ID: 1182553929

View in Genome Browser
Species Human (GRCh38)
Location 22:31118616-31118638
Sequence GACCCTGGATCATGCAATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182553929_1182553932 16 Left 1182553929 22:31118616-31118638 CCAGAATTGCATGATCCAGGGTC No data
Right 1182553932 22:31118655-31118677 TCAGAGTTCAGTCAATGATTAGG 0: 1
1: 0
2: 1
3: 26
4: 158
1182553929_1182553933 22 Left 1182553929 22:31118616-31118638 CCAGAATTGCATGATCCAGGGTC No data
Right 1182553933 22:31118661-31118683 TTCAGTCAATGATTAGGCTCAGG No data
1182553929_1182553931 -7 Left 1182553929 22:31118616-31118638 CCAGAATTGCATGATCCAGGGTC No data
Right 1182553931 22:31118632-31118654 CAGGGTCAGAATTCAGTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182553929 Original CRISPR GACCCTGGATCATGCAATTC TGG (reversed) Intronic
No off target data available for this crispr