ID: 1182555382

View in Genome Browser
Species Human (GRCh38)
Location 22:31126008-31126030
Sequence TTGGGAGAGGGCCCCCTCAC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 145}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182555382_1182555387 -10 Left 1182555382 22:31126008-31126030 CCGGTGAGGGGGCCCTCTCCCAA 0: 1
1: 0
2: 1
3: 4
4: 145
Right 1182555387 22:31126021-31126043 CCTCTCCCAAGAAAGGTGGCTGG 0: 1
1: 0
2: 2
3: 8
4: 161
1182555382_1182555396 30 Left 1182555382 22:31126008-31126030 CCGGTGAGGGGGCCCTCTCCCAA 0: 1
1: 0
2: 1
3: 4
4: 145
Right 1182555396 22:31126061-31126083 AGCCATTCTTCCAGGGTGGATGG 0: 1
1: 0
2: 0
3: 15
4: 182
1182555382_1182555389 -8 Left 1182555382 22:31126008-31126030 CCGGTGAGGGGGCCCTCTCCCAA 0: 1
1: 0
2: 1
3: 4
4: 145
Right 1182555389 22:31126023-31126045 TCTCCCAAGAAAGGTGGCTGGGG 0: 1
1: 0
2: 4
3: 19
4: 219
1182555382_1182555395 26 Left 1182555382 22:31126008-31126030 CCGGTGAGGGGGCCCTCTCCCAA 0: 1
1: 0
2: 1
3: 4
4: 145
Right 1182555395 22:31126057-31126079 GGTTAGCCATTCTTCCAGGGTGG 0: 1
1: 0
2: 0
3: 4
4: 83
1182555382_1182555392 5 Left 1182555382 22:31126008-31126030 CCGGTGAGGGGGCCCTCTCCCAA 0: 1
1: 0
2: 1
3: 4
4: 145
Right 1182555392 22:31126036-31126058 GTGGCTGGGGCTTAGCTCTGAGG 0: 1
1: 0
2: 3
3: 39
4: 303
1182555382_1182555394 23 Left 1182555382 22:31126008-31126030 CCGGTGAGGGGGCCCTCTCCCAA 0: 1
1: 0
2: 1
3: 4
4: 145
Right 1182555394 22:31126054-31126076 TGAGGTTAGCCATTCTTCCAGGG 0: 1
1: 0
2: 1
3: 8
4: 151
1182555382_1182555388 -9 Left 1182555382 22:31126008-31126030 CCGGTGAGGGGGCCCTCTCCCAA 0: 1
1: 0
2: 1
3: 4
4: 145
Right 1182555388 22:31126022-31126044 CTCTCCCAAGAAAGGTGGCTGGG 0: 1
1: 1
2: 0
3: 21
4: 187
1182555382_1182555393 22 Left 1182555382 22:31126008-31126030 CCGGTGAGGGGGCCCTCTCCCAA 0: 1
1: 0
2: 1
3: 4
4: 145
Right 1182555393 22:31126053-31126075 CTGAGGTTAGCCATTCTTCCAGG 0: 1
1: 0
2: 0
3: 11
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182555382 Original CRISPR TTGGGAGAGGGCCCCCTCAC CGG (reversed) Exonic
900345333 1:2207787-2207809 CTGGGGGAGGGCCGCCGCACTGG - Intronic
900600783 1:3501854-3501876 GTGGCAGGGGGCCCCCCCACAGG + Exonic
900800372 1:4733483-4733505 CTGGGAGTGGGACCCTTCACAGG + Intronic
901053940 1:6440123-6440145 GTGGGAAAGGGCCCTGTCACCGG - Intronic
901490332 1:9593384-9593406 GTGGGAGAGGACCCCCTGGCAGG + Intronic
902480354 1:16708187-16708209 GCGGGAGAGGGCCCTGTCACCGG + Intergenic
903302134 1:22386564-22386586 TAGGGAGAGGGAACCTTCACAGG - Intergenic
903835128 1:26198640-26198662 ATGGGAGAGGTCCCCATTACAGG - Intronic
906061470 1:42951986-42952008 ATGGGAGGGGGCATCCTCACTGG + Intronic
907299677 1:53478768-53478790 TAGGGAGAGGGGCCTTTCACAGG - Intergenic
912414900 1:109501426-109501448 TAGGGGGAAGGTCCCCTCACTGG - Intronic
916233481 1:162562143-162562165 TTGGGAGTGGGGCCTCTCCCGGG + Intronic
1064716294 10:18180286-18180308 TGGGAAGATGGCCCCATCACAGG - Intronic
1071256543 10:83876884-83876906 CTGGGAGAAGAGCCCCTCACGGG + Intergenic
1073068607 10:100779407-100779429 TTGGGAGAGAGCCCCTTTGCAGG + Intronic
1074189279 10:111122208-111122230 AAAGGAGAGGGCCCCCTGACAGG + Intergenic
1076795112 10:132794597-132794619 TGGGCAGAGGGCACCTTCACTGG - Intergenic
1077571320 11:3340568-3340590 TTGGGAGAGGGTTTTCTCACAGG + Intronic
1081700509 11:45149570-45149592 TTGGGTGGGGGCCCCATGACTGG + Intronic
1081776182 11:45677464-45677486 CTGGCAGAGGGACCCTTCACAGG - Intergenic
1083941735 11:65899823-65899845 TGGGGTGAGGGTCCCCACACGGG - Intronic
1084297430 11:68222010-68222032 TTGGATGAGGCCCCCCACACTGG - Intergenic
1084399830 11:68937112-68937134 TTGGGGCAGTGTCCCCTCACTGG + Intronic
1085152114 11:74260469-74260491 TTGGGAGGGGGGCCCCTTAGGGG + Intronic
1085474666 11:76782410-76782432 TTGGGAGAGGGGCAGTTCACAGG - Intronic
1085566625 11:77520270-77520292 CTGAGAGAGTGCCCCGTCACAGG - Intronic
1091231362 11:133989935-133989957 TTGGGTGAGGCCCACCACACTGG - Intergenic
1094851517 12:34384371-34384393 GAGGCAGAGGTCCCCCTCACGGG - Intergenic
1094870546 12:34597021-34597043 ATGGCTGAGGTCCCCCTCACAGG + Intergenic
1100865554 12:98853318-98853340 TTGGTAGAGTGGCCCCTAACTGG + Intronic
1102530016 12:113539391-113539413 CTGGGAGAGGGCCTCCCCACAGG - Intergenic
1104048475 12:125180762-125180784 TTGGGACTGAGCCCCATCACTGG + Intergenic
1106388077 13:29307570-29307592 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1109859004 13:68172401-68172423 ATGGGAGAGGCCCACCTCAATGG - Intergenic
1110696582 13:78498058-78498080 TTGGGCGAGAGCCTCCTGACTGG + Intergenic
1118688647 14:68316530-68316552 GTGGAAGAGGGCCCACCCACAGG - Intronic
1122135296 14:99629173-99629195 TGGGGAAAGGCCCACCTCACAGG - Intergenic
1122441762 14:101736887-101736909 TTGGGAGAGGTCCCACCCAGCGG - Intergenic
1124413576 15:29456592-29456614 GTGGGACAGTGCCCCCTCCCAGG + Intronic
1125677714 15:41511637-41511659 CTGGGAGAGGGCTCCCGCCCAGG + Intronic
1125894794 15:43293429-43293451 TTGGGACAGGGCAAACTCACCGG + Exonic
1126050394 15:44680000-44680022 TTAGGAGAGGGCTGCCACACTGG - Intronic
1126299243 15:47176770-47176792 TTGGGAGAGGGCACTCTTCCTGG + Intergenic
1130926021 15:88386508-88386530 TTGGGAGAGGGGCCCTCCCCAGG + Intergenic
1132409892 15:101568865-101568887 CTGGGAAAGGACCCCCTCCCAGG - Intergenic
1132995468 16:2820270-2820292 TTAGGAGAGGCCCCGCTGACGGG + Intronic
1133282771 16:4676529-4676551 GCGGTAGAGGGGCCCCTCACAGG + Intronic
1134294962 16:12937591-12937613 TTTGGAGAGGGCTCCCTTCCTGG + Intronic
1136636940 16:31529946-31529968 TTGGGAGAGTGGCGCCTCCCAGG + Intergenic
1140093262 16:71854024-71854046 TTGGGAGAAGGCCTCATCTCTGG + Exonic
1141147595 16:81542649-81542671 TTGGGTGAGGGCCCTCTTCCTGG + Intronic
1141244021 16:82289981-82290003 CTGGGAGAGGGCCACCTTACAGG - Intergenic
1143626294 17:8112002-8112024 CTGGGAGAGGGCCCTTTCCCAGG + Intronic
1146723142 17:35137351-35137373 TTGGGAGAGGCTCTCATCACAGG - Intronic
1147556205 17:41480814-41480836 TTTGGGGAGGGCATCCTCACTGG - Exonic
1152443918 17:80329208-80329230 TTGGCAGAGCACACCCTCACTGG + Intronic
1154191063 18:12231498-12231520 CTGGGTGAGGGCCCTCCCACAGG + Intergenic
1157749834 18:50168471-50168493 TTGGAAAAGGGCCCCCTGACAGG - Intronic
1160136521 18:76276219-76276241 CTGGGAGAGGGCTCCATCTCAGG - Intergenic
1161426726 19:4207798-4207820 TTCGGGGCTGGCCCCCTCACAGG - Exonic
1162319546 19:9963055-9963077 TTGGGTGAGGGCTGCCTCAGGGG - Intronic
1162393752 19:10404620-10404642 TAGGAAGAGGCGCCCCTCACCGG - Intronic
1163143988 19:15368647-15368669 TTGGGAGAAGACCCCATCGCAGG - Intronic
1165170991 19:33891512-33891534 TCGGGTGAGGGCTCCCTCCCGGG - Intergenic
1202714393 1_KI270714v1_random:34089-34111 GCGGGAGAGGGCCCTGTCACCGG + Intergenic
925255014 2:2475884-2475906 CTGGGAGAGGGCTCACTCAATGG + Intergenic
926999538 2:18778655-18778677 TTGGGGGAGGGACCATTCACTGG - Intergenic
927310407 2:21624712-21624734 TTGGCAAAGGGTTCCCTCACGGG - Intergenic
930137235 2:47914843-47914865 TTGAGGGAGAGCCCTCTCACAGG + Intergenic
935361753 2:102251330-102251352 TTGGCACAGGGCCCCGTCTCAGG + Intergenic
936062384 2:109303585-109303607 ACGGGAGAGGGCCGCCACACGGG + Intronic
936712888 2:115153292-115153314 TTGGGAAAGGGGCTCCCCACAGG + Intronic
938765786 2:134459819-134459841 TTGGCAGAGGGCCAGCTCAGAGG - Intronic
939447468 2:142328805-142328827 ATAGGAGAGGGCCACCTGACAGG + Intergenic
942155618 2:173124394-173124416 TTGGAAGAGGGCCTGCTCCCCGG + Intronic
946302289 2:218831312-218831334 TAGGGAGAATGCCCCCTCCCTGG - Intronic
948337428 2:237221477-237221499 GTGGGCGAGGGCCCCCACCCAGG - Intergenic
948841226 2:240650467-240650489 CTGGGCCAGGGCACCCTCACAGG + Intergenic
948847334 2:240689379-240689401 TTGAGAGAGGGCCCTGTCCCTGG - Intergenic
1170169317 20:13393465-13393487 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1172770913 20:37382083-37382105 TGGGGAAAAGGCCCCCTGACTGG - Intronic
1172800747 20:37574473-37574495 CTAGGAGAGGGCCACCTCCCTGG + Intergenic
1174671738 20:52314371-52314393 ATGGCAGAGTGGCCCCTCACAGG + Intergenic
1175285367 20:57833818-57833840 TGGGGAGAAGGAGCCCTCACGGG + Intergenic
1175285396 20:57833913-57833935 TGGGGAGAAGGAGCCCTCACGGG + Intergenic
1175285432 20:57834027-57834049 CTGGGAGAAGGGGCCCTCACGGG + Intergenic
1175285443 20:57834065-57834087 TGGGGAGAAGGAGCCCTCACTGG + Intergenic
1175285454 20:57834103-57834125 CTGGGAGAAGGGACCCTCACTGG + Intergenic
1175285484 20:57834198-57834220 CTGGGAGAAGGGACCCTCACTGG + Intergenic
1175285489 20:57834217-57834239 CTGGGAGAAGGAGCCCTCACTGG + Intergenic
1175285495 20:57834236-57834258 CTGGGAGAAGGAGCCCTCACGGG + Intergenic
1175285514 20:57834293-57834315 CTGGGAGAAGGGACCCTCACTGG + Intergenic
1175529742 20:59666305-59666327 GTGGGAGAGGGCAGACTCACAGG - Intronic
1176233875 20:64045252-64045274 TTGGGGGAGGGACTTCTCACAGG + Intronic
1179643595 21:42762245-42762267 TGGGGTGAGGGCCCTCCCACCGG + Intronic
1179676827 21:42988846-42988868 CTGGATGAGGACCCCCTCACTGG + Intronic
1179676858 21:42988955-42988977 CTGGATGAGGACCCCCTCACTGG + Intronic
1179676873 21:42989010-42989032 CTGGATGAGGACCCCCTCACTGG + Intronic
1179681606 21:43025417-43025439 GTGGCAGAGGGTCCCCTCATGGG - Intronic
1181442339 22:22943177-22943199 TTGGGAGAGGGCCCAGCCTCTGG - Intergenic
1181812042 22:25409294-25409316 TGGGGACAGGGACCCATCACAGG + Intergenic
1182463710 22:30501122-30501144 TTGGTAGAGGACCCTCTCCCGGG - Intronic
1182555382 22:31126008-31126030 TTGGGAGAGGGCCCCCTCACCGG - Exonic
1184108724 22:42383242-42383264 CCAGGAGAGGGCCACCTCACTGG - Exonic
950726871 3:14922437-14922459 TGGGGAGAGGCCCCCCACCCTGG + Exonic
952211167 3:31230932-31230954 CTGGGAGAGGGCAGGCTCACAGG + Intergenic
952431698 3:33229966-33229988 TTGGCAGTGGGCCCTTTCACGGG + Intergenic
953346725 3:42182196-42182218 TGTGGAGACGGCCCTCTCACGGG - Intronic
959636356 3:108576870-108576892 TTGGGAGATGGTGCCCTGACAGG + Intronic
961662879 3:128479713-128479735 CTGGGCCAGGGGCCCCTCACAGG + Exonic
962587737 3:136859649-136859671 TTGGGTGAGGGCTCTCTCTCTGG + Intergenic
964836291 3:160941435-160941457 TTGTGAGAGGGACCCCGCAGAGG + Intronic
968492903 4:899999-900021 TGGGGCGAGGCTCCCCTCACAGG + Intronic
968579809 4:1384697-1384719 ATGGGTGGGGGCCACCTCACTGG - Intronic
973813014 4:54591176-54591198 TTGGGAGAGTGCCCGCTCTGTGG - Intergenic
974136956 4:57830336-57830358 TTTGGATATGGCTCCCTCACAGG - Intergenic
976138731 4:81967029-81967051 TTAGGTGAGGGCCCTCTCCCTGG + Intronic
982784277 4:159523445-159523467 TGGGCAGAGGCGCCCCTCACTGG - Intergenic
986254220 5:6088356-6088378 TTGGATGAGGCCACCCTCACTGG - Intergenic
986436283 5:7734876-7734898 TTGGGTGAGGGCTCCCTTTCAGG + Intronic
994216354 5:97142730-97142752 TGGGAAGAGGGCCCCCTGAGGGG - Exonic
996552110 5:124741930-124741952 TTGGCACAGGGGCCCCTCAAAGG - Intronic
999197858 5:149794914-149794936 TGGGGCAATGGCCCCCTCACAGG - Intronic
1002319346 5:178365788-178365810 GGGGGAGTGGGCCCCCTCCCAGG - Intronic
1003551700 6:7107274-7107296 TTGCGAGAGGGGCACCTCAGAGG - Intergenic
1006134844 6:31888979-31889001 GGGGGAGAGGGTCCCCTCGCTGG + Exonic
1006260147 6:32861147-32861169 CTGGGAGAGGGGCCCCTCCTGGG + Intergenic
1010070071 6:71733788-71733810 TTGGCAGGGGACCCCCTCACAGG - Intergenic
1013628192 6:111958193-111958215 CTGGGGCAGGGCCCCCTCAAGGG + Intergenic
1020015478 7:4829079-4829101 TTGGGAGTGGGCCCAGTAACAGG - Intronic
1022547351 7:31201480-31201502 TGTGGAGAGGGTCCCCTTACAGG + Intergenic
1023190120 7:37571065-37571087 CTGGGAGAAGTCCACCTCACAGG - Intergenic
1023715454 7:43039407-43039429 ATGGGAAAGGGCCCCTGCACTGG - Intergenic
1025102971 7:56150792-56150814 TGGGCAGAGGCGCCCCTCACTGG - Intergenic
1026929189 7:74213784-74213806 TGGGGAGAAGCCCTCCTCACTGG + Intronic
1034457703 7:151180216-151180238 ATGGGGCAAGGCCCCCTCACAGG + Intronic
1034941360 7:155232416-155232438 TTGGAGGATGGCCACCTCACTGG - Intergenic
1041858098 8:62480920-62480942 GTAGGAGAGGGCACCCTGACCGG + Intronic
1042794870 8:72650850-72650872 TTGATAGAGGTCCCCCTCCCTGG + Intronic
1044562895 8:93630706-93630728 TTGGGTGTGTGTCCCCTCACTGG - Intergenic
1045249537 8:100471940-100471962 CTGGGAGAGGGCCCCCTCCCTGG - Intergenic
1045429124 8:102096771-102096793 GTGGGAGTGGGCCCCAGCACAGG - Intronic
1047095275 8:121618385-121618407 TTGGGAGTGGGCACCCCCCCAGG - Intronic
1048026996 8:130596264-130596286 ATGGCAGAGGGCCCCCGCAATGG - Intergenic
1049577983 8:143398366-143398388 TTGGGGGAGGCCACCCTCAGAGG - Intergenic
1054798501 9:69324949-69324971 TTGGGGCAGGGCACCCTCCCAGG + Intronic
1055586123 9:77761187-77761209 TGGGCAGAGGCGCCCCTCACTGG - Intronic
1055923852 9:81489796-81489818 TTGGGTGAGGGCCCACTTTCTGG + Intergenic
1056106826 9:83355314-83355336 TTGGGAGAGGGCTCCAATACAGG - Intronic
1187434902 X:19258875-19258897 CTGGGAGGGGACCCACTCACTGG + Intergenic
1191642768 X:63446229-63446251 TTGTGAGATGGAGCCCTCACAGG + Intergenic