ID: 1182555600

View in Genome Browser
Species Human (GRCh38)
Location 22:31126899-31126921
Sequence GCCACGTGGCCTCCCGCTGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 156}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182555590_1182555600 22 Left 1182555590 22:31126854-31126876 CCTGAAGGTGGGCGCGAGGGCGG 0: 1
1: 0
2: 0
3: 14
4: 143
Right 1182555600 22:31126899-31126921 GCCACGTGGCCTCCCGCTGCAGG 0: 1
1: 0
2: 1
3: 11
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182555600 Original CRISPR GCCACGTGGCCTCCCGCTGC AGG Exonic
900208351 1:1441060-1441082 GCCACGCGGGCTCCCTCTGCTGG + Exonic
900637830 1:3674581-3674603 ACCATGTGGCCTCCCTCTGTGGG - Intronic
901659575 1:10790004-10790026 CCCCAGTGGCCTCCTGCTGCTGG + Intronic
902369125 1:15994339-15994361 ACCACGTGCCTTCCAGCTGCTGG + Intergenic
903127482 1:21257777-21257799 TCCACGTGGCCCCCCCCCGCAGG + Intronic
906292927 1:44631754-44631776 TCCACGACCCCTCCCGCTGCGGG - Intronic
907307113 1:53519645-53519667 GCCCCGTGGCCCACGGCTGCTGG + Intronic
908817564 1:68050003-68050025 GCCACCTGGCCTCAGGCTGAGGG + Intronic
912697816 1:111854835-111854857 GCCTCCTGGCCTCCTGGTGCCGG + Intronic
924151738 1:241136523-241136545 GCCACGTGGCCCCTCACTGTGGG - Intronic
1062806182 10:421299-421321 GGCACTTGGCCTCCCTTTGCGGG - Intronic
1063947964 10:11195806-11195828 TCCACGTGGCCTCCCACTTGAGG + Intronic
1070539489 10:77406065-77406087 GCCCAGTGGCCTCCCCCTCCTGG - Intronic
1070720401 10:78752972-78752994 GCCAAGTGGGCTCCCTCTGGAGG + Intergenic
1072316816 10:94211283-94211305 GCCACCTGCCCTCCCTCTGTAGG - Intronic
1073042238 10:100615600-100615622 ACCACATTCCCTCCCGCTGCAGG + Intergenic
1075028329 10:119003569-119003591 GGCCTGTGGCCTCCAGCTGCAGG + Intergenic
1075575281 10:123573107-123573129 GCCTCCTTACCTCCCGCTGCAGG - Intergenic
1077473592 11:2776202-2776224 GCCAGCTGCCCTCCCTCTGCAGG - Intronic
1080774256 11:35371090-35371112 GCCACCTGGCCTACAGGTGCTGG - Intronic
1086935314 11:92739236-92739258 GCCAAGTAGCCTTCAGCTGCTGG + Intronic
1093176445 12:15918288-15918310 GCCGCCTCGCCTCCCTCTGCAGG + Intronic
1096004358 12:48157121-48157143 GCCGCGGGCCCTCCCGCAGCAGG - Intronic
1096389669 12:51218341-51218363 GCCACATGGCCTTCAGCTGAGGG + Intergenic
1101337945 12:103813351-103813373 GCCACTTGGCATCCAGCAGCAGG - Intronic
1102202092 12:111064212-111064234 GCCACATCGCCTCCTGCTGCTGG - Intronic
1104539342 12:129648099-129648121 GCCTTGTGGCCTCTGGCTGCAGG - Intronic
1105039162 12:132948387-132948409 GCCACGTGGCCTCGCTCCACAGG - Intronic
1108422533 13:50265712-50265734 GCCAGGTGACCTCCCGGTGTGGG - Intronic
1110632613 13:77726664-77726686 CCCACCTGGCCTCCCTGTGCTGG + Intronic
1113188919 13:107721559-107721581 TCCGTGTGGCCTCACGCTGCAGG + Intronic
1114461086 14:22886607-22886629 GCCAGGTGGCGGCCCTCTGCAGG - Exonic
1116336586 14:43665446-43665468 GTCAAGTGGTCTCCCCCTGCTGG - Intergenic
1120976843 14:90256566-90256588 GCCACTTGAGCTGCCGCTGCCGG - Exonic
1121447000 14:93985147-93985169 GCCACGTGTCCCCCTGCTGGTGG - Intergenic
1121727007 14:96159795-96159817 GCCACGTGGCCTCCATGTGAAGG + Intergenic
1122230926 14:100306102-100306124 GCCTCGCGGCTTCCCGCTGGCGG - Intronic
1122922559 14:104886033-104886055 TCCACAGGGCCTCCCGGTGCCGG + Exonic
1126634239 15:50765804-50765826 GCTACGAGGCCACCGGCTGCGGG + Exonic
1127380155 15:58424119-58424141 ACGACGTGGCATCCTGCTGCAGG + Intronic
1128423943 15:67521086-67521108 GCCCCGTGGCCTCCCGCTGGGGG - Exonic
1128768677 15:70266258-70266280 GCCCCTTGGCCTCACGGTGCTGG - Intergenic
1134625646 16:15720797-15720819 GCCACCCGACCTCCCTCTGCTGG + Intronic
1137057478 16:35752539-35752561 GGCCTGTGGCCTCCCGCTGGGGG + Intergenic
1137270779 16:46901100-46901122 TCTACCTGGCCTCCAGCTGCTGG - Intronic
1137539895 16:49355137-49355159 GCCACCTGGCCTCTGCCTGCAGG + Intergenic
1139344854 16:66296359-66296381 GCCTCTTGGCCTCCACCTGCAGG + Intergenic
1139659464 16:68411063-68411085 GCCACATGGCCTCTTCCTGCTGG - Intronic
1140457121 16:75112006-75112028 TCCCCGAGGCCTCCCACTGCCGG - Exonic
1140859801 16:79008817-79008839 GCCCCCTGGTCTCCGGCTGCAGG - Intronic
1144022929 17:11252767-11252789 GCCACATGCCCTGTCGCTGCAGG - Intronic
1144788919 17:17846891-17846913 GCCACATGGCCACCATCTGCGGG + Exonic
1147253381 17:39166668-39166690 GCAACGTGCCCTCAGGCTGCAGG + Intronic
1147742295 17:42676198-42676220 GCCTGTGGGCCTCCCGCTGCAGG - Intronic
1150313216 17:64146425-64146447 GCCGCCTGGCCTCCCGCGGGCGG + Intergenic
1153911245 18:9708239-9708261 GCCACGTGACCCACCGCGGCGGG + Exonic
1156000462 18:32378982-32379004 GCCACCTGGCCTCCTGAGGCAGG + Intronic
1156269211 18:35515599-35515621 GGGATGTGGCCTCTCGCTGCTGG + Intergenic
1160484411 18:79275687-79275709 GCCACTTGGCCTCTTGGTGCAGG - Intronic
1160894264 19:1395340-1395362 GTCACGCGGGCTCCGGCTGCGGG + Intronic
1160927960 19:1556017-1556039 GCCCCGGGACCTCCCGCCGCCGG - Exonic
1160952753 19:1675509-1675531 GCCACCAGGCGTCCCGCGGCAGG + Intergenic
1161537948 19:4831496-4831518 GCCACCTGGCCTCCCTCTTAGGG - Intronic
1161590789 19:5128284-5128306 GCCTCACGGCCTCCAGCTGCAGG - Intronic
1161687635 19:5711274-5711296 GCCACCTGCCCTCCCGCTGTAGG - Intronic
1163266390 19:16224943-16224965 CCCACGTGGCTTCCCCCAGCAGG + Intronic
1164047554 19:21555580-21555602 GCCACGTGGTCTCGCTCAGCAGG - Intronic
1167155382 19:47735373-47735395 GCCTCATGGCCTCCTCCTGCTGG - Intronic
1167921587 19:52786872-52786894 GCCCCGGGCCCTCCCTCTGCCGG - Intronic
1168078246 19:53991997-53992019 GCCCCGTAGCCTCCCGCCTCTGG + Intergenic
928303708 2:30147904-30147926 GTCACGTGGCCTCCATCAGCTGG + Intronic
930166079 2:48204976-48204998 GCCAGGTGGCTTCTCCCTGCAGG - Intergenic
932095666 2:68846183-68846205 GCCACGTGGCCACCTCTTGCTGG + Intergenic
932827996 2:74958948-74958970 GCCTCGGGGCCTCCCGCGGGCGG + Intronic
937706632 2:124928188-124928210 CCCAAGTGGCCTGCCACTGCTGG - Intergenic
938191030 2:129280804-129280826 GCCAAGTAGCCTCCCACTCCTGG - Intergenic
938300611 2:130208849-130208871 GCCAAGTGACCTCCCACTGCTGG + Intergenic
938456114 2:131465622-131465644 GCCAAGTGACCTCCCACTGCTGG - Intronic
941819222 2:169827887-169827909 ACTTCGTGGCCTACCGCTGCCGG + Exonic
948768804 2:240236842-240236864 GCCCCTTGGCCCCCTGCTGCAGG - Intergenic
948834698 2:240620395-240620417 GCCCAGGGGCCTCCTGCTGCAGG + Intronic
948849978 2:240701142-240701164 GCCAGGCGGCCTCGCGCGGCAGG - Intergenic
949004167 2:241636376-241636398 CCCACGTGGGCCCCCGCGGCAGG - Intronic
1168846012 20:945142-945164 GCTGAGTGGCCACCCGCTGCTGG + Intergenic
1169113020 20:3045565-3045587 CCCATGTGGCCTCCCACAGCAGG - Intronic
1169366954 20:5000367-5000389 GCCATGTGACCTCCCTCAGCCGG - Intronic
1172619381 20:36309054-36309076 GCCACGTTCCCTCCAGCTTCAGG + Intronic
1173828692 20:46064028-46064050 GCCTGTTGGCCTCCTGCTGCTGG - Intronic
1174173431 20:48630700-48630722 TCCACGTGCCCTCCTGCTGCAGG - Intronic
1174405294 20:50298942-50298964 CCCACCTGCCCACCCGCTGCCGG - Intergenic
1175908548 20:62393656-62393678 GCAAAGTGAGCTCCCGCTGCAGG + Intronic
1176026552 20:62988803-62988825 GCCACGTGGACTCCCAAAGCGGG - Intergenic
1176093645 20:63329783-63329805 GCCACCTCGCCTGCCTCTGCTGG - Intronic
1176411558 21:6451946-6451968 CCCACGTGCCCTCACGCTGTGGG - Intergenic
1178583243 21:33853364-33853386 GCTGCGTGGCCTCCTGCTCCAGG - Intronic
1179626290 21:42651301-42651323 GCCACGTGGCCTCCTGCATAAGG + Intergenic
1179687052 21:43060268-43060290 CCCACGTGCCCTCACGCTGTGGG - Intronic
1179786622 21:43733941-43733963 GGCACGGGGCCCCCAGCTGCAGG - Intronic
1180700335 22:17778129-17778151 GCCAGGTGGCCTTCCTCTCCCGG + Intergenic
1181544106 22:23591292-23591314 CCCTGGTGGCCTCCCGCTGCAGG + Intergenic
1182467452 22:30526078-30526100 GCCACTTGGCTTCCCTCTTCTGG - Intronic
1182555600 22:31126899-31126921 GCCACGTGGCCTCCCGCTGCAGG + Exonic
1184281656 22:43440884-43440906 TCCATGTGGCCTCCCTCTCCAGG + Intronic
1184748911 22:46473102-46473124 GCCTCGTGGGCTCTCGGTGCAGG + Intronic
1185189994 22:49429252-49429274 GCCACGTGGCCCCCAGTTGGAGG - Intronic
951551841 3:23882607-23882629 GCCACGTGGGAGCCCACTGCAGG + Intronic
954421576 3:50421699-50421721 GCCACGAGGCCTCCAGCACCTGG + Intronic
965571965 3:170181792-170181814 GCCACGTGACCTCTGGCTCCGGG - Intergenic
968625116 4:1623507-1623529 TCCACTTGGTCACCCGCTGCAGG + Intronic
968978596 4:3834770-3834792 GCCACGTGCAGTCCAGCTGCAGG + Intergenic
969340836 4:6539940-6539962 GCCACGTGGCCACCTGCCCCAGG + Intronic
969431393 4:7156888-7156910 GTCACGTGGCTTCCCCCTGGAGG - Intergenic
969635636 4:8368134-8368156 GGCACGTGGCCACCAGCAGCAGG + Intronic
977121120 4:93103247-93103269 GCATCGTAGCCTCCCTCTGCTGG + Intronic
978749578 4:112231940-112231962 GCCCCGTGCCCTCACGCCGCCGG + Exonic
980155000 4:129093525-129093547 GCCGAGTGGACTTCCGCTGCTGG - Exonic
981782095 4:148442281-148442303 GCCTCGGGCTCTCCCGCTGCAGG - Exonic
982915556 4:161204116-161204138 GCCAAGTGGTCTCCCTCAGCAGG + Intergenic
985801357 5:2007114-2007136 TCCACGTGGCCCCTTGCTGCTGG + Intergenic
996205836 5:120734158-120734180 GCCAGGAGCCCTCCCGCTTCAGG - Intergenic
1001404002 5:171462798-171462820 GACACGGGGCCTGCAGCTGCAGG - Intergenic
1004517239 6:16330630-16330652 CCCACTTGGCCTCCCGGTGCTGG + Intronic
1005755694 6:28923584-28923606 GGCAGGTGGTCTCCTGCTGCAGG + Exonic
1005841700 6:29748265-29748287 CTCCCCTGGCCTCCCGCTGCCGG - Intergenic
1005894103 6:30163510-30163532 GCCAGGTGGCTTCCCTGTGCTGG + Exonic
1011892176 6:92177987-92178009 CCCACCTGGCCTTCCTCTGCTGG + Intergenic
1013068469 6:106706185-106706207 GCCACTTGGCCTCTCAATGCTGG - Intergenic
1019275501 7:173475-173497 GCCCCGTTAGCTCCCGCTGCAGG - Intergenic
1019347919 7:539667-539689 GACACGTGGCCTCCTGCGCCGGG + Intergenic
1020122715 7:5513990-5514012 GCCACCCGGCCTCCCGATGCCGG + Intergenic
1027207520 7:76113390-76113412 GCCACGCGGTCTCCCGGTGTTGG - Intergenic
1027263095 7:76478989-76479011 ACCACGTGGCATGCCCCTGCTGG + Intronic
1027314479 7:76977094-76977116 ACCACGTGGCATGCCCCTGCTGG + Intergenic
1034982416 7:155487606-155487628 GACGCGGGGTCTCCCGCTGCGGG - Intronic
1035238809 7:157517135-157517157 GCCACGTGTCCTGAGGCTGCAGG + Intergenic
1035655329 8:1301022-1301044 CCCACGTGGCTTCCAGCTCCTGG + Intergenic
1037121350 8:15290852-15290874 GCCAGGTAGACACCCGCTGCGGG - Intergenic
1037528362 8:19749879-19749901 GCTCCCTGGCCTCCCACTGCAGG - Intronic
1038577303 8:28716338-28716360 GGCGCTTGGCCTCCAGCTGCAGG - Exonic
1039573561 8:38605695-38605717 GCCATGTGGCGTCCCGGTCCTGG + Intergenic
1040547222 8:48408064-48408086 GCCAGGTGGGCAGCCGCTGCAGG - Intergenic
1041419096 8:57646945-57646967 GCCAAGTGGCCTCCGTCAGCAGG - Intergenic
1047121286 8:121908109-121908131 GCCAAGTGGCCTCGCTCAGCGGG + Intergenic
1049367243 8:142246363-142246385 GCCACAGGTCCTCCTGCTGCTGG + Intronic
1049628333 8:143636613-143636635 GCCTCGAGGCCTCTCGGTGCTGG + Intronic
1049651494 8:143771821-143771843 GCCGCGCGGCCTCCTGCTCCCGG - Intergenic
1049756054 8:144311800-144311822 GCCCCATGGCCTCCCCCGGCGGG + Exonic
1052144065 9:25025833-25025855 GCCAAGTGGTCTCACTCTGCGGG - Intergenic
1053475231 9:38377661-38377683 GCCACGGGGCCTCCGAGTGCGGG - Intergenic
1057436480 9:95045243-95045265 GACACGGGTCCGCCCGCTGCAGG - Intronic
1060228032 9:121808106-121808128 GTCACGTGGCGTCCAGCCGCAGG - Intergenic
1060449708 9:123725642-123725664 GCCAGGGGCCCTCCTGCTGCTGG - Intronic
1203778540 EBV:87858-87880 GCCGCGGGGCCTCCTGCCGCGGG + Intergenic
1203778546 EBV:87873-87895 GCCGCGGGGCCTCCTGCCGCGGG + Intergenic
1203778552 EBV:87888-87910 GCCGCGGGGCCTCCTGCCGCGGG + Intergenic
1203778558 EBV:87903-87925 GCCGCGGGGCCTCCTGCCGCGGG + Intergenic
1203778564 EBV:87918-87940 GCCGCGGGGCCTCCTGCCGCGGG + Intergenic
1185771410 X:2768030-2768052 GCAACCTGGCCTCCTGCTGCAGG + Intronic
1186512254 X:10138912-10138934 GCCGCTCGGCCTCCCGCAGCAGG - Exonic
1190108386 X:47574359-47574381 GCCCCGGGGCCTCCCGCCACTGG + Exonic
1196781305 X:119386801-119386823 CCCACGTGGCTTGCCACTGCTGG + Intergenic
1200251619 X:154557181-154557203 AACGCGTGGCCTCCCGCTTCTGG + Intronic
1200253826 X:154568865-154568887 AACGCGTGGCCTCCCGCTTCTGG + Intergenic
1200263943 X:154635543-154635565 AACGCGTGGCCTCCCGCTTCTGG - Intergenic
1200266148 X:154647235-154647257 AACGCGTGGCCTCCCGCTTCTGG - Intergenic
1200710573 Y:6481318-6481340 GCCCCAAGGCCTCCTGCTGCAGG - Intergenic
1200884955 Y:8258517-8258539 GCCCCATGCCCTCCTGCTGCAGG - Intergenic
1201023362 Y:9680669-9680691 GCCCCAGGGCCTCCTGCTGCAGG + Intergenic
1201299142 Y:12490879-12490901 GCAACCTGGCCTCCTGCTGCAGG - Intergenic