGGAGCCTTGGCCAGGG - Exonic
1165741351 19:38207005-38207027 GGCCTGTGGACCCCTAGCCCAGG - Exonic
1165938222 19:39402616-39402638 GGCCTGAGCGGGCGTGGCCAAGG - Intergenic
1165950765 19:39472941-39472963 GGCCTGTGGAGGCCTGGGGAGGG + Intronic
1166062869 19:40337756-40337778 GGCCTGTGGCTGGCTGGGCAGGG - Intronic
1166673273 19:44724169-44724191 GGCCCCAGGATGCCTGGCCAGGG - Intergenic
1166861342 19:45813321-45813343 GGTCAGTGAAGGCCTGTCCAAGG - Intronic
1168153433 19:54460850-54460872 GGCCCGTGTAGGCCAGGCCCAGG - Exonic
1168198789 19:54797571-54797593 GAGCTGTGGAGGCATGGCCCCGG - Intronic
1168254769 19:55159338-55159360 GGTCTCTGAAGGCCTGGCCCCGG + Exonic
1168403827 19:56100620-56100642 GGCGGGTGTTGGCCTGGCCATGG - Intronic
1168459093 19:56538892-56538914 GCCCAGTGGATGCCGGGCCATGG + Intergenic
925448947 2:3951957-3951979 GGCCTGGGGTGGTCTGGGCATGG + Intergenic
925621957 2:5802976-5802998 GGTTTGTAGAGGCCTGGCCGGGG - Intergenic
926192424 2:10738840-10738862 CTCCTGTGGAGGGCTGGACAGGG - Intronic
926315584 2:11707420-11707442 GGCCTCAGGGGGTCTGGCCACGG - Intronic
926491322 2:13529011-13529033 AGACTGTGGGGCCCTGGCCAAGG - Intergenic
927477242 2:23423315-23423337 GGCCTGGGGAGGTCAGGCCCGGG - Intronic
928136769 2:28693682-28693704 GGCTTCTGGAGGCCTGGCAGAGG - Intergenic
928424030 2:31163373-31163395 TGCTTGTGGAGGGCTGGCCAGGG + Intergenic
929016944 2:37507077-37507099 TGACTCTGGAGGCCTAGCCATGG + Intergenic
930703513 2:54483030-54483052 ACCCTGAGGAGGCCGGGCCAGGG + Intronic
931283921 2:60817001-60817023 GGCATGTGGGGGCGGGGCCAGGG - Intergenic
933808647 2:86018230-86018252 GGCCTCTGAAGGCCTGGCCTGGG - Intergenic
935627577 2:105184112-105184134 AGGCTGTGGAGGCCGGGCCCAGG - Intergenic
935721359 2:105982152-105982174 AGACTGTGGGGCCCTGGCCAAGG - Intergenic
935970709 2:108528406-108528428 AGACTGTGGGGCCCTGGCCAAGG + Intergenic
936045663 2:109185954-109185976 GGCCAGCAGAGGCCTGGCCTTGG + Intronic
936419470 2:112349479-112349501 AGACTGTGGGGCCCTGGCCAAGG - Intergenic
937122918 2:119453085-119453107 GGACAGTGCAGGCATGGCCAAGG + Intronic
937982838 2:127625158-127625180 GGCCTGTGAGGCTCTGGCCAAGG + Intronic
937987863 2:127646609-127646631 GGCCTGTGGTGGCAGCGCCATGG - Intronic
938370281 2:130764038-130764060 GGCCCCTGGAGGCCAGGTCACGG + Exonic
940987153 2:160061817-160061839 GGACTGGGGAGGCCTGGCTTGGG + Intronic
941902366 2:170690739-170690761 TGTCTGTGGAGGCCTCACCAAGG + Intergenic
942247880 2:174024100-174024122 TGCCCCTGCAGGCCTGGCCACGG + Intergenic
945289872 2:208116466-208116488 AGACTGTGGGGCCCTGGCCAAGG + Intergenic
946924745 2:224615663-224615685 AGGCTGTGAAGGCCTGCCCAGGG - Intergenic
948661243 2:239507928-239507950 GGCCTGTGCCGGCCTGTGCAGGG + Intergenic
948826282 2:240574773-240574795 AGCCTGGGGAGGCCTTGCCCTGG - Intronic
948917028 2:241039603-241039625 GGCCTGTGCAGGAACGGCCAGGG - Intronic
949028062 2:241775489-241775511 AGCCTGTGGTGCCCTGGGCAGGG + Intergenic
949031174 2:241798202-241798224 GGCCTGAGGAGGCCTGGCCTGGG - Intronic
1168856464 20:1012764-1012786 GTCCTGTGGAGGTCTGGGGAGGG + Intergenic
1170578076 20:17679919-17679941 GGCCAGTGGAGGCCTGGAGGAGG - Intronic
1170602359 20:17850403-17850425 GGCCTCTTGAGGCCTGGACTTGG + Intergenic
1172042035 20:32052558-32052580 AGCCTGGGGAGGGCTGGCTACGG + Intronic
1172062579 20:32196625-32196647 GGCCACAGGAGGCCTGGTCATGG - Exonic
1173017000 20:39234773-39234795 GGTCATGGGAGGCCTGGCCAGGG + Intergenic
1174087021 20:48016622-48016644 GGCCTTTGGAGGACTTGCCCTGG - Intergenic
1175247075 20:57588674-57588696 GTCCTGGGGAGGCCTGGCAGGGG + Intergenic
1175378603 20:58546855-58546877 AGCCGCTGGAGGCCTGGCTAGGG + Intergenic
1175846301 20:62060734-62060756 GGCCTTTGGAGGCCTGGACCTGG - Intronic
1175912122 20:62410032-62410054 GCCCTGTGGCTGCCAGGCCAGGG + Intergenic
1176030345 20:63008499-63008521 GGCCGGAGGAGGCCTGGCACAGG + Intergenic
1176095758 20:63343672-63343694 GGGCTGGGAAGCCCTGGCCAGGG + Intronic
1176108751 20:63401611-63401633 GGCGTGAAGAGGCCTGGTCAGGG - Intergenic
1178390415 21:32193189-32193211 GGCATGAGGAGGCCAGGCCTGGG + Intergenic
1178817715 21:35946684-35946706 TGCCTGTTCAGGGCTGGCCAGGG - Intronic
1179610524 21:42547400-42547422 CTCCTGAGGAGGCCTGGCCAGGG - Intronic
1179902173 21:44399951-44399973 GGCCTAGGGAGGCCTGGGGAAGG + Intronic
1180016962 21:45093391-45093413 GGCCTGTGGAAACCTGCCAATGG - Intronic
1180790017 22:18570773-18570795 GGCCTCTGGAGGCCTGTTGATGG - Intergenic
1180921795 22:19525002-19525024 GGCGTGTGGAGGTCAGGCCCAGG + Intronic
1180965485 22:19786072-19786094 GTCCTGTGGAGGGCAGGCCCAGG - Exonic
1180970342 22:19811813-19811835 GGCCTGGGGAGGGCTGACCCAGG - Intronic
1181053913 22:20250604-20250626 GCTCTGTGGAGACCTGGGCAAGG + Intronic
1181246929 22:21510326-21510348 GGCCTCTGGAGGCCTGTTGATGG - Intergenic
1181277354 22:21695219-21695241 TGCCTCTGAAGGCCTGGCCGGGG + Intronic
1181286053 22:21753463-21753485 CGGCAGTGGAGGCCTGGCCAGGG + Intergenic
1181329873 22:22081627-22081649 AGGCTGTGGAGTCCTGGACATGG + Intergenic
1182032958 22:27174642-27174664 GGCCTGAGGGGGCAAGGCCAGGG + Intergenic
1182549096 22:31091427-31091449 GGCCTGTGGAGGCCTGGCCACGG - Exonic
1182657153 22:31899876-31899898 GGGCTGTGGAGGGCTGGGGAAGG - Intronic
1183516523 22:38270052-38270074 GACCTTTGGAGGCCCCGCCAAGG - Intronic
1183613259 22:38925605-38925627 GGCATGAGTAGGCCTGGGCACGG - Intergenic
1183623693 22:38989227-38989249 GGCCTGTTTAGGCCTTGTCAGGG - Intronic
1184103164 22:42352213-42352235 GGGCTGTGGAGACCTGACCTCGG - Intergenic
1184234346 22:43175036-43175058 GTCTTGTGGTGACCTGGCCAGGG - Intronic
1184839915 22:47046521-47046543 GCCCTGTGAAGGTGTGGCCACGG + Intronic
1185021669 22:48380200-48380222 GGCCTGTCAAGGCCTTCCCAGGG - Intergenic
1185047303 22:48534845-48534867 CGACTGTGGAGGCTTGGCCGTGG + Intronic
1185058588 22:48593742-48593764 GGCCTGGGGAGGCCGTGCTAAGG - Intronic
1185128747 22:49025770-49025792 GGCCACTGGAGGCAGGGCCATGG + Intergenic
1185377753 22:50489905-50489927 TGCCTGGAGAGGCCTGGCCCTGG + Exonic
951248428 3:20367025-20367047 AGACTGTGGGGCCCTGGCCAAGG - Intergenic
952288883 3:31995946-31995968 GCCCTGTGGAGGGCTGGAAATGG + Intronic
952752998 3:36840607-36840629 GGCCCCTTGAGGCCTGGCCTTGG - Intronic
953465076 3:43112722-43112744 GGCGTGTGGAGGCCAGTTCATGG - Intergenic
954327218 3:49870065-49870087 GGCCTGCTTAGCCCTGGCCAAGG + Exonic
954422292 3:50425074-50425096 GCCCTGTGGAAGCATGGCCCTGG - Intronic
955074501 3:55600977-55600999 GGCCTGTGGCGAGCTTGCCATGG - Intronic
955715891 3:61829383-61829405 GGCCTGTTTGGCCCTGGCCACGG - Intronic
955754441 3:62213711-62213733 GGTCTCTGGAGGCCTAGGCATGG + Intronic
955910364 3:63853308-63853330 GGCCTGTGAATGCCTGGACAGGG - Intronic
956734836 3:72230436-72230458 GTCCTGTGGAGCACTGGACAAGG + Intergenic
957073021 3:75580461-75580483 GGCCGGAGCGGGCCTGGCCACGG - Intergenic
961260736 3:125599608-125599630 TGCTTGTGGAGTCATGGCCATGG + Intergenic
961391119 3:126552895-126552917 GCCCTGTGGAGACTTGGCCCAGG + Intronic
961454200 3:127016194-127016216 TGGGTGTGGAGCCCTGGCCAGGG + Intronic
963305654 3:143649745-143649767 GGGCTCTGGGGGCTTGGCCAAGG + Intronic
964932890 3:162047581-162047603 AGACTGTGGGGCCCTGGCCAAGG - Intergenic
965849690 3:173009408-173009430 GGCCTTTGTAGTCCTGGCCATGG + Intronic
967068693 3:185943144-185943166 GGCCAGTGGCAGCCAGGCCAGGG + Intergenic
968045553 3:195622327-195622349 GGGGTGTTGAGGCCTGGCCTGGG + Intergenic
968045577 3:195622396-195622418 GGGGTGTTGAGGCCTGGCCTGGG + Intergenic
968045600 3:195622465-195622487 GGGGTGTTGAGGCCTGGCCTGGG + Intergenic
968064337 3:195750314-195750336 GGAGTGTTGAGGCCTGGCCTCGG + Intronic
968064351 3:195750348-195750370 GGGGTGTTGAGGCCTGGCCTGGG + Intronic
968105880 3:196000680-196000702 TGCATGTGGAGACCTGGGCAGGG - Intergenic
968319197 3:197750307-197750329 GGGCTGTGGAGGCGGGGGCAGGG + Intronic
968607018 4:1540332-1540354 GGCCTGGGGAAGCCAGGCCCCGG + Intergenic
968610338 4:1554136-1554158 GGCCTGTGGGGTCTGGGCCAGGG - Intergenic
968626793 4:1629449-1629471 GTGCCCTGGAGGCCTGGCCAGGG + Intronic
968646036 4:1741082-1741104 GGCAAGGGGAGGCTTGGCCAAGG - Intronic
968658381 4:1788403-1788425 GGGCAGTGGAGGGCTGGCCAGGG - Intergenic
968941042 4:3637893-3637915 GTCCTTTGCTGGCCTGGCCACGG - Intergenic
968964819 4:3764535-3764557 GGGGTGTGGAGGCCGAGCCAGGG - Intergenic
969016625 4:4107758-4107780 GGCCAGAGCGGGCCTGGCCACGG - Intergenic
969135309 4:5024627-5024649 GGGCTGAGGAGGCTTGGACAGGG - Intergenic
969439341 4:7208159-7208181 GGGGTGAGGAGGCCAGGCCAGGG - Intronic
969463261 4:7340044-7340066 GGCCTGTGGGGCACTGGCCCAGG + Intronic
969476047 4:7422936-7422958 GGCCTTTAGAGATCTGGCCATGG - Intronic
969516847 4:7652708-7652730 GCCCTGAGGAGGCCAGGCCTGGG - Intronic
969796536 4:9532145-9532167 GGCCGGAGCGGGCCTGGCCACGG + Intergenic
969957890 4:10910669-10910691 GGAATTTGGAGGCCTGGCCCTGG - Intergenic
970365426 4:15353535-15353557 AGCCTGTGGAGACATGGGCAAGG + Intronic
972217176 4:36910316-36910338 AGACTGTGGGGCCCTGGCCAAGG + Intergenic
975134054 4:70857118-70857140 GCCCTATGGAGGGCTGGGCATGG + Intergenic
975205778 4:71642920-71642942 AGACTGTGGGGCCCTGGCCAAGG + Intergenic
976367241 4:84245296-84245318 GGCCACGGGAGGCCTGGTCATGG + Intergenic
977043436 4:92041455-92041477 AGACTGTGGGGCCCTGGCCAAGG - Intergenic
977972509 4:103228392-103228414 AGACTGTGGGGCCCTGGCCAAGG + Intergenic
978733494 4:112058647-112058669 GCCCTGTGGCAGCCTGGACATGG + Intergenic
979259376 4:118633774-118633796 GGCCTCTGCAGGCCTCGACAAGG + Intergenic
979328975 4:119406789-119406811 GGCCTCTGCAGGCCTCGACAAGG - Intergenic
980780056 4:137482407-137482429 AGACTGTGGGGCCCTGGCCAAGG + Intergenic
983312872 4:166087753-166087775 AGCGTCTGGAAGCCTGGCCAGGG + Intronic
983898095 4:173103189-173103211 AGACTGTGGGGCCCTGGCCAAGG + Intergenic
984908137 4:184648997-184649019 GGCAGCGGGAGGCCTGGCCAGGG - Intronic
985167512 4:187112863-187112885 GGTCTGTGGATGCCTTGGCAGGG - Intergenic
985621314 5:957622-957644 GGCCTGGTGCAGCCTGGCCAAGG + Intergenic
986211964 5:5682455-5682477 GGGCTGAGGAGGCCTGGACAGGG + Intergenic
986255012 5:6095087-6095109 GGGCTGTGGTGGTCTTGCCAAGG - Intergenic
986786885 5:11122957-11122979 GGCCTCTGGACGCTTGACCAAGG + Intronic
986821325 5:11469923-11469945 GGCCAGAGGAGGCATGGTCAAGG - Intronic
987930414 5:24393876-24393898 AGACTGTGGGGCCCTGGCCAAGG - Intergenic
992153954 5:73935958-73935980 GGCTTCTGGGTGCCTGGCCATGG + Intronic
995850247 5:116537432-116537454 GGTCTGTGGAGACCAGGTCAGGG + Intronic
995898844 5:117046222-117046244 GGCCTGTGGAGACAGGGGCAGGG - Intergenic
997261217 5:132466731-132466753 GTCCTGGGCAGGCCTGGACAGGG - Intronic
998005014 5:138651083-138651105 GGTCTCTGGAGCCCTGGCCTGGG - Intronic
998137154 5:139680051-139680073 GGGCTGTGGAGGCCTGGACTAGG + Intronic
998457428 5:142284135-142284157 GCCTTGTGAAGGCCAGGCCAAGG - Intergenic
999140545 5:149358375-149358397 GGCCTGGGCAGGACTGGCCGCGG + Intronic
999243711 5:150142038-150142060 GGGAGGAGGAGGCCTGGCCATGG + Intronic
1000236953 5:159370816-159370838 AGACTGTGGGGCCCTGGCCAAGG + Intergenic
1001133381 5:169082128-169082150 GGCCTGTGGAGTCCCTGCTAAGG - Intronic
1001209091 5:169793709-169793731 GGCCTGATGAGACCTGGCCCTGG + Intronic
1001586067 5:172834539-172834561 GGCCTGCGGAGGCATGCACAGGG - Intronic
1002025832 5:176395701-176395723 GGCCTGTGGTGGTCTGGGCAGGG + Intronic
1002339268 5:178504362-178504384 GGACTCAGGAGGCCTGGCCTGGG + Intronic
1002534171 5:179867201-179867223 TGGCTGTGGAGGCCTTGCCCTGG + Intronic
1002605584 5:180381075-180381097 GGAATGCGGAGGCCTGGCCCAGG - Intergenic
1002729596 5:181325518-181325540 GGCCTCTGCAGGCCTCGACAAGG + Intergenic
1003890299 6:10558008-10558030 AGCCTGTGGAGGCCTGGAGTAGG - Intronic
1004194191 6:13488628-13488650 GCACTGAGGAGGACTGGCCAAGG + Intergenic
1004493956 6:16145616-16145638 GGCCTCCTGAGGCCTGGCCCAGG + Intronic
1006436020 6:34026600-34026622 GGGGTGTGGAGGCCTGGGGAGGG - Intronic
1006797609 6:36741573-36741595 GGCCTGTGGAGGCCTCTCCCTGG - Exonic
1007386356 6:41522886-41522908 GCCCTGTAGACGCCTTGCCAAGG + Intergenic
1008123603 6:47645111-47645133 AGACTGTGGGGCCCTGGCCAAGG + Intergenic
1008381609 6:50844080-50844102 GGCCTGTGGAGACCAGGCGGAGG + Exonic
1010005004 6:70986171-70986193 GGGCTCTGGAGGCCAGGGCAAGG - Intergenic
1010818620 6:80388316-80388338 GACCTATGGAGGCCTGCCAAAGG - Intergenic
1011014825 6:82743411-82743433 AGATTGTGAAGGCCTGGCCAGGG + Intergenic
1011585813 6:88924027-88924049 GCCCTGAGGAGGGGTGGCCAAGG + Intronic
1012974733 6:105768239-105768261 GGTCTGAGAAGGACTGGCCAGGG - Intergenic
1017028537 6:150201447-150201469 GCCCTGTGGAGGCCTGGCTGGGG + Intronic
1018243336 6:161799779-161799801 GGCCTGGGAAGGCCTGGGGATGG + Intronic
1018555283 6:165043075-165043097 GGCACCTGGAGGCCTGGCCTGGG + Intergenic
1018850798 6:167588961-167588983 GGCCTGTGGAGGCTTCCTCAGGG + Intergenic
1018903040 6:168060646-168060668 GGCCACTGGAGGGCAGGCCAGGG + Intronic
1019426347 7:978947-978969 GTCATGTGGAAGCCTGGCCACGG + Intergenic
1019722278 7:2580179-2580201 TGCCTGAGGAGGCCTGGCCAAGG + Intronic
1019816160 7:3202346-3202368 GGACTCTGGAGGCCTGGTCCTGG + Intergenic
1020114832 7:5470573-5470595 GCCCTGTGGAAGGCTGGCCGTGG - Intronic
1022531627 7:31070365-31070387 GGCCTGTGGTGGCCATGGCAGGG + Intronic
1022955330 7:35375123-35375145 GGCCTCTGGAGGCCTCACCGTGG - Intergenic
1023311586 7:38892956-38892978 GGAGTGTAGAGGCCTGGGCAAGG - Intronic
1023400819 7:39792304-39792326 GGCCTCTGCAGGCCTCGACAAGG + Intergenic
1023848252 7:44135468-44135490 GGGCCCTGCAGGCCTGGCCAGGG + Intergenic
1024061533 7:45702419-45702441 GGCTTGTGGTGGCCAGGCCATGG + Intronic
1026875536 7:73877131-73877153 GGCCTGTGGGGGCTGGCCCAGGG + Intergenic
1026909379 7:74083664-74083686 GGCCTCTAGAGGCGTGGCCTTGG + Intronic
1027419392 7:78004926-78004948 GGCTTGAGGAGGCCTGGCCCTGG - Intergenic
1029075100 7:97928558-97928580 GGCCAGAGCGGGCCTGGCCACGG - Intergenic
1029120078 7:98261903-98261925 GGACAGTGGAGCCCTGGCCCTGG + Intronic
1029381729 7:100219693-100219715 GGCCTGGGGAGGCCAGGGGAGGG - Exonic
1029401896 7:100352143-100352165 GGCCTGGGGAGGCCAGGGGAGGG - Intronic
1029558644 7:101287692-101287714 GGGCTGTCCAGGCCTGGCAAAGG - Intergenic
1029957618 7:104656327-104656349 GGCCTGAGGAGGCCTGGTGTAGG + Intronic
1030861726 7:114639903-114639925 AGCCTTTGGAGGCCTTGCCTGGG + Intronic
1031393577 7:121245981-121246003 TGCCTGTGGAGGGCTGGGCATGG - Intronic
1031832201 7:126641713-126641735 GGCCTGTGGATTAGTGGCCATGG - Intronic
1032051317 7:128652639-128652661 GGCCTCTGCAGGCCTCGACAAGG + Intergenic
1032253569 7:130278911-130278933 GTCCATTGTAGGCCTGGCCAGGG - Intronic
1033681694 7:143601437-143601459 GCCCTGGGGAGAGCTGGCCACGG + Intergenic
1033703197 7:143860376-143860398 GCCCTGGGGAGAGCTGGCCACGG - Exonic
1034352938 7:150429058-150429080 GGGCTTTGGAGTCCTGGCCTGGG + Intergenic
1035065608 7:156102934-156102956 GGTCTGGGGAGGCCAGGTCATGG + Intergenic
1035169332 7:157009154-157009176 GGCCCGGGGAGGCAAGGCCAAGG - Intronic
1035237244 7:157506471-157506493 TGCCTGTGGCGACCTGGCCTGGG + Intergenic
1035297539 7:157875832-157875854 GCCCTGGGGACGCCTGGCCTGGG - Intronic
1035297585 7:157875952-157875974 GCCCTGGGGATGCCTGGCCTGGG - Intronic
1035428050 7:158795177-158795199 GGCATGTGGAGTCCTGTGCAGGG - Intronic
1035447794 7:158954903-158954925 GGCCTGTGGGGGACGGGGCATGG - Intronic
1035714484 8:1743548-1743570 GGCTTGTGCAGTCCTGGCCTGGG + Intergenic
1036135380 8:6155516-6155538 TGCGTGTGGAGGCCTGGTGATGG + Intergenic
1036242431 8:7091820-7091842 GGCCAGAGCGGGCCTGGCCACGG + Intergenic
1036899386 8:12659610-12659632 GGCCAGAGCGGGCCTGGCCACGG - Intergenic
1036900453 8:12665757-12665779 GGCCAGAGCGGGCCTGGCCACGG - Intergenic
1037744163 8:21629981-21630003 GCCCTGTGGGGGCCTTGCCAGGG - Intergenic
1038442856 8:27583958-27583980 GGCCTGTGGAAGCTCTGCCATGG + Intergenic
1038477301 8:27877192-27877214 GGGCTGTAGGGGCCTGGGCAGGG - Intronic
1040819152 8:51536032-51536054 AGCATGTGGACCCCTGGCCATGG + Intronic
1041095005 8:54341404-54341426 GGCCTGGTGATGCCTGTCCAAGG - Intergenic
1041227264 8:55712987-55713009 AGACTGTGGGGCCCTGGCCAAGG + Intronic
1042735639 8:71984873-71984895 GGAATCAGGAGGCCTGGCCAGGG - Intronic
1043271831 8:78343649-78343671 GGCCTGTGAAAGACTGGACAAGG + Intergenic
1044340425 8:91040767-91040789 GGCCTGGGGAGGCCGAGCCGGGG + Exonic
1045343734 8:101275985-101276007 GGCCAGTGGCGGCCTGGCCTAGG + Intergenic
1046718443 8:117592466-117592488 GGCCTGTTGAGGCCTAGGCTTGG - Intergenic
1047439914 8:124868410-124868432 GGCTGCTGGAGGCCTGTCCAAGG + Intergenic
1049181633 8:141225965-141225987 GGCGTGGGGAGGCCTGACCTAGG - Intronic
1049232304 8:141490743-141490765 GGACAGTGGGGGCTTGGCCAGGG - Intergenic
1049250632 8:141587008-141587030 GGGATGTGGAGGACTGACCATGG + Intergenic
1049370124 8:142260427-142260449 GGACAGAGGACGCCTGGCCAGGG - Intronic
1049374419 8:142282175-142282197 GGAACGTGCAGGCCTGGCCAGGG - Intronic
1049465611 8:142750007-142750029 GGGATGTGGGGGCCTGACCAGGG - Intergenic
1049478226 8:142806747-142806769 TGGCTGTGGAGGCCTGGGCGGGG + Intergenic
1049529734 8:143148293-143148315 GGCCTGGGGAGGGCGGGCCTGGG - Intergenic
1049599907 8:143502909-143502931 GCCCGGGGGAGGGCTGGCCAAGG + Intronic
1049696238 8:143985569-143985591 GGCCTGGGGAACCCGGGCCAGGG + Exonic
1049762323 8:144337028-144337050 GGGCTCTGGAGGCCGGGCCCAGG - Intergenic
1050624572 9:7489115-7489137 TGGCTTTGGATGCCTGGCCAGGG + Intergenic
1052888811 9:33676933-33676955 GGCCTCCGGAGCCCGGGCCACGG + Intergenic
1052994708 9:34545691-34545713 GGCCTGAGGGTGCCTGGCTAGGG + Intergenic
1053480828 9:38415066-38415088 GCAGTGTAGAGGCCTGGCCAGGG + Intronic
1054448765 9:65391106-65391128 GGTGTGTGAAGGCCTGGCCCAGG - Intergenic
1056576599 9:87859671-87859693 GCCCAGTGGACACCTGGCCACGG - Intergenic
1056708536 9:88971611-88971633 GGCCTGGGGAGGCCTGGCCTGGG - Intergenic
1057336207 9:94157080-94157102 GGCCTCGGGCAGCCTGGCCACGG - Intergenic
1057584627 9:96318137-96318159 GGCTTCTGGAGGGCTGGGCATGG - Intergenic
1057819223 9:98318490-98318512 GTCCTGTGCAGGGCTGGCCAGGG + Intronic
1057863069 9:98657474-98657496 CCCCTGTGGAACCCTGGCCAGGG + Intronic
1059249977 9:112879707-112879729 GTCTTCTGGGGGCCTGGCCATGG + Exonic
1060113892 9:120926133-120926155 GCCTTGTGGAGTCCTGGCCTGGG + Exonic
1060139970 9:121201507-121201529 GGCCTGACGGGGCCTGGCCCCGG + Intronic
1060197406 9:121632566-121632588 GGCCAGAGGAGGCCTTGCTAAGG - Intronic
1060278855 9:122202423-122202445 GGATTGTGGAGGCCTGACGATGG - Intergenic
1060309413 9:122445905-122445927 GCCCTAAGGAGGCCTGGCAAAGG - Intergenic
1060414647 9:123421778-123421800 GGCTCGTGGTGGCCTGGCCAAGG - Intronic
1060520265 9:124290349-124290371 GGCCTGTGGATGGCTGGCCTGGG + Intronic
1060597636 9:124857740-124857762 GGCCTGGAGAGTCCTGGCCATGG - Exonic
1061031706 9:128088459-128088481 AGGCTGGGGAGGCCAGGCCAGGG - Intronic
1061231761 9:129319672-129319694 GGCCCGTGGAGGCCGGGGCCGGG + Intergenic
1061577708 9:131517847-131517869 GGCATGAGGAGGCCTGGCCGCGG - Intronic
1062033485 9:134372428-134372450 GGCTGGAGGAGGCCTGGCCCTGG + Intronic
1062138416 9:134942122-134942144 GACCTGTGTTGCCCTGGCCAGGG - Intergenic
1062245041 9:135561837-135561859 GGTCTGTGGTGTCCCGGCCATGG + Exonic
1062264975 9:135682899-135682921 GGGCTGTGGACGCCTGGGCAGGG - Intergenic
1062463595 9:136671831-136671853 GGCTTGTGGAGCCCTTCCCAGGG + Intronic
1062488493 9:136792692-136792714 GGGCAGTGGAGGCCAGGCCTGGG - Intronic
1062628976 9:137455177-137455199 GGTCTGTGCTGGCCTGGCCTGGG - Intronic
1203577566 Un_KI270745v1:20787-20809 GGCCTCTGCAGGCCTCGACAAGG + Intergenic
1185909870 X:3971540-3971562 AGACTGTGGGGCCCTGGCCAAGG + Intergenic
1187874816 X:23795496-23795518 GGCCTTTGGAGGCCTGAAAAAGG + Intergenic
1190055002 X:47176154-47176176 AGCCTGTGTAGTCCTGGCCCTGG + Intronic
1190220424 X:48509145-48509167 CGCCTGGGGAGGCCGGCCCAGGG - Intronic
1190425932 X:50334593-50334615 AGACTGTGGGGCCCTGGCCAAGG - Intronic
1191639357 X:63413654-63413676 AGACTGTGGGGCCCTGGCCAAGG + Intergenic
1191917841 X:66221600-66221622 AGACTGTGGGGCCCTGGCCAAGG - Intronic
1192727611 X:73768966-73768988 GCCCTGTGGGAGCCAGGCCATGG - Intergenic
1192875193 X:75222605-75222627 GGCCTGTGGGGTGGTGGCCATGG - Intergenic
1192915337 X:75645727-75645749 AGACTGTGGGGCCCTGGCCAAGG - Intergenic
1196422882 X:115540777-115540799 AGACTGTGGGGCCCTGGCCAAGG - Intergenic
1196459951 X:115919482-115919504 AGACTGTGGGGCCCTGGCCAAGG - Intergenic
1198238536 X:134760833-134760855 GGCCTCTGGAGGCCTAGACTTGG - Intronic
1200072931 X:153537912-153537934 TGCCTGTGGAGGCAGGGGCACGG + Intronic
1200886860 Y:8279884-8279906 GGGCTGTGGAAGCCCGCCCAGGG + Intergenic
1200943304 Y:8807086-8807108 AGACTGTGGGGCCCTGGCCAAGG + Intergenic
1200973135 Y:9177802-9177824 CACCTGTGGAAGCCTGGCAAGGG + Intergenic
1202137943 Y:21686711-21686733 CACCTGTGGAAGCCTGGCAAGGG - Intergenic