ID: 1182554091

View in Genome Browser
Species Human (GRCh38)
Location 22:31119658-31119680
Sequence CAGGGTGACCAGGGAGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 632
Summary {0: 1, 1: 0, 2: 9, 3: 61, 4: 561}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182554085_1182554091 -4 Left 1182554085 22:31119639-31119661 CCTCATGGCGGGCCTGGGTCAGG No data
Right 1182554091 22:31119658-31119680 CAGGGTGACCAGGGAGAGAAAGG 0: 1
1: 0
2: 9
3: 61
4: 561
1182554083_1182554091 0 Left 1182554083 22:31119635-31119657 CCTCCCTCATGGCGGGCCTGGGT 0: 1
1: 0
2: 0
3: 10
4: 158
Right 1182554091 22:31119658-31119680 CAGGGTGACCAGGGAGAGAAAGG 0: 1
1: 0
2: 9
3: 61
4: 561
1182554077_1182554091 11 Left 1182554077 22:31119624-31119646 CCATAGCATGACCTCCCTCATGG 0: 1
1: 0
2: 2
3: 4
4: 113
Right 1182554091 22:31119658-31119680 CAGGGTGACCAGGGAGAGAAAGG 0: 1
1: 0
2: 9
3: 61
4: 561
1182554076_1182554091 27 Left 1182554076 22:31119608-31119630 CCTTTGCAGATGGTAGCCATAGC 0: 1
1: 0
2: 0
3: 5
4: 76
Right 1182554091 22:31119658-31119680 CAGGGTGACCAGGGAGAGAAAGG 0: 1
1: 0
2: 9
3: 61
4: 561
1182554084_1182554091 -3 Left 1182554084 22:31119638-31119660 CCCTCATGGCGGGCCTGGGTCAG 0: 1
1: 0
2: 0
3: 6
4: 168
Right 1182554091 22:31119658-31119680 CAGGGTGACCAGGGAGAGAAAGG 0: 1
1: 0
2: 9
3: 61
4: 561

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182554091 Original CRISPR CAGGGTGACCAGGGAGAGAA AGG Intronic
900554860 1:3275390-3275412 CAGAGGGGCCAGGGAGAGACAGG - Intronic
901258992 1:7857275-7857297 AAGGGTGAGTAGGGAGAGGAAGG - Intergenic
901269782 1:7942699-7942721 GAGAGTGGCCAGGGAGAGAGAGG - Intronic
901643355 1:10704308-10704330 AAGGGGCACCAGGGAGAGAAAGG + Intronic
902082506 1:13830742-13830764 CAAGATGACCAAGAAGAGAAGGG - Intergenic
902540209 1:17149210-17149232 TAGCGTGAGCAGGGTGAGAAAGG + Intergenic
902983576 1:20142148-20142170 CAGGGTGGACATGGAGAGAGTGG + Intronic
903024165 1:20415422-20415444 CAGAGTGACCAAGGAGAGATGGG + Intergenic
903071860 1:20730648-20730670 CCGGGGGACCAGGGAGGGCATGG + Intronic
903264254 1:22147502-22147524 CACCCTGACCAGGGAGGGAACGG + Intergenic
903295967 1:22343188-22343210 CAGGGTGGACAGGGAGACGATGG + Intergenic
903358296 1:22761683-22761705 AAGGGTTGCCAGGGAGAGAGAGG - Intronic
903651928 1:24927778-24927800 GAGGGTGACCAGGGAAAGGAGGG + Intronic
903824282 1:26131695-26131717 CAGGGAGAAAAAGGAGAGAAAGG + Intergenic
904841319 1:33373659-33373681 GAGGGTGACCAGTGGGAGAAGGG - Intronic
905732126 1:40304510-40304532 CAGGGTGACCAAGGCGAGAGGGG - Exonic
905907848 1:41631488-41631510 CAGGGTGCCCAAGAGGAGAAAGG - Intronic
906541811 1:46592627-46592649 CAGGGAGAGCAGGGAGAGCAAGG + Intronic
906678983 1:47712194-47712216 CAGCCTGGCCAGGGAGTGAAAGG + Intergenic
907043687 1:51285998-51286020 CAGGGTGAGCGGGTAGAGACAGG - Intergenic
907254188 1:53165864-53165886 CAGGGAATCCAGGGAGATAAGGG - Intergenic
907620626 1:55974566-55974588 CAGGGTGAACTGTGAGATAAGGG + Intergenic
907730171 1:57058237-57058259 CAGGTGGAACAGGGAAAGAATGG + Intronic
908124148 1:61013537-61013559 CTGGGTGACCATGGAATGAAAGG - Intronic
908478040 1:64508096-64508118 CAGGAGGACAAGAGAGAGAAGGG + Intronic
909342858 1:74551078-74551100 CAGAGTGAGAAGGGAGAGGAGGG - Intergenic
910186279 1:84544237-84544259 CAGGTTGACAAGGAAGTGAAGGG - Intergenic
910870339 1:91827545-91827567 AAGGATGAGCAGGGAGAGACAGG + Intronic
911239880 1:95453581-95453603 TAGGGTGGCCAGGAAGACAAAGG + Intergenic
911710538 1:101066652-101066674 CAGGATGAGAAGGGAGAGAGTGG + Intergenic
912009795 1:104945809-104945831 CTGGCTGACCATGGAGATAATGG + Intergenic
912170980 1:107098776-107098798 CAGGGTCACCAGGCAGTGCAGGG - Intergenic
912688049 1:111782402-111782424 AAGGGGGACCTGGGAGAGAAAGG + Intronic
913141380 1:115944653-115944675 CAGGAAGAGGAGGGAGAGAAGGG + Intergenic
913146528 1:115995626-115995648 CAGACAGACAAGGGAGAGAAAGG - Intronic
914247653 1:145897766-145897788 CAGGGTGACCTGAGACAGACTGG - Intronic
914392022 1:147232517-147232539 CAGGGAGACCATGGAAAGAGAGG - Intronic
914753367 1:150550075-150550097 CAGGGAGACCTGGGGGTGAAGGG + Intronic
915287140 1:154860327-154860349 CACGATGACCAGGCAGAAAAAGG - Intronic
915588282 1:156856854-156856876 AAGAGAGTCCAGGGAGAGAAAGG - Intronic
915625322 1:157110889-157110911 GAGGGAGGCCAGGGAGGGAATGG + Intergenic
915860392 1:159437920-159437942 TAGGGTGACCAAGGTGAGCAAGG - Intergenic
916561130 1:165934887-165934909 AAGGGGCAACAGGGAGAGAAAGG + Intergenic
916606021 1:166343156-166343178 CAGGGGGAGCAGGGGGAGCAGGG + Intergenic
916791472 1:168129131-168129153 CAGGGTAAGCAGAGAGGGAATGG + Intronic
917514512 1:175696380-175696402 CAGGGTGGGCAGAGAGAAAATGG + Intronic
919944106 1:202307380-202307402 CAGCTTGACCAGGGAGTGCAGGG - Exonic
919977156 1:202620157-202620179 CCAGTGGACCAGGGAGAGAAGGG - Intronic
919983277 1:202655895-202655917 CAAGGTGACCATGGAGCGAGTGG + Intronic
920101411 1:203519308-203519330 GGGGGTGAGCGGGGAGAGAAGGG - Intergenic
921804439 1:219437696-219437718 CTTTGGGACCAGGGAGAGAAGGG - Intergenic
922065266 1:222131547-222131569 CAAAGTGCCCTGGGAGAGAAGGG + Intergenic
922742308 1:228020838-228020860 GAGGGTGACTAGGGAGAGGGAGG + Intronic
923547986 1:234938641-234938663 CAGGGTGAGAGGGAAGAGAACGG + Intergenic
924253985 1:242163807-242163829 CAGGATGAGCAGGGAGAGACGGG + Intronic
924309263 1:242722862-242722884 CATGGTCACCAAGGAAAGAATGG - Intergenic
1063056356 10:2509147-2509169 CAGAGTCTCCAGGGAAAGAAAGG + Intergenic
1063556161 10:7081574-7081596 CAGGGAAACTGGGGAGAGAAAGG - Intergenic
1063968246 10:11363381-11363403 GAGCGTGACCAGGGAGAGCGCGG + Intergenic
1065991080 10:31011151-31011173 CAGGCTGAGCAGAGAGAGCATGG + Intronic
1066277297 10:33881523-33881545 CAGGGTGGCAGGAGAGAGAATGG + Intergenic
1066353231 10:34657304-34657326 CAGGGTGAAATGGGAGAGAAAGG + Intronic
1066453294 10:35550514-35550536 CAGGGAGGCCAGGGAGAGAAGGG - Intronic
1066459875 10:35603733-35603755 AAAGGTGACCAGGATGAGAAGGG + Intergenic
1066745301 10:38601387-38601409 CTGGGTGTCCACGGAGGGAAGGG - Intergenic
1067717274 10:48699193-48699215 CAGGGTGACCATGGAGAAGAGGG + Intronic
1069526807 10:69179900-69179922 GTGGGTGAGCAGTGAGAGAATGG - Intergenic
1069530542 10:69215556-69215578 GAGGGTGACTCGGGTGAGAAAGG - Intergenic
1070506659 10:77119079-77119101 CCAGGGGACGAGGGAGAGAATGG - Intronic
1071241382 10:83709301-83709323 CAGGGTGACCCGGGAAACCATGG - Intergenic
1071602051 10:86963099-86963121 AAGGGTGGCCAGGGAGACGAGGG - Exonic
1071808545 10:89152195-89152217 GAGAGTGACCTGGGAAAGAATGG - Intergenic
1071986516 10:91056674-91056696 AAGTGTGACCAGGGTGATAATGG - Intergenic
1072067338 10:91883931-91883953 CACGGGGACCAGGCAGGGAACGG - Intergenic
1072202473 10:93173175-93173197 CAATGTGACCAGGGATAGCAGGG + Intergenic
1072455870 10:95575307-95575329 CAGAGAGACCAGGGAGATATGGG + Intergenic
1073512247 10:104050106-104050128 TTAGGTGACCAGGGTGAGAAAGG - Exonic
1074077659 10:110143340-110143362 CAGTGTGCCCAGGTGGAGAAGGG - Intergenic
1074445113 10:113515139-113515161 CAGGGAGGGAAGGGAGAGAAAGG - Intergenic
1074964916 10:118482109-118482131 CAGTGTGACCTGGGAGGAAATGG - Intergenic
1074979369 10:118607588-118607610 GAGGGTGGACAGGGAGAGGAGGG - Intergenic
1074987261 10:118669338-118669360 CAGCGTGGCCTGGGAGAAAAAGG + Intergenic
1074994899 10:118748254-118748276 CAAGGTTACCAGGTACAGAATGG - Intronic
1075093912 10:119458758-119458780 CAGGGTGTGGAGGAAGAGAAGGG - Intronic
1075812634 10:125236392-125236414 CTGGGTGGTCAGGGAGGGAAAGG + Intergenic
1075903532 10:126062318-126062340 CCTGGTTACCAGGGAGAGAGTGG + Intronic
1076726702 10:132417199-132417221 CAGTGTGTCCAGGGAGGGGATGG + Exonic
1076871283 10:133196253-133196275 CAGGGAGACCAGGCAGGGAGGGG - Intronic
1076980177 11:199930-199952 CAGGGTCACCTGGGAGAGGAGGG - Exonic
1077036581 11:498389-498411 CAGGGTGACCGAGGAGACCAGGG - Intronic
1077332159 11:1988505-1988527 GAGGGTGAGGAGGGAGAGGAGGG + Intergenic
1077501475 11:2911484-2911506 CAGGGTGGCCAGGGTGAGGAAGG + Intronic
1080395164 11:31883205-31883227 CATGGTGACAAATGAGAGAAGGG + Intronic
1080403722 11:31959830-31959852 CAGGGTGAGGAAGGAGAGAAAGG + Intronic
1080922327 11:36721463-36721485 CAGTGAGAGCAGTGAGAGAAGGG - Intergenic
1081578886 11:44338248-44338270 CACGGTGACCACGGAGCGACGGG - Intergenic
1081702224 11:45159133-45159155 CAGGGTGCTCAGGGAGGGCAGGG - Intronic
1082064618 11:47889766-47889788 CAGGGGGAAAAGGGAGTGAAGGG + Intergenic
1082167629 11:48966175-48966197 CAGAGAGACCAGGGAGAGTCTGG + Intergenic
1082239380 11:49855031-49855053 CAGAGAGACCAGGGAGAGTCTGG - Intergenic
1082242767 11:49889321-49889343 CAGAGAGACCAGGGAGAGTCTGG + Intergenic
1082657260 11:55870130-55870152 CAGAGAGACCAGGGAGAGTCTGG + Intergenic
1083421066 11:62553554-62553576 CAGGCTGAGCAGGGAAGGAAGGG + Intronic
1083655059 11:64225602-64225624 CAGGGTCACCATGGAGACTAGGG - Intronic
1083801038 11:65046426-65046448 CCGGGTGAGGAGGGAGACAAGGG - Exonic
1084093338 11:66893864-66893886 CTTGGTGACCAGGGAGAGGGTGG - Intronic
1084645872 11:70457197-70457219 CGGGGCGGCCAGGCAGAGAAAGG + Intergenic
1085289599 11:75388442-75388464 CAAGCTGACCAGGGAGGGACAGG - Intergenic
1086575895 11:88338534-88338556 CAGGGTGAGAAGGGTGAGGAAGG + Intergenic
1087397370 11:97617180-97617202 CAGGGTGCCAAGTGAGAAAATGG - Intergenic
1087878291 11:103385311-103385333 CATGATGAACAGAGAGAGAAAGG - Intronic
1088267480 11:108001584-108001606 CAGGGAACCCAGGGAGAGAATGG - Intergenic
1088585389 11:111356345-111356367 CAGGTGGACCTGGGAGGGAAGGG + Intronic
1089212388 11:116814285-116814307 AGTGGTGACCAGGGAGATAATGG + Intergenic
1089778441 11:120855998-120856020 CAGGGGGACCAGGAAAAGGAAGG + Intronic
1090154608 11:124424467-124424489 CATGGTGACCATGTAGAGCAGGG + Exonic
1090359719 11:126163869-126163891 CCGGGAGACCAGGCAGAGAATGG + Intergenic
1090965276 11:131592748-131592770 CAAGGAGACCAGGTAGAGAGAGG - Intronic
1091082369 11:132682656-132682678 GAGAGCAACCAGGGAGAGAATGG + Intronic
1091303303 11:134521621-134521643 AGGGGTGGCCAGGGAGAGGAGGG - Intergenic
1091340189 11:134806155-134806177 CTGGGTCAGCATGGAGAGAAGGG - Intergenic
1202815140 11_KI270721v1_random:43681-43703 GAGGGTGAGGAGGGAGAGGAGGG + Intergenic
1091875166 12:3927785-3927807 CAGGTAGACAAGGGAGAAAATGG - Intergenic
1092184279 12:6467249-6467271 CTGGGTTAACAGGGAGAGGATGG + Intronic
1092971248 12:13697403-13697425 TAGGGTGACAAGGGAGAAATGGG - Intronic
1093896491 12:24580682-24580704 CAATGTCACAAGGGAGAGAAAGG + Intergenic
1094019127 12:25895634-25895656 CAGAATGAACAGAGAGAGAAGGG + Intergenic
1094460139 12:30687576-30687598 CAGAGTAATAAGGGAGAGAAGGG - Intronic
1095982408 12:47980949-47980971 CAGGGTGAACGTGGAGAGACTGG - Exonic
1095982708 12:47982141-47982163 CAGGGTGACGTTGGTGAGAAAGG - Exonic
1096070721 12:48774121-48774143 CAGGGTAACCAAGGAGGGAAAGG + Intronic
1096244201 12:49975259-49975281 CAGGGAGGGCAGGGAGAGCAAGG + Intronic
1096567143 12:52491444-52491466 TTGGGTGACCAGGGCCAGAAGGG - Intronic
1096748646 12:53744893-53744915 CAGGGGAAGCAGAGAGAGAATGG - Intergenic
1097188450 12:57208301-57208323 CAGGCTGGCCTGGGAGGGAAGGG - Intronic
1098111476 12:67126526-67126548 CTGGGTGCCTAGGGAGAGGAAGG - Intergenic
1099293481 12:80801823-80801845 AAGGGTGATCGGGGAAAGAAAGG - Intronic
1100619104 12:96254859-96254881 CAGGGTAGACAGGGAGAGGAAGG + Intronic
1103204304 12:119116385-119116407 CAGTCTTACCAGGGAGACAAAGG + Intronic
1103696223 12:122817917-122817939 CAGGGTGCCAAGGTGGAGAAGGG - Intronic
1104042298 12:125138637-125138659 CAGGACAACCAGGGAAAGAAAGG - Intronic
1104089913 12:125507666-125507688 CAGAATGAGCAGGGAGAGAGTGG + Intronic
1104217732 12:126750715-126750737 CAGGGTGGCGGGGGAGAGAGAGG - Intergenic
1104615324 12:130263344-130263366 CAGCGTGACCAGGAAGAACAGGG + Intergenic
1104718983 12:131034174-131034196 CAGGGTGGGCAGGGGAAGAAGGG - Intronic
1104989208 12:132615657-132615679 CCGTGTGTCCCGGGAGAGAATGG - Intergenic
1106782572 13:33074375-33074397 CAGGGTCACCTGGGAGAGGCTGG - Intergenic
1107849933 13:44561063-44561085 TCGGGGGACCAGGGAGAGGAGGG + Intronic
1108837293 13:54567493-54567515 CAGGGTGAGAATGGAGAGTATGG + Intergenic
1109576730 13:64269100-64269122 CAGGGTGGCAGGAGAGAGAATGG - Intergenic
1110749387 13:79095060-79095082 AAGGGGGACAAGGCAGAGAAGGG - Intergenic
1110828389 13:80000233-80000255 CAAGGGGCCAAGGGAGAGAAAGG - Intergenic
1112138509 13:96611793-96611815 CAGAGTGAGCATGGACAGAAGGG + Intronic
1112659205 13:101488043-101488065 CATGATGAGAAGGGAGAGAAGGG + Intronic
1113261841 13:108573547-108573569 CAGAGAGACCAGGGATAGACTGG + Intergenic
1113268598 13:108647152-108647174 CTGGGTGACAAGGGAGAAAGTGG - Intronic
1113421820 13:110176884-110176906 AAAGGAGACCAAGGAGAGAAAGG - Exonic
1114552407 14:23540472-23540494 GGAGGTGACCATGGAGAGAAGGG + Intronic
1114707309 14:24740261-24740283 CATGATGACAAAGGAGAGAAAGG - Intergenic
1115352004 14:32405759-32405781 CAGGGTGGCAGGAGAGAGAATGG - Intronic
1116791892 14:49348124-49348146 GAGGGTGACCTTGGAGAGGAAGG - Intergenic
1117211343 14:53503653-53503675 CAGGTAGACCAGGTAGACAAGGG + Intergenic
1118812402 14:69284896-69284918 CAGGGTGGCAGGAGAGAGAAGGG - Intronic
1119229650 14:72970154-72970176 CTGGGGGACCAGGGACAGCACGG + Exonic
1119566458 14:75633244-75633266 CAGGGTCATCAGGAAGAGGAGGG + Intronic
1119583154 14:75805983-75806005 TAGGGTGAACAGGAAGAGACTGG - Intronic
1120138873 14:80904343-80904365 GGGGGTGAAGAGGGAGAGAAAGG + Intronic
1120389957 14:83893838-83893860 CAGGGTGACCTTGAAGAGAATGG - Intergenic
1120716487 14:87846407-87846429 CAGTGTGACAAGAGACAGAAAGG + Intronic
1120758415 14:88265333-88265355 CAGGAGGGCCAGAGAGAGAAGGG + Intronic
1120871071 14:89338017-89338039 CAGGCTGCCCAGGGATAGAAAGG - Intronic
1121214595 14:92237636-92237658 TAAGGTGACCACTGAGAGAATGG - Intergenic
1121406749 14:93723712-93723734 TAAGGTGACCACTGAGAGAAGGG - Intronic
1121522350 14:94594726-94594748 CAGGGGGGTGAGGGAGAGAAAGG - Intronic
1121621927 14:95356259-95356281 CCTGGTGACTGGGGAGAGAATGG - Intergenic
1122112481 14:99511974-99511996 CAGGGTCAGCAGGCAGAGACAGG - Exonic
1122353139 14:101109033-101109055 CTGGCTGACCAGGGTGAGGATGG - Intergenic
1124492819 15:30168541-30168563 CCAGTGGACCAGGGAGAGAAGGG - Intergenic
1124750715 15:32369784-32369806 CCAGTGGACCAGGGAGAGAAGGG + Intergenic
1125125254 15:36212190-36212212 CAGGATGACCATGGACAAAATGG + Intergenic
1126309801 15:47302617-47302639 GAGAGTCACCAGTGAGAGAAGGG + Intronic
1126881694 15:53105823-53105845 CAGTGTGACCAGGGACACCATGG + Intergenic
1127202008 15:56664443-56664465 CATGGTGAACTGGGGGAGAAAGG + Intronic
1127230264 15:56984295-56984317 AAGGGTGGAGAGGGAGAGAAAGG + Intronic
1127602482 15:60552126-60552148 GAGAGTTATCAGGGAGAGAAGGG + Intronic
1127658184 15:61075335-61075357 CAAGGTGACCTTGGAGAGCAGGG - Intronic
1127982307 15:64044373-64044395 CAGGATCACCAGGGTGAGAAGGG + Intronic
1128072573 15:64806928-64806950 CAAGGAGACCTGGCAGAGAAGGG + Intergenic
1128528671 15:68429962-68429984 CAGAGGCACCAGGGAGTGAATGG - Intronic
1128753845 15:70167697-70167719 CATGGCAGCCAGGGAGAGAAGGG + Intergenic
1128757552 15:70193825-70193847 GAGGGGGAGCAGGGGGAGAAGGG + Intergenic
1128791238 15:70435425-70435447 CAGGGTGACGAGGGTGGGAAAGG + Intergenic
1129164313 15:73767680-73767702 CAGGGAGCCGGGGGAGAGAAGGG - Intergenic
1129249511 15:74301172-74301194 CAGGGTGCCCAGAGAGTGGAGGG - Intronic
1129362151 15:75030604-75030626 CAGGGCCATCAGGGAGTGAAGGG - Intronic
1129753260 15:78080607-78080629 CTGGGTGACCAGGGAAGGATTGG - Intronic
1131464728 15:92645992-92646014 GGGGGTGACCAGGCAGGGAAAGG - Intronic
1131778100 15:95823883-95823905 CAGGTAGACCAGGCAGATAAGGG - Intergenic
1131819478 15:96257679-96257701 CAGGGGGAACAGGCAGAAAAGGG + Intergenic
1132605721 16:792952-792974 CAGGGAGACCTGGTGGAGAAGGG - Exonic
1132849707 16:2019556-2019578 GAGGCTGAGCAGGCAGAGAATGG + Exonic
1134136761 16:11681663-11681685 CAGGGTGATGAGGGGGAGATGGG - Intronic
1134684595 16:16149898-16149920 CAGGGTGGACAGGGCGAGATGGG + Exonic
1135538214 16:23310984-23311006 GAGGGAGTCCAGGGAGTGAATGG + Intronic
1136550590 16:30980459-30980481 CAGGGTGTTAAGGAAGAGAACGG - Intronic
1136737767 16:32478262-32478284 CTGGGTGTCCACGGAGGGAAGGG + Intergenic
1137433055 16:48433912-48433934 CCGGGTGTAGAGGGAGAGAAGGG - Intronic
1137701667 16:50502213-50502235 CAGGCTGACCTGGAGGAGAAGGG + Intergenic
1138493332 16:57391082-57391104 CAGGCTGACTTGGGACAGAAAGG + Intergenic
1139432075 16:66916195-66916217 CAGGGTGACCTGGCAGGGAAGGG + Exonic
1140109209 16:71988546-71988568 CGTGGTGACCATGGTGAGAAGGG + Intronic
1141080544 16:81047898-81047920 CAGGACGGCCAGAGAGAGAAGGG + Intergenic
1141462079 16:84183602-84183624 CAGGCTTAGCAGGGAGAGGAAGG + Intronic
1141551976 16:84812378-84812400 CAGGGGGTGCTGGGAGAGAAAGG + Intergenic
1141875514 16:86821451-86821473 CAAGCTGACCAGGAGGAGAATGG + Intergenic
1141883730 16:86877717-86877739 CAGAGAGACCAGAGAGAGAGAGG - Intergenic
1142294237 16:89209869-89209891 CAGGGAGACCTGGGGGAGACCGG + Intergenic
1203015306 16_KI270728v1_random:351315-351337 CTGGGTGTCCACGGAGGGAAGGG - Intergenic
1203033641 16_KI270728v1_random:624473-624495 CTGGGTGTCCACGGAGGGAAGGG - Intergenic
1143245872 17:5485736-5485758 CATGGTGACTAGTGAGAGGAAGG - Intronic
1143416863 17:6756718-6756740 CAGGAAGAGCAGGGGGAGAAGGG + Intronic
1143482870 17:7237748-7237770 CAGAGGGACCTGGGAGAGCAGGG - Intronic
1143520494 17:7441602-7441624 CAGGGTGGGAAGGGGGAGAATGG + Intronic
1144613534 17:16746867-16746889 GAGGGAGAGAAGGGAGAGAAGGG - Intronic
1146372768 17:32275658-32275680 CAGGCTGATTAGGGAGAGACAGG - Intronic
1146633986 17:34490778-34490800 CAGGTTAACATGGGAGAGAAAGG - Intergenic
1146986614 17:37226075-37226097 CAGGGCTACTAGGGAGGGAAGGG + Intronic
1147215738 17:38897974-38897996 CAGGATGGGCAGGGAGTGAAGGG + Intronic
1148341770 17:46877524-46877546 GAGGTTGAACAGGGAGACAACGG + Intronic
1148352385 17:46950358-46950380 GAGGGTGAGGATGGAGAGAAGGG + Intronic
1148794008 17:50188618-50188640 CAGGGTGACCGTGGTGAGACCGG - Exonic
1148857674 17:50587636-50587658 CAGGGAGACTAGAGAGAGCAAGG + Intronic
1149398704 17:56271632-56271654 GAGGGTGACCAGGAAGGGCAGGG + Intronic
1149594591 17:57856990-57857012 CACTGTGACCAGGGAAAAAAGGG + Intergenic
1150819258 17:68421905-68421927 CAGAGTGAGCAGGGAGAGGCTGG + Exonic
1151501808 17:74494823-74494845 GAGGATGCCCAGGGAGAGAATGG - Intergenic
1151582749 17:74989302-74989324 CAGGGGGACCAGGGTGGGACTGG + Intronic
1151727746 17:75894439-75894461 CAGGGGTGCCAGGAAGAGAACGG - Intronic
1151802857 17:76387871-76387893 CCTGGTGACTGGGGAGAGAATGG + Intergenic
1151837569 17:76593289-76593311 CAGGGTGCCCAGGAAGGGCATGG + Intergenic
1151943520 17:77306975-77306997 CAGGGTTACCTGGGGGAGTAGGG + Intronic
1152071787 17:78137784-78137806 CAGGGTGACCAGGAAGGCGAAGG - Exonic
1152087080 17:78226880-78226902 CAGCGGGACCAGGAAGGGAAGGG + Intergenic
1152572006 17:81125040-81125062 CAGGGTGAGCAGGGTGAGCAGGG + Intronic
1152722587 17:81930158-81930180 CCTGGAGACCAGGGAGAGCAGGG - Intergenic
1152747756 17:82049108-82049130 CAAGGTAACCTGGGAGGGAAGGG + Exonic
1154056321 18:11016024-11016046 CAGGGTGAAAAGGGAGAACAAGG - Intronic
1155399210 18:25419774-25419796 TATGGTGACCAGGGAGGGAAGGG - Intergenic
1156343512 18:36234842-36234864 CATGGTGGCAAGAGAGAGAAGGG + Intronic
1157080722 18:44522302-44522324 CAGGGTGACCTGGCAGGAAAGGG + Intergenic
1157503953 18:48212895-48212917 CAGGCTGGCCAGGCAGAGGAGGG - Intronic
1157524630 18:48371569-48371591 CAGGATAACCAGGAAGAGAGTGG + Intronic
1157542542 18:48521935-48521957 CAGTTTCCCCAGGGAGAGAATGG + Intergenic
1157899724 18:51503051-51503073 CAAAGTGACCAGGGAAAGTATGG + Intergenic
1158107663 18:53904236-53904258 GAGACTGAACAGGGAGAGAAAGG - Intergenic
1158345935 18:56517286-56517308 AAGGGTGACCATGGAGAGAATGG - Intergenic
1158433523 18:57415610-57415632 CAGTGTGAGCAGGGACAGAATGG - Intergenic
1159456782 18:68669366-68669388 CAGGGGGACCAGCGAGTGCAAGG + Intergenic
1160123170 18:76148116-76148138 CAGGGTGGCCCAGGAGAGCAGGG + Intergenic
1160147234 18:76375563-76375585 CCCGGAGACCAGGGAGAGGATGG + Intronic
1160875659 19:1295266-1295288 CAGGGTGAGCGGGGAGGGACGGG - Intronic
1160978939 19:1807590-1807612 CAGGGTGACCTGGGGAAGCAGGG - Intronic
1160988426 19:1850872-1850894 CAGGGTGAGGAGGGGGAGAGAGG + Intergenic
1161014434 19:1976667-1976689 CAGGGTGGCCGTGGAGACAATGG - Intronic
1161257301 19:3316494-3316516 CAGAGTGAGGAGGGGGAGAAAGG + Intergenic
1161257916 19:3320147-3320169 CAGAGTGAGGAGGGAGAGAGAGG + Intergenic
1161554613 19:4933615-4933637 CTGGGTGACCAGGCAGAGGAGGG - Intronic
1161572061 19:5036169-5036191 CAGGCAGACCAGGGTGAGAGGGG - Intronic
1161794857 19:6380781-6380803 CAAGGGGATCAGGGAGAGACAGG + Intronic
1161982211 19:7635949-7635971 CAGCATGTCCAGGTAGAGAAGGG - Intronic
1162459444 19:10805820-10805842 CTTGGTCCCCAGGGAGAGAACGG + Intronic
1162538347 19:11277465-11277487 GAGGGAGACCATGGAGAGAGAGG + Intergenic
1163233301 19:16017826-16017848 CTAGGGGACCAGGCAGAGAAAGG - Intergenic
1163444734 19:17339639-17339661 CAGGGAGAAAAGGCAGAGAAAGG - Intronic
1163645245 19:18485529-18485551 CAGGGAGACCAGGGAGACCAGGG + Intronic
1163827870 19:19533621-19533643 AGGGGTGAGGAGGGAGAGAATGG - Intronic
1164447629 19:28331420-28331442 CAGAGTGGCCAGGAAAAGAAGGG + Intergenic
1165072344 19:33262687-33262709 CAGGGTGACGAGGAAGAGAGAGG - Intergenic
1165406048 19:35631916-35631938 GACAGTGAGCAGGGAGAGAAGGG - Intronic
1166003020 19:39889532-39889554 CAGTGTGACCAGGGTGATCACGG - Exonic
1166005807 19:39905784-39905806 CAGTGTGACCAGGGTGATCACGG - Exonic
1166122493 19:40693934-40693956 CAGGGGGAGCAGAGAGGGAATGG - Intronic
1166128903 19:40733627-40733649 CAGGATGCCCAGGGAGACAGAGG - Intronic
1166253549 19:41586900-41586922 CTGTGTGACCCAGGAGAGAATGG - Intronic
1166257824 19:41618937-41618959 CTGTGTGACCCGGGAGAGAATGG + Intronic
1166299755 19:41907006-41907028 CAGGGAGAGCAGAGAGAGAAGGG - Intronic
1166349031 19:42185609-42185631 CAGGGGGACAAGAGTGAGAAGGG - Intronic
1166410482 19:42553086-42553108 CTGTGTGAGCTGGGAGAGAATGG + Intronic
1166556810 19:43705542-43705564 TAGGGAGACCAGAAAGAGAAAGG - Intergenic
1166700078 19:44877362-44877384 CAGTGTGAGCAGGGAGGGATGGG - Intronic
1166712167 19:44944671-44944693 CAGGATGAGCATGGAGGGAAAGG + Intronic
1166762154 19:45231799-45231821 CAGGGTGCCAGGGGAGAGAAGGG + Exonic
1167385542 19:49160910-49160932 GAGGGTGATGAGGGAGAGAGGGG + Intronic
1167419282 19:49393884-49393906 CAGGGTGGGCAGTGAGGGAATGG - Intronic
1167477229 19:49708069-49708091 CAGGGTCACCTGGCAAAGAAAGG + Intronic
1167576975 19:50322499-50322521 CATGGAGACCAGAGAGAGATGGG - Intronic
1168287171 19:55340654-55340676 CTGGGTGTCCAGTGAGTGAAGGG - Intronic
926892559 2:17650549-17650571 CACTCTGACCAAGGAGAGAAAGG + Intronic
928076361 2:28268370-28268392 CAGGGAGACAATGGAGAGAGAGG + Intronic
929087711 2:38184605-38184627 CAGTGTGCCCAGAGAGAGAGTGG + Intergenic
930486746 2:52019746-52019768 GAGGGCCAGCAGGGAGAGAAAGG + Intergenic
930618683 2:53622128-53622150 CATGGTGGCCAGGTACAGAAGGG + Intronic
930817954 2:55618024-55618046 CGGAGTAACCAGGGACAGAAAGG + Intronic
930997087 2:57733016-57733038 GAGGGTGACGAGGGAGAGCTGGG + Intergenic
931058867 2:58503919-58503941 CAGGGTGAGCAGGGTGAGCAGGG + Intergenic
931150140 2:59563991-59564013 CAGGGTGAGCAGGTAGTGATAGG + Intergenic
931253010 2:60550354-60550376 CGGGGTGATGGGGGAGAGAAAGG + Intronic
931285303 2:60827249-60827271 GGAGGTGACCAGGCAGAGAAAGG - Intergenic
931629370 2:64285273-64285295 CAGGGAGACCTGGGAGCCAAGGG + Intergenic
932993753 2:76821869-76821891 CAGGAGGAACAGGGAGAGAGAGG - Intronic
933508244 2:83205332-83205354 CAGGGTGACAGCAGAGAGAATGG + Intergenic
933613385 2:84459617-84459639 CAGTGAGACCGGGGAGACAAGGG + Intronic
934056121 2:88252995-88253017 GAGGGAGACGAGGGAGGGAAGGG - Intergenic
934307702 2:91840578-91840600 CTGGGTGTCCACGGAGGGAAGGG - Intergenic
934702169 2:96451325-96451347 GAGGGTGAGGAGGGAGTGAAAGG - Intergenic
934775529 2:96934822-96934844 CAGGGTGAGTGGGGAGAAAAAGG - Intronic
934860481 2:97760377-97760399 CAGGGGGTCCAGATAGAGAAAGG - Intronic
935410803 2:102759886-102759908 CGGAGTGGCCAGAGAGAGAAAGG - Intronic
935553385 2:104481446-104481468 CAGAGGGACCAGGGAGACAGAGG + Intergenic
937062639 2:118991854-118991876 AAGGGAGACCAGGGAGTGAAAGG + Exonic
937249402 2:120514065-120514087 CAGGGTGGCCAGGCAGGAAAAGG - Intergenic
937286534 2:120757692-120757714 GAGGGAGACCAGGGTAAGAAGGG - Intronic
937808641 2:126174910-126174932 CATGTTGAACAGAGAGAGAAGGG - Intergenic
937827799 2:126387163-126387185 CATGGTGGCAAGAGAGAGAAAGG - Intergenic
938310537 2:130285942-130285964 CTGGAGGAGCAGGGAGAGAATGG + Intergenic
938444389 2:131366425-131366447 CTGGGGGAGCAGGGAGAGAATGG - Intergenic
938462842 2:131509156-131509178 CAGGCTGCCCAGAGAGAGAGTGG - Intergenic
938836064 2:135105250-135105272 GAGGGAGACCATGGAGAGAGGGG - Intronic
939857759 2:147381073-147381095 CAGTGTGAAGAAGGAGAGAAAGG + Intergenic
941683405 2:168423194-168423216 CAAGGTGACTACGGACAGAAAGG + Intergenic
941683884 2:168428119-168428141 CAGGGAGACCTGGGGGAGAGGGG + Intergenic
942321340 2:174739170-174739192 CTGGCTGGCCAGGGAGAGGATGG - Intergenic
942989786 2:182186225-182186247 CAGTGTGGGGAGGGAGAGAAAGG - Intronic
943575891 2:189630776-189630798 GAGGGTGAGTGGGGAGAGAATGG - Intergenic
943612037 2:190045271-190045293 CAAGCTGACCAGGGATAGAAGGG - Intronic
944427216 2:199595618-199595640 CAGGCTGTCCAGGAAGAGAGAGG + Intergenic
945261499 2:207848028-207848050 CAGGCTGATTAGGGAGAAAAGGG + Intronic
945303415 2:208235485-208235507 CAGTGGCACCAGGAAGAGAACGG - Intergenic
945712524 2:213316578-213316600 CTAAGTGACCAAGGAGAGAATGG - Intronic
946015856 2:216603257-216603279 CTGGGCTTCCAGGGAGAGAAAGG + Intergenic
946178273 2:217935170-217935192 CAGGGTGAGGAGGGGGAGGAAGG + Intronic
947168884 2:227290815-227290837 CATGGTCTCCAGGGAGATAAGGG + Exonic
948364346 2:237444899-237444921 CTGGGGCACCTGGGAGAGAAGGG + Intergenic
948726338 2:239936305-239936327 CAGTGTCCCCAGGCAGAGAATGG + Intronic
1169737111 20:8849024-8849046 CAGTTTGTCCTGGGAGAGAATGG + Intronic
1169829973 20:9814126-9814148 CAGGATGGCCAGGCAGAGAATGG + Intronic
1170061695 20:12265817-12265839 CAGGGTGCCCAGTGAGGGCAGGG + Intergenic
1170544917 20:17427711-17427733 CCAGCTGACCAGGGAGACAAGGG - Intronic
1170592053 20:17778595-17778617 GAGGGAGACCATGGAGAGAGAGG - Intergenic
1170647828 20:18212573-18212595 CAGGTGGAACAGAGAGAGAAAGG + Intergenic
1170680242 20:18519856-18519878 CATGGTCAGCAGGGAGAGCACGG + Intronic
1170859680 20:20091070-20091092 CGGGGTGGCCAGGGAGACAATGG - Intronic
1170932816 20:20784091-20784113 CAAGGGGACCCTGGAGAGAAGGG + Intergenic
1172391177 20:34566477-34566499 AGGGGTGACCAGGGACAGACAGG + Intronic
1172624379 20:36338848-36338870 CCAGGTGAAGAGGGAGAGAAGGG + Intronic
1172835437 20:37870216-37870238 CAGTGAGACCAGGAAGAGAAAGG - Intronic
1172872593 20:38144940-38144962 CAGGGTGACCAGGATGACCAGGG + Intronic
1173225562 20:41160495-41160517 CAGAGGGGCCAAGGAGAGAAGGG + Intronic
1173646489 20:44636300-44636322 CAGGGGGAAGAGAGAGAGAAAGG + Intronic
1174254786 20:49246460-49246482 CAGGGTGCCCAAGGAGGGCAGGG + Exonic
1174325971 20:49779185-49779207 CAGGGGGACTTGGGAGAAAATGG + Intergenic
1174368123 20:50068591-50068613 CAGGGTGACCCTGGAGAGCTGGG + Intergenic
1175001326 20:55633240-55633262 CAGGGTGACCAGCTACAGAGAGG - Intergenic
1175171155 20:57082401-57082423 TGGGGTGACCTGGGAGAAAAGGG - Intergenic
1175341579 20:58234111-58234133 CGTGGTCATCAGGGAGAGAAAGG + Intergenic
1175431577 20:58908411-58908433 CAGGATGGCTAGGGCGAGAAGGG + Intronic
1175745558 20:61454421-61454443 CAGGGGGAACAGGGAGGGAGGGG + Intronic
1175807505 20:61838011-61838033 AACGGTGAGCAGGCAGAGAAAGG - Intronic
1175999950 20:62827238-62827260 CAGGGTGACCGAGGCGAGAGGGG + Exonic
1176002421 20:62838689-62838711 CAGGGTGACAGAGGAGACAAAGG + Exonic
1176069186 20:63217195-63217217 CAGGGTGAACAGTGACAGCAGGG + Intergenic
1176173263 20:63706001-63706023 TCAGGTGACCAGTGAGAGAAGGG - Intronic
1176177620 20:63736165-63736187 CAGGGTCTCTGGGGAGAGAAGGG + Intronic
1176672203 21:9745158-9745180 GAGGGAGAGTAGGGAGAGAAAGG + Intergenic
1176723564 21:10412585-10412607 GAGGGTGGCCAGTGGGAGAAGGG - Intergenic
1178086499 21:29117773-29117795 CAGTGTGATCAGGGACTGAATGG + Intronic
1178492712 21:33063408-33063430 CAGCGAGCCCAGGGACAGAAGGG + Intergenic
1178601564 21:33999194-33999216 CAGGGTGACAAGGGACAGTGGGG - Intergenic
1179716874 21:43292996-43293018 GAGGGAGAACAGGGAGGGAATGG - Intergenic
1180159497 21:45992745-45992767 CAGGGTGGCCCTGGAGAGAGAGG + Exonic
1180304723 22:11065357-11065379 GAGGGTGGCCAGTGGGAGAAGGG - Intergenic
1180534784 22:16387660-16387682 CTGGGTGTCCATGGAGGGAAGGG - Intergenic
1180696501 22:17754410-17754432 CAGGGTGCCCAGGGAGGGCAGGG + Intronic
1181671418 22:24427250-24427272 CAGGGTGACCAAGCAGAGCCTGG - Intronic
1181711871 22:24696206-24696228 GAGGGGGAGGAGGGAGAGAAGGG - Intergenic
1181759995 22:25051696-25051718 CAGGGTGACCCAGCAGAGGAGGG + Intronic
1182016818 22:27047345-27047367 CAGGGTGAGAAGGAAAAGAAGGG - Intergenic
1182554091 22:31119658-31119680 CAGGGTGACCAGGGAGAGAAAGG + Intronic
1182718601 22:32379028-32379050 ATGGCTGACCAGGGAGAGAGGGG + Intronic
1183100436 22:35580472-35580494 CAGGGTGAGCGGGGACAGGAAGG + Intergenic
1183324168 22:37182627-37182649 AAGGGTGACAAGGGGGAGATGGG - Exonic
1183327262 22:37200996-37201018 CTGGGAGACCCAGGAGAGAAGGG + Intergenic
1183465999 22:37980716-37980738 CTGGGAGACCAGGGAGAAAGAGG - Intronic
1184489734 22:44801656-44801678 CAGGGTGGCCTGGGGGACAATGG - Intronic
1185130005 22:49033492-49033514 TAGGGAAACCAGGGAGAGAGGGG - Intergenic
950428047 3:12935210-12935232 CAGGCTGAGCAGGGGCAGAATGG - Intronic
951143204 3:19193374-19193396 CAGGGAGAAAAGGGAGAGAATGG - Intronic
951202424 3:19890242-19890264 AAGGGTGCAGAGGGAGAGAATGG - Intronic
951508655 3:23477927-23477949 CAGAGTGACAGGAGAGAGAAGGG - Intronic
951909404 3:27733340-27733362 CAGGGTGAGAAGTGAGAGAAAGG + Intergenic
954114702 3:48459973-48459995 CAGGCTGGCCAGGGCCAGAAAGG - Intronic
954132355 3:48567135-48567157 AAGGGTGACCAGGGCGAGAAAGG - Exonic
954132551 3:48567872-48567894 CAGGGTGAACGGGGAGTGAAGGG - Exonic
954134332 3:48575223-48575245 CAGGGAGAACGGGGAGAGAAAGG - Exonic
954134653 3:48576416-48576438 CAGGGTGACCGTGGGGAGACTGG - Exonic
954135677 3:48581138-48581160 CAGGGTGAAGTTGGAGAGAAAGG - Exonic
956398812 3:68854278-68854300 CAAGGTGAACAAGAAGAGAATGG + Intronic
956674542 3:71722007-71722029 GAGAGTGACAAGGGAGAAAAGGG + Intronic
957242877 3:77681783-77681805 CAGGATGAACAGGGATAGATTGG - Intergenic
958086522 3:88815691-88815713 CAGGGAGTTCATGGAGAGAATGG + Intergenic
958702835 3:97615657-97615679 CAAATTGACCAGGGATAGAAGGG + Intronic
960388471 3:117050022-117050044 GAGGGAGACGAGGGAGAGGAGGG - Intronic
960476310 3:118133237-118133259 AGGGGTGAGCAGGAAGAGAAGGG + Intergenic
960588518 3:119343732-119343754 CAGGGAGAAAAGGGAGAGCAAGG - Intronic
961387264 3:126529777-126529799 TAGGGAGACAGGGGAGAGAAGGG - Intronic
961441204 3:126954342-126954364 CAGGCTGACCATGGGGAGAGGGG + Intronic
961531896 3:127545030-127545052 CTGGGTGAGCAGGAAGAGGAAGG + Intergenic
961704823 3:128776028-128776050 TAGGGTGACTGGGGAGACAATGG - Intronic
961732485 3:128976518-128976540 TATGGGGACAAGGGAGAGAATGG - Intronic
961902884 3:130231470-130231492 CAGGGTTACCAAGGAGAGCTTGG + Intergenic
962061298 3:131930361-131930383 CAGGGTGACCTTGCAGAGAAAGG + Intronic
962644262 3:137420386-137420408 CAGTGTGTCCAGGAGGAGAAGGG - Intergenic
963251340 3:143105870-143105892 CAGTTTGCACAGGGAGAGAAAGG - Intergenic
963619447 3:147587227-147587249 CTGGGTAACCAGGGACAGAGTGG + Intergenic
963805895 3:149722619-149722641 GAAGGTGAACAGAGAGAGAAAGG - Intronic
964195198 3:154056241-154056263 CAGGGTGAGCAAGAATAGAATGG + Intergenic
966760824 3:183417856-183417878 CAGGGTGGCAAGGGAGAGAGAGG + Intronic
966851737 3:184169013-184169035 CAGGGTGAGTAGGGTGGGAAGGG - Intronic
967972858 3:195012150-195012172 CAGGGTGGCCAAGGACAGGAGGG + Intergenic
968073374 3:195801997-195802019 CAGGGTGGCCAGAGAGGGAGGGG - Intronic
968406110 4:340514-340536 CAAGGGGAGAAGGGAGAGAATGG - Intronic
968844367 4:3031758-3031780 GGGTGTGACCAGGGAGAGAGTGG + Intronic
969163290 4:5280434-5280456 CAGGGAGACGAGGGAGAGTCAGG - Intronic
969342982 4:6553875-6553897 CTGGGTGGCCTGGTAGAGAAGGG - Intronic
969367191 4:6703364-6703386 CAGTTTGAGCAGGGAGAGATGGG - Intergenic
969508504 4:7603136-7603158 GAGGGAGACCATGGAGAGAGAGG + Intronic
969528221 4:7714987-7715009 CAGGGTAACAAGGGAGGCAAAGG - Intronic
969703490 4:8780280-8780302 CATGGGGACGAAGGAGAGAAAGG - Intergenic
971324977 4:25636338-25636360 TAGGGTGAACTGGGAGGGAAGGG - Intergenic
971627356 4:28938988-28939010 CAGTTTGACAAGGGAAAGAATGG + Intergenic
972172647 4:36365545-36365567 CAGGGAGAAAAGGTAGAGAAGGG + Intergenic
972276373 4:37561543-37561565 CAATGTGGCCAGGGAAAGAAAGG + Intronic
972307349 4:37844364-37844386 GAGCGTGAACAGGGAGACAAAGG + Exonic
972321533 4:37977293-37977315 CGGGGCGGCCAGGCAGAGAAAGG - Intronic
972720094 4:41687871-41687893 GTGGGAGAACAGGGAGAGAAAGG - Exonic
973163317 4:47046101-47046123 CAGAGTGGCCGGAGAGAGAAGGG - Intronic
973787195 4:54342893-54342915 TAGGGTGATCAGGGAGGGATCGG + Intergenic
974699530 4:65422440-65422462 AAGGTTGAGCAGGCAGAGAATGG - Intronic
975452363 4:74544148-74544170 GAGGGTGGACAGGGAGAGACTGG + Intergenic
976221061 4:82757170-82757192 CAGGGTAACCAGAGAGTGACGGG - Intronic
976236849 4:82906524-82906546 CAGGATGATCAAGAAGAGAAAGG + Exonic
977015297 4:91684380-91684402 CAGGTTGACCAGTAAAAGAAAGG + Intergenic
977785544 4:101029745-101029767 CAGGGTGTCTAAGGAGATAATGG + Intronic
978449812 4:108819879-108819901 CAGGGGGAAAAGGGAAAGAAAGG - Intronic
978456352 4:108896692-108896714 CAGGGAGACGCTGGAGAGAACGG - Exonic
978459972 4:108940627-108940649 CAGGGTGACCAAGGACAGGCAGG - Exonic
979876635 4:125899565-125899587 CAGGGTGGCCAGAGAGATAATGG - Intergenic
981629109 4:146797638-146797660 CAGGGTGAGGTGGGAGAGGAAGG - Intronic
982091652 4:151884774-151884796 CAGGATGGCCAGGCAGACAAGGG + Intergenic
983570699 4:169205080-169205102 CAGAGTAACAAGGGAGTGAAGGG + Intronic
984634635 4:182097635-182097657 CAGGGTGACCCAGGAGAGAAGGG - Intergenic
985402530 4:189606690-189606712 GAGGGAGAGTAGGGAGAGAAAGG - Intergenic
986273460 5:6253768-6253790 CAGGGTCCCCAGGGAGGGATGGG - Intergenic
986290585 5:6396254-6396276 CAGGGTGACCGGGGTGAGTGTGG + Intergenic
986601118 5:9474188-9474210 CAGATTGATCAGTGAGAGAAAGG + Intronic
986788545 5:11138533-11138555 CAGGTTGGGCAGGGAGAGGATGG - Intronic
987078381 5:14404642-14404664 CAGGGTGACCGGGGAAAGCGGGG - Intronic
988042844 5:25910939-25910961 CAGGATGAGCAGGATGAGAATGG + Intergenic
989667015 5:43866445-43866467 CAGGGTGGTCAGGGAGAACAGGG + Intergenic
990609218 5:57440967-57440989 CAGCATGACCAAGGAGGGAAGGG + Intergenic
990748619 5:58986671-58986693 CTGGGGGCGCAGGGAGAGAATGG - Intronic
994301673 5:98155282-98155304 CTGGGTCTCCAGGGAGATAAGGG - Intergenic
995414185 5:111890550-111890572 CAGGGTGCCCAGGCAGAGTTTGG - Intronic
995551414 5:113285499-113285521 CAGAGTGAGCAGGGGGAGAGTGG - Intronic
995834431 5:116386061-116386083 TAGGGTGCAGAGGGAGAGAAAGG + Intronic
996332158 5:122342098-122342120 TAGTCTGACCAGTGAGAGAATGG - Intronic
997891112 5:137677758-137677780 CAGGGGGACCATGGAGGGAAAGG + Intronic
1000364227 5:160476307-160476329 CTGGGTGACCAGGGACAGGTGGG + Intergenic
1000408960 5:160918074-160918096 CAGTGTGAAAAGGGAGAGTAGGG - Intergenic
1001015640 5:168138616-168138638 CAGGGAGCACAGGGAGAGAGAGG + Intronic
1001473877 5:172035586-172035608 CCTGGTGACCATGGAGAGCAGGG - Intergenic
1001510200 5:172315270-172315292 CAGGGTTGTCTGGGAGAGAAGGG - Intergenic
1001976850 5:176007178-176007200 CAGGGTGACCAGAGACAGGTGGG - Intronic
1002240578 5:177836602-177836624 CAGGGTGACCAGAGACAGGTGGG + Intergenic
1002965363 6:1960776-1960798 TAGGGTGACCGGGGATAGAAAGG + Exonic
1003447827 6:6200792-6200814 CAGGGTCTGCAGGGAGAGAAGGG + Intronic
1003778724 6:9398849-9398871 CAGGGTGCCCAGCGAGCGCAGGG + Intergenic
1003940652 6:11022052-11022074 CAGGGGTCCCAGGGAGAGAGAGG + Intronic
1004665104 6:17742031-17742053 CAGGATGACCACATAGAGAATGG - Intergenic
1006094350 6:31646603-31646625 CTGGGAGACCAGGGAGAAAGAGG - Intronic
1006258668 6:32850989-32851011 CAGGGTGATCAGGGTGACCATGG + Exonic
1006295101 6:33166772-33166794 CCGGGTGAGCAGGGAGAGAAGGG - Exonic
1006303620 6:33206909-33206931 CTGGGAGACCAGGCAGAGAAAGG - Intergenic
1006365170 6:33611005-33611027 CAGAGTGGAGAGGGAGAGAAAGG - Intergenic
1007215574 6:40234884-40234906 CAAGCTGACCAGGGACAGAAGGG + Intergenic
1008464508 6:51815460-51815482 TAGGGTGGGGAGGGAGAGAAAGG + Intronic
1008484919 6:52025469-52025491 CAGGCTAACCTGGCAGAGAATGG + Exonic
1008679890 6:53861029-53861051 TAGGGTGACGGGTGAGAGAAGGG + Intronic
1009185672 6:60571864-60571886 TGGGGAGACCAGAGAGAGAAAGG - Intergenic
1009918217 6:70023624-70023646 TAGGGTGAACAAGGAGAAAAAGG + Exonic
1010082150 6:71876367-71876389 TAGGGTGACCAGGGATAAATAGG + Intergenic
1010794611 6:80104947-80104969 CAGGCAGACTAGGGAGAAAATGG - Intergenic
1011213618 6:84981284-84981306 CAAGGTGATCAGGGAAGGAATGG + Intergenic
1011437278 6:87351736-87351758 CAGGGTGACCAAGGTGATAGAGG - Intronic
1011772093 6:90684755-90684777 CAGGCTGAACATGAAGAGAAAGG - Intergenic
1012723368 6:102777727-102777749 CTGGGTGACCAGGGAGGACAAGG + Intergenic
1013586663 6:111584957-111584979 CAGAGTGAGCAAGGAGAGAATGG - Intronic
1014123273 6:117750407-117750429 GAGGGAGACCATGGAGAGAGAGG - Intergenic
1015137517 6:129890571-129890593 CAGAGTGAGCAGGGAGAGCCAGG + Intergenic
1015437670 6:133208391-133208413 CAGGGGAAACAGGGAGAGAGGGG - Intergenic
1016404593 6:143716830-143716852 CTGGGTGAGCAGGGAGAGGAGGG + Intronic
1016569700 6:145498107-145498129 CAGACTGACTGGGGAGAGAAGGG - Intergenic
1017052613 6:150407779-150407801 AAAGGTGAAGAGGGAGAGAATGG + Intergenic
1018105940 6:160486438-160486460 CTGGGTGATCAGGCAGAAAACGG + Intergenic
1018209735 6:161469290-161469312 CAGGGTGGCAGGAGAGAGAATGG - Intronic
1018308038 6:162478915-162478937 CTGGGTGATCAGGGAGCGAGTGG + Intronic
1019404877 7:877833-877855 CAGGGAGGCCTGAGAGAGAAAGG - Intronic
1019531486 7:1505777-1505799 CAGGGTGACAAGGCAGAGGGAGG - Intergenic
1019563779 7:1670039-1670061 TCGGGAGGCCAGGGAGAGAAGGG + Intergenic
1019770359 7:2880552-2880574 CAGGGCGATGATGGAGAGAAAGG + Intergenic
1019984857 7:4648226-4648248 CATGGTGTCCAGAGAGGGAAAGG - Intergenic
1021463656 7:20916942-20916964 CAGGGTTACCAGTGAGGAAATGG - Intergenic
1022107977 7:27210393-27210415 CGGGGAGGCCAGGGAGAGAGAGG + Intergenic
1023030388 7:36085552-36085574 TGGGGGGATCAGGGAGAGAACGG - Exonic
1024077129 7:45827211-45827233 CCTGGTGAACAGGGAGGGAAGGG - Intergenic
1024268703 7:47626083-47626105 CAGTGAGAGCAGAGAGAGAAAGG + Intergenic
1024691588 7:51808928-51808950 CAGGGTTCCCAGGAAGAAAAAGG - Intergenic
1025029963 7:55548956-55548978 CAGGGTGACCACAGTGAGACTGG + Intronic
1025107621 7:56185266-56185288 CAGGGTGGCAGGAGAGAGAATGG - Intergenic
1026310625 7:69180824-69180846 CAGGGTGGCAGGAGAGAGAATGG + Intergenic
1026966214 7:74441767-74441789 CAGGGTCACCTGGGAGGGTAGGG + Intergenic
1029201633 7:98843226-98843248 CAGGGTCATCAGGCAGGGAATGG - Intergenic
1030130019 7:106191558-106191580 AAGGATGACCAGAGAAAGAAAGG - Intergenic
1030170610 7:106599156-106599178 CAGGGTAGGCAGGGAGAGGAAGG - Intergenic
1030361534 7:108600150-108600172 CAGGGTGGCAGGAGAGAGAATGG + Intergenic
1031974269 7:128084097-128084119 CAGGGTGACAAGGGTCAGAGGGG + Intronic
1032384037 7:131509209-131509231 CAGGCTAACCAGGGAGAGGGAGG + Intronic
1032701538 7:134384108-134384130 CACGGTGACCAGGAACAGAGAGG - Intergenic
1033045964 7:137962413-137962435 CAAGGTGAGAAGGCAGAGAAAGG - Intronic
1033269005 7:139913893-139913915 GAGGGTGAGCAGGGAGAGGCTGG - Intronic
1033543203 7:142376132-142376154 GAGGGTGACCCAGGAGAGGACGG + Intergenic
1033548087 7:142420781-142420803 GAGGGTGACCCAGGAGAGGAGGG + Intergenic
1033551477 7:142451819-142451841 CAGGGTCACCAGGGAGAGACGGG - Intergenic
1033555946 7:142488668-142488690 CATGGTCACCAGGAAGAGACAGG - Intergenic
1033558323 7:142508173-142508195 CATGGTCACCAGGGAGAGACAGG - Intergenic
1034679199 7:152915789-152915811 GAGGGTGAGAAGGGGGAGAAGGG - Intergenic
1034752505 7:153584025-153584047 CAAGGTCAGCAGGGAGAGAAGGG + Intergenic
1035557849 8:579754-579776 GTGGGTGACCAGGCAGCGAATGG - Intergenic
1035811623 8:2496347-2496369 CAGGGGGACAAGGGAGGGAATGG + Intergenic
1036505289 8:9349280-9349302 CAGTGTGAACAAGCAGAGAATGG - Intergenic
1036623347 8:10443862-10443884 CAGGGTGGCCAGAGAGAGAAAGG + Intergenic
1036744270 8:11392958-11392980 GACGGTGGACAGGGAGAGAATGG + Intronic
1037048305 8:14337371-14337393 CAGCAAGACGAGGGAGAGAAGGG + Intronic
1037104879 8:15094821-15094843 CAGGGTGGCAGGAGAGAGAATGG - Intronic
1037656325 8:20887314-20887336 CAGGGACACCAAGGAGTGAACGG + Intergenic
1038503478 8:28064228-28064250 CAGAGTGACCAAGGACAGAAGGG - Intronic
1039058681 8:33556477-33556499 CAGGGGGAGCAGGGAGGAAAGGG + Intronic
1039450680 8:37672542-37672564 CAGGGTGTCCATAGAGAGAGGGG + Intergenic
1041288571 8:56285543-56285565 CAGGCTGACCAGGGATGGTATGG - Intergenic
1041465650 8:58155337-58155359 CAGGGTGAGAGTGGAGAGAATGG - Intronic
1042807659 8:72789500-72789522 GAAGTTGACCAGGTAGAGAAGGG + Intronic
1042944731 8:74143962-74143984 CAGGGAGACCAGTGAGATAGTGG + Intergenic
1043087146 8:75849332-75849354 CAGGATGACCAGGTACAGAGAGG - Intergenic
1044572522 8:93735265-93735287 CAGGGTCACTAGAGAGAGATAGG - Exonic
1044778159 8:95715526-95715548 GAGGGAGGCAAGGGAGAGAATGG - Intergenic
1044855390 8:96470021-96470043 CAGGGTAACCAGGGACAGCCTGG + Intergenic
1045321169 8:101082347-101082369 CAGGGTGATCAGATAGATAATGG - Intergenic
1045378639 8:101600786-101600808 CAGTGTGACCAGGGAGAGGCAGG + Intronic
1046541595 8:115590514-115590536 CAGGGTGACAAGAAGGAGAAGGG + Intronic
1047300450 8:123609417-123609439 CAGGGTCCTCAGGGAGGGAAGGG + Intergenic
1047402535 8:124558662-124558684 CAGGGGGACCAGGGAGAGTGGGG + Intronic
1047440495 8:124873220-124873242 TAGGATGAACAGGCAGAGAAAGG - Intergenic
1047835006 8:128679905-128679927 AAGGGTGTCCAGGGAGAGGGAGG - Intergenic
1048846078 8:138604750-138604772 CAGGGAGAACCAGGAGAGAAAGG - Exonic
1048856860 8:138693680-138693702 CAGGGTGCCAAGGGACAGGAAGG - Exonic
1049348797 8:142153103-142153125 AAGGTTGCCCAGGTAGAGAAAGG - Intergenic
1049452550 8:142669922-142669944 CCGGGTGAGCAGGGTGAGTAGGG - Exonic
1049462097 8:142735014-142735036 CAGGGTGACAGGGGACAGAGGGG - Intronic
1049656570 8:143801632-143801654 CAGGGTGACAACGGAGAGCAAGG + Intronic
1049989507 9:977750-977772 CAGATTGAGCAGGGAGACAACGG + Intronic
1050237216 9:3594658-3594680 CAGGGTGGCAGGAGAGAGAAGGG + Intergenic
1051107591 9:13597588-13597610 GAGGGTGAGAAAGGAGAGAAAGG + Intergenic
1053294103 9:36900899-36900921 CTGGGGGACCCGGGAGATAATGG - Intronic
1053654050 9:40197578-40197600 GAGGGTGACGAGGAGGAGAAAGG + Intergenic
1054366165 9:64343794-64343816 GAGGGTGACGAGGAGGAGAAAGG + Intergenic
1054673795 9:67833524-67833546 GAGGGTGACGAGGAGGAGAAGGG + Intergenic
1054718693 9:68582367-68582389 CAGGGGGTCCAGGGAGAAGAAGG + Intergenic
1056873505 9:90306183-90306205 CCAGGGGACCAAGGAGAGAAGGG - Intergenic
1057129268 9:92641891-92641913 CAGGGGTCCCAGGGAGGGAAAGG + Intronic
1057292356 9:93814717-93814739 CAGGGAAACCAGAGAGAGAGAGG - Intergenic
1057913231 9:99036167-99036189 CAGGGTCTCAAAGGAGAGAAAGG + Exonic
1058114788 9:101072483-101072505 CTGTGTGCCCAGGAAGAGAAGGG + Intronic
1058731702 9:107856703-107856725 CTGGGTGAAAAGGGAAAGAATGG + Intergenic
1058835511 9:108855869-108855891 CAGGGTGACCCTGGAGAGGCAGG - Exonic
1058887328 9:109331357-109331379 CAGGGGGCCCAGGGAGGAAAGGG + Intergenic
1058999584 9:110334724-110334746 CAGGTTGGCCAGGGAGGGATGGG + Intronic
1059438079 9:114288452-114288474 CAGGGGGAGCAGGGCGAGGACGG + Exonic
1059438709 9:114290807-114290829 CAGGGGGAGCAGGGAGACGATGG + Exonic
1059551836 9:115236965-115236987 CAGGGAGAAAAAGGAGAGAAAGG + Intronic
1060763315 9:126274572-126274594 AAGGGTGACCAGGCCGAGACTGG + Intergenic
1061311798 9:129768380-129768402 CTGGGTCAACAGGGAAAGAAGGG - Intergenic
1062118133 9:134820149-134820171 CCGGGTGAACAGGGTGAGAAGGG + Exonic
1062355888 9:136162126-136162148 CATGGGCACCAGGGAGAGACAGG - Intergenic
1062571223 9:137186277-137186299 CCAGGTGACCCGGGAGAGGATGG - Exonic
1062671445 9:137712204-137712226 AGGGGTGACCAGGGAGAGAAGGG - Intronic
1185734337 X:2485725-2485747 AAGGGAGAAAAGGGAGAGAAGGG + Intronic
1185734350 X:2485773-2485795 AAGGGAGAAAAGGGAGAGAAGGG + Intronic
1186042408 X:5495467-5495489 CATGGTGCCCAGTGGGAGAAAGG - Intergenic
1186045507 X:5532560-5532582 GAGGGAGACAAGGGAGAGAGAGG + Intergenic
1186274595 X:7926300-7926322 CAAGGTGAGGAGGGAAAGAAAGG - Intronic
1186717868 X:12272417-12272439 GAGGGTGACCAGGGAGAGGACGG + Intronic
1186779625 X:12899752-12899774 CCAGGTGTCCAGGAAGAGAAGGG + Intergenic
1187733171 X:22277502-22277524 CAGGGGGAACGGAGAGAGAAGGG - Intergenic
1188529617 X:31125320-31125342 CAGTGGGGCCAGGGAGGGAATGG - Intronic
1188874823 X:35416848-35416870 AAGGGTCACCAGGCAGAGTAGGG + Intergenic
1188953559 X:36407165-36407187 AAGGGTCACCAGGAAGAGTAGGG - Intergenic
1189305704 X:39985148-39985170 CAAGGGGTCCTGGGAGAGAAAGG + Intergenic
1190391490 X:49935923-49935945 CAGAGTGACCAGTGAATGAATGG + Intronic
1191870178 X:65739063-65739085 CAGGATGAGCAGGATGAGAATGG + Exonic
1192496142 X:71617758-71617780 AAGGGAGAGCAGGGAGAGAGAGG - Intronic
1192529335 X:71872022-71872044 GAGGGTGAAAAGGGAGAGGAGGG + Intergenic
1192548898 X:72037864-72037886 CAGTGCCACCAGGGAAAGAAAGG + Intergenic
1194003105 X:88456467-88456489 CAGGGAGATCAGGGAGACAGAGG + Intergenic
1194961371 X:100240086-100240108 CAGGTTGATCTGGAAGAGAAAGG - Intergenic
1196731095 X:118942252-118942274 GAGGGGGAGAAGGGAGAGAATGG + Intergenic
1197152946 X:123239920-123239942 CAAGGGCACCAGTGAGAGAAAGG - Intronic
1197893392 X:131287394-131287416 GAGGGTGAAGAGGGAGTGAAGGG - Intronic
1199434827 X:147801800-147801822 CAGGGCCACCAGTGAGAGAGGGG - Intergenic
1199950022 X:152699633-152699655 CAGGGTGACCAGAGAGTTGAGGG + Intronic
1199959652 X:152768828-152768850 CAGGGTGACCAGAGAGTTGAGGG - Intronic
1200110916 X:153740540-153740562 CTGGGTGTCCACGGAGGGAAGGG - Intronic
1201549927 Y:15209215-15209237 AAGGGGGAGCAGGGAGAGGAGGG + Intergenic