ID: 1182553926

View in Genome Browser
Species Human (GRCh38)
Location 22:31118594-31118616
Sequence GTCACACACTGAGCCCTAAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182553926_1182553931 15 Left 1182553926 22:31118594-31118616 CCGTTTAGGGCTCAGTGTGTGAC No data
Right 1182553931 22:31118632-31118654 CAGGGTCAGAATTCAGTCTGTGG No data
1182553926_1182553927 -4 Left 1182553926 22:31118594-31118616 CCGTTTAGGGCTCAGTGTGTGAC No data
Right 1182553927 22:31118613-31118635 TGACCAGAATTGCATGATCCAGG 0: 1
1: 0
2: 0
3: 23
4: 484
1182553926_1182553928 -3 Left 1182553926 22:31118594-31118616 CCGTTTAGGGCTCAGTGTGTGAC No data
Right 1182553928 22:31118614-31118636 GACCAGAATTGCATGATCCAGGG 0: 1
1: 0
2: 0
3: 27
4: 529

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182553926 Original CRISPR GTCACACACTGAGCCCTAAA CGG (reversed) Intronic
No off target data available for this crispr