ID: 1182561284

View in Genome Browser
Species Human (GRCh38)
Location 22:31161246-31161268
Sequence TCCGTGCCTCCTTTCGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 65}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182561279_1182561284 2 Left 1182561279 22:31161221-31161243 CCACCGATGGAGTGAATGGATTG 0: 1
1: 0
2: 0
3: 6
4: 43
Right 1182561284 22:31161246-31161268 TCCGTGCCTCCTTTCGAGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 65
1182561280_1182561284 -1 Left 1182561280 22:31161224-31161246 CCGATGGAGTGAATGGATTGCCT 0: 1
1: 0
2: 0
3: 15
4: 130
Right 1182561284 22:31161246-31161268 TCCGTGCCTCCTTTCGAGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182561284 Original CRISPR TCCGTGCCTCCTTTCGAGGG AGG Intronic
902576581 1:17381753-17381775 TCAGGGCCTCCTTTTGAGGGAGG - Intronic
911981722 1:104577575-104577597 GCCCTGCCTCTTTTCCAGGGAGG - Intergenic
916600402 1:166287767-166287789 TTCTTGCTTCCTTTCAAGGGTGG + Intergenic
917400040 1:174637669-174637691 TTCGTGCCTCCTCATGAGGGAGG + Intronic
922579166 1:226684391-226684413 TCCATGCAGGCTTTCGAGGGAGG - Intronic
923305622 1:232685645-232685667 TCCATGGCTCCCTCCGAGGGAGG + Intergenic
924757318 1:246953141-246953163 TTCAGGCCTCCTTTGGAGGGAGG + Intronic
1070320839 10:75353483-75353505 GCTCTGCCTCCTTCCGAGGGTGG - Intergenic
1077160980 11:1112787-1112809 TCCTTGGGTCATTTCGAGGGTGG + Intergenic
1081773821 11:45664935-45664957 TCCCTGCCCCCATTCGAGGAGGG - Intronic
1082768993 11:57191212-57191234 TTCATGGCTCCTTTCGAGGAGGG + Exonic
1083708838 11:64534960-64534982 TCCCTGCCTCCCTTAGAGAGAGG - Intergenic
1083795603 11:65014703-65014725 TCCGCGGATCCTTTCGAGCGTGG + Intronic
1088505053 11:110519395-110519417 GCAGTGCCTCCTTTTGAGGATGG + Intergenic
1094278630 12:28708923-28708945 TCCCTGCCTCCATTCAAGGAGGG + Intergenic
1102128172 12:110502315-110502337 TCCGAGCCTGCTTTTTAGGGCGG + Exonic
1102988131 12:117294962-117294984 TCCCTGCCTCCTTTTGAGCCTGG - Intronic
1103479461 12:121241666-121241688 TCCGTGTCTCCTGTCCAGGAGGG + Intronic
1103956954 12:124582630-124582652 GGGGTGCCACCTTTCGAGGGTGG - Intergenic
1104013327 12:124947270-124947292 TCCATGCCTTCTTGGGAGGGTGG - Exonic
1104758703 12:131284347-131284369 TCCGTGCTCCCTTCCCAGGGAGG + Intergenic
1108914666 13:55591797-55591819 TCCGTGTCTGCTTTCGAAGCTGG + Intergenic
1111899830 13:94187184-94187206 TCCAAGCCTTCTTTTGAGGGAGG - Intronic
1115410612 14:33069942-33069964 TACGTGCCTCTTTTTGAAGGTGG + Intronic
1119719903 14:76883637-76883659 GCAGGGCCTCCTTTCGAGGTTGG + Intergenic
1121633730 14:95439778-95439800 TCCGTGTGTCCTTTAGAGGCTGG - Exonic
1122342222 14:101035811-101035833 TCCTTGTCTCCCATCGAGGGGGG + Intergenic
1127964642 15:63914512-63914534 TTTGTGCCTCCCTTCCAGGGGGG - Intronic
1128769446 15:70270941-70270963 TCAGTGACTCCTATCAAGGGTGG + Intergenic
1129666683 15:77583118-77583140 TCAGTGCCCCCTTACCAGGGAGG - Intergenic
1140228395 16:73097057-73097079 TCCCTTCCTTCTTTCGAGGTGGG + Intergenic
1141406962 16:83803059-83803081 TCCCTGCCTTCTTTCAAGGCAGG + Intergenic
1143108370 17:4540634-4540656 TCCGTGTCTCTTACCGAGGGAGG + Intronic
1148063909 17:44854875-44854897 TCCCTGCCTCCTTTCGACCCTGG + Intronic
1150577309 17:66441654-66441676 TCCGTGCCTCCTTTAGAAAGGGG - Intronic
1158529581 18:58247114-58247136 TCCTTACCTCCTTTAGAGGCGGG + Intronic
1158686937 18:59623068-59623090 TCTGTGCCCCCTTTCCAGAGTGG - Intronic
1160073606 18:75650606-75650628 AGTGTGCCTCCTTTCTAGGGAGG + Intergenic
926323258 2:11763523-11763545 TCCCTACCTCCTTTCCAGGCGGG + Intronic
930802483 2:55457298-55457320 CACCTGCCTCCTTTGGAGGGTGG - Intergenic
948429769 2:237911982-237912004 TCCCTGCCCCCTTCCTAGGGTGG - Exonic
1170819047 20:19740244-19740266 TCTGTGTCTCCTTTCCAGGCTGG - Intergenic
1172810183 20:37641792-37641814 TCTGTGCCTCATTATGAGGGTGG + Intergenic
1174198480 20:48790361-48790383 TCCGTTCCTACTTTCGGGGGAGG - Intronic
1174479284 20:50819554-50819576 TCAGTGCCTGCTGTCTAGGGTGG - Intronic
1176136035 20:63522416-63522438 CCCGTGCCACCTTTAGCGGGGGG + Intergenic
1176381776 21:6117393-6117415 TCAGTGCCCTATTTCGAGGGTGG + Intronic
1179577417 21:42316814-42316836 TCCGTGTTTCTTTTCCAGGGAGG + Intergenic
1179741696 21:43420846-43420868 TCAGTGCCCTATTTCGAGGGTGG - Intronic
1181365364 22:22372372-22372394 TCCTTGCCTCCTTCTCAGGGCGG + Intergenic
1182561284 22:31161246-31161268 TCCGTGCCTCCTTTCGAGGGAGG + Intronic
949934469 3:9106287-9106309 TCCCTGACTCCTTTCCAGTGTGG + Intronic
950671111 3:14525901-14525923 TCCTTGCCTCCTTTGGAGTAGGG + Exonic
954215867 3:49124245-49124267 GCCGTGCCGGCTTTGGAGGGCGG - Exonic
988873960 5:35423198-35423220 TCTTTGCCTCCTTTCCAGGCTGG - Intergenic
995108897 5:108405904-108405926 TCCTTTCCTCCACTCGAGGGAGG - Intergenic
997206630 5:132054054-132054076 CCCCTGCCTCCTTTCTGGGGTGG + Intergenic
998651247 5:144124135-144124157 TGCATTCCTCCTTTAGAGGGTGG + Intergenic
1001565622 5:172697466-172697488 TCCGTCCATCCTTTCCTGGGAGG - Intergenic
1004525390 6:16402629-16402651 GCTGTTCCTCCTTTCAAGGGAGG + Intronic
1013441748 6:110179075-110179097 CCCGTGCCTCTTTCCGGGGGAGG - Intronic
1019337163 7:490952-490974 TCCATACCTCCTTGCCAGGGAGG - Intergenic
1019357019 7:585771-585793 TCCGTGGTTCCTATCTAGGGTGG - Intronic
1021839981 7:24714508-24714530 TCCGTGGCTCCTTCCTATGGTGG - Intronic
1047731775 8:127734759-127734781 TCCGTGCCTTTTTTTGGGGGGGG - Intergenic
1050821945 9:9890014-9890036 TCCATGCCTCTTTGGGAGGGTGG - Intronic
1060039994 9:120291992-120292014 TCCTTCCCTCCTTTCCAGTGGGG - Intergenic
1189332692 X:40153212-40153234 TCCGGGCCCCCTCTCTAGGGCGG - Intronic
1190562267 X:51697177-51697199 TCCGTGCCTGATTTAGATGGTGG + Intergenic