ID: 1182553931

View in Genome Browser
Species Human (GRCh38)
Location 22:31118632-31118654
Sequence CAGGGTCAGAATTCAGTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182553929_1182553931 -7 Left 1182553929 22:31118616-31118638 CCAGAATTGCATGATCCAGGGTC No data
Right 1182553931 22:31118632-31118654 CAGGGTCAGAATTCAGTCTGTGG No data
1182553926_1182553931 15 Left 1182553926 22:31118594-31118616 CCGTTTAGGGCTCAGTGTGTGAC No data
Right 1182553931 22:31118632-31118654 CAGGGTCAGAATTCAGTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182553931 Original CRISPR CAGGGTCAGAATTCAGTCTG TGG Intronic
No off target data available for this crispr