ID: 1182554635

View in Genome Browser
Species Human (GRCh38)
Location 22:31122666-31122688
Sequence GCATTAACACACCTGCCTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182554635_1182554644 5 Left 1182554635 22:31122666-31122688 CCTTAAGGCAGGTGTGTTAATGC No data
Right 1182554644 22:31122694-31122716 CCTGGAGCAAAGGGCTGACCAGG No data
1182554635_1182554638 -4 Left 1182554635 22:31122666-31122688 CCTTAAGGCAGGTGTGTTAATGC No data
Right 1182554638 22:31122685-31122707 ATGCCCCTCCCTGGAGCAAAGGG No data
1182554635_1182554645 12 Left 1182554635 22:31122666-31122688 CCTTAAGGCAGGTGTGTTAATGC No data
Right 1182554645 22:31122701-31122723 CAAAGGGCTGACCAGGCCTACGG No data
1182554635_1182554637 -5 Left 1182554635 22:31122666-31122688 CCTTAAGGCAGGTGTGTTAATGC No data
Right 1182554637 22:31122684-31122706 AATGCCCCTCCCTGGAGCAAAGG No data
1182554635_1182554648 26 Left 1182554635 22:31122666-31122688 CCTTAAGGCAGGTGTGTTAATGC No data
Right 1182554648 22:31122715-31122737 GGCCTACGGCAGAAAGGTGAAGG 0: 1
1: 0
2: 0
3: 10
4: 95
1182554635_1182554646 20 Left 1182554635 22:31122666-31122688 CCTTAAGGCAGGTGTGTTAATGC No data
Right 1182554646 22:31122709-31122731 TGACCAGGCCTACGGCAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182554635 Original CRISPR GCATTAACACACCTGCCTTA AGG (reversed) Intergenic