ID: 1182559365

View in Genome Browser
Species Human (GRCh38)
Location 22:31147726-31147748
Sequence TGCCCAAGGCTGCCCAGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182559365_1182559373 23 Left 1182559365 22:31147726-31147748 CCCCTCCTGGGCAGCCTTGGGCA No data
Right 1182559373 22:31147772-31147794 CTGTTATACACTCTACTGATTGG No data
1182559365_1182559370 -8 Left 1182559365 22:31147726-31147748 CCCCTCCTGGGCAGCCTTGGGCA No data
Right 1182559370 22:31147741-31147763 CTTGGGCAAGTCAGTTACTTTGG No data
1182559365_1182559374 24 Left 1182559365 22:31147726-31147748 CCCCTCCTGGGCAGCCTTGGGCA No data
Right 1182559374 22:31147773-31147795 TGTTATACACTCTACTGATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182559365 Original CRISPR TGCCCAAGGCTGCCCAGGAG GGG (reversed) Intergenic
No off target data available for this crispr