ID: 1182566587

View in Genome Browser
Species Human (GRCh38)
Location 22:31204644-31204666
Sequence ACTCCTGGTGTTTGGCTTCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 2, 1: 0, 2: 2, 3: 14, 4: 200}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182566577_1182566587 21 Left 1182566577 22:31204600-31204622 CCTACATCCGTGGCAGGGCTCTG 0: 2
1: 0
2: 0
3: 13
4: 120
Right 1182566587 22:31204644-31204666 ACTCCTGGTGTTTGGCTTCCTGG 0: 2
1: 0
2: 2
3: 14
4: 200
1182566580_1182566587 14 Left 1182566580 22:31204607-31204629 CCGTGGCAGGGCTCTGGACTGGT 0: 2
1: 0
2: 0
3: 19
4: 187
Right 1182566587 22:31204644-31204666 ACTCCTGGTGTTTGGCTTCCTGG 0: 2
1: 0
2: 2
3: 14
4: 200
1182566576_1182566587 25 Left 1182566576 22:31204596-31204618 CCTGCCTACATCCGTGGCAGGGC 0: 2
1: 0
2: 0
3: 7
4: 92
Right 1182566587 22:31204644-31204666 ACTCCTGGTGTTTGGCTTCCTGG 0: 2
1: 0
2: 2
3: 14
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182566587 Original CRISPR ACTCCTGGTGTTTGGCTTCC TGG Exonic
900198579 1:1390865-1390887 TCTTCCTGTGTTTGGCTTCCAGG - Exonic
902991512 1:20190784-20190806 GCTCCTGGTTTTTGGCTGCTTGG - Exonic
903547374 1:24134559-24134581 AGCCCTGGTGTTTGGGTTTCAGG + Intronic
904120100 1:28192594-28192616 AGCCTTGGTGTTTGGCTCCCAGG + Intronic
904723660 1:32530383-32530405 ACTCATGGTTTTTGCCTTTCTGG - Intronic
904849033 1:33443284-33443306 AGACCTGGTCTTTTGCTTCCAGG + Intergenic
905379892 1:37554301-37554323 ACTCCTGGACTTCCGCTTCCGGG + Exonic
907212146 1:52833162-52833184 TCTCTTGGTCTTTGCCTTCCAGG - Intergenic
910670956 1:89772294-89772316 ACTCCGGTGGTTTGGCCTCCTGG + Intronic
911657672 1:100463346-100463368 CCTCCTAGTCTTTGGCTTCATGG + Intronic
912327820 1:108785329-108785351 ACACGTGGTGTTGGGCTTACAGG - Intronic
912804077 1:112742261-112742283 ATTCCTGCCCTTTGGCTTCCAGG + Intergenic
915927887 1:160038100-160038122 AGTCCTGGCATTTGGATTCCAGG + Exonic
916644120 1:166765138-166765160 ACTCCTTTCTTTTGGCTTCCAGG - Intergenic
917577579 1:176340123-176340145 CCTTCTAGTGTCTGGCTTCCTGG + Intergenic
917973495 1:180223862-180223884 ACTCCAGGTCATTGCCTTCCAGG + Intergenic
918166039 1:181948722-181948744 ACACGTGGTGTTGGGCCTCCAGG + Intergenic
920514605 1:206575379-206575401 GCTCATGGTGAATGGCTTCCGGG + Intronic
922063070 1:222110039-222110061 AATACTGGAGTTGGGCTTCCAGG - Intergenic
922413228 1:225395818-225395840 ACTCATGCTGTTTGGCCTCTGGG + Intronic
922632142 1:227126223-227126245 CCTCCAGGTGTGTGGCCTCCAGG + Intronic
924117738 1:240763940-240763962 ACTCCTGGCACTTGGCTTCCCGG + Intergenic
1065032878 10:21605707-21605729 ACTACAGGTGTTTGGCTCACTGG + Intronic
1066260774 10:33727796-33727818 ACTTCTGGGGTTTGGGTCCCTGG - Intergenic
1066635577 10:37495930-37495952 CCTCGTGGTGTTTGGCTTGTGGG + Intergenic
1067041026 10:42953371-42953393 AGTCCTGGTGATTGGCTGCGGGG - Intergenic
1069605176 10:69734163-69734185 ACTCCAGACATTTGGCTTCCAGG + Intergenic
1070011426 10:72478716-72478738 ACTCCTGGTTTTTAGTTGCCTGG + Intronic
1070997509 10:80798549-80798571 ATTCCTGGCCTTTGACTTCCAGG - Intergenic
1073131871 10:101194604-101194626 ACTCCTGATTCTTGACTTCCTGG - Intergenic
1075357075 10:121789270-121789292 AGCCCTGGAGTTAGGCTTCCTGG - Intronic
1075711279 10:124531935-124531957 ACTCCTGGTGTTTTACTTTAAGG + Intronic
1076395556 10:130135787-130135809 GCTCCTGGTGTTAGGGTTCCTGG - Intergenic
1080647749 11:34199212-34199234 GGTGATGGTGTTTGGCTTCCAGG + Intronic
1082089933 11:48081040-48081062 ACTCCTGGTGATTGACTCCTAGG + Intronic
1083620261 11:64045724-64045746 ATTTCTGGTTTTTGGCATCCAGG - Intronic
1084853192 11:71960728-71960750 ACCCCATGTGTTTGGCTTTCAGG + Exonic
1085617148 11:78009359-78009381 ACTCTTGTTGTTTGGCTTCCTGG + Intergenic
1088265212 11:107981961-107981983 AGTACTGGGGCTTGGCTTCCTGG + Intergenic
1088610753 11:111573971-111573993 AATGCTGGTATTTGGCTTCAGGG - Intergenic
1089101136 11:115963543-115963565 ACTTGTGGTGTATGGCTTCTGGG + Intergenic
1090262020 11:125328089-125328111 CCTCCTGGTGCTGGGGTTCCAGG - Intronic
1091973116 12:4804728-4804750 AGTCCTGGTTGTTGGTTTCCAGG + Intronic
1092523285 12:9294380-9294402 AGGCCTGGTTTTGGGCTTCCTGG + Intergenic
1092544009 12:9437519-9437541 AGGCCTGGTTTTGGGCTTCCTGG - Intergenic
1092767870 12:11869632-11869654 ACTCCTGGTGGTTGTTCTCCTGG - Exonic
1093640954 12:21526921-21526943 TTTCCTGGTGTTTGTTTTCCTGG + Exonic
1096277715 12:50224804-50224826 ACTGCAGCTGTTTGACTTCCTGG + Intronic
1097993403 12:65860959-65860981 ACACATGGTGTTTGACTTCATGG + Intronic
1098980765 12:76953196-76953218 ACTCCTGGTCTTTGTCATGCTGG + Intergenic
1099866841 12:88293379-88293401 ACACATGGTGTTTGGCTGCATGG + Intergenic
1100222402 12:92520033-92520055 ACTCCTTGTCTTTGTCTTCTTGG + Intergenic
1100581081 12:95941303-95941325 AATCCTGCTATTTGTCTTCCTGG - Intronic
1104728159 12:131090378-131090400 ACTGCTGGTCTTTGGGTTCCTGG + Intronic
1109876092 13:68405915-68405937 ACACCTGGTGTTGGGCCTGCAGG - Intergenic
1112630965 13:101160973-101160995 ACTGCTGGTGTTTGCCTTTATGG - Intronic
1112688932 13:101866987-101867009 TCTCCAGTTGCTTGGCTTCCAGG - Intronic
1112720289 13:102236543-102236565 ACTTGTACTGTTTGGCTTCCCGG - Intronic
1113345111 13:109469624-109469646 AAATCTGGTGTCTGGCTTCCTGG - Intergenic
1114384689 14:22242801-22242823 AGTACTGGGGCTTGGCTTCCCGG - Intergenic
1114697042 14:24635056-24635078 ACTACTGATCTTTGGCTGCCTGG - Intergenic
1115872130 14:37816445-37816467 ATTTCTGCTGTCTGGCTTCCAGG + Intronic
1123744062 15:23304469-23304491 AATCTTTGTGTTTGGCTGCCCGG + Intergenic
1126376536 15:48002462-48002484 ACACCTGGTGTCTGGCTTCTGGG + Intergenic
1128046454 15:64622074-64622096 ACTGCTGTTGATTGGCTTCTGGG + Intronic
1128115523 15:65102495-65102517 TCTCCTGGTGTCCGGCCTCCGGG + Exonic
1129682308 15:77664716-77664738 AGTCCTGAGGTTTGGCCTCCTGG - Intronic
1129905362 15:79183470-79183492 AATCCAGGTGTCAGGCTTCCTGG + Intergenic
1130101531 15:80898203-80898225 ACACCTGGAATTTGGGTTCCAGG + Intronic
1130551876 15:84894647-84894669 CCTCTTGCTGTTTGGCTTCACGG + Intronic
1131047863 15:89327349-89327371 GCTCCTGGTGTTTGCCTCCAAGG - Exonic
1131470652 15:92693887-92693909 ACAGCTGGTGTTTGCCTTTCAGG - Intronic
1132331276 15:101013880-101013902 CCTCCTGGTGGGTGGCCTCCTGG - Intronic
1133401031 16:5487159-5487181 GCTCCTTGTGTTTTTCTTCCTGG + Intergenic
1133403727 16:5507025-5507047 ACCCCTGGAGCTTGGCTGCCTGG + Intergenic
1133845832 16:9453078-9453100 TCTCCTGGTGTTTGACTGACAGG + Intergenic
1134106230 16:11487372-11487394 ACTCCTAGTGTCTGGCAGCCTGG - Exonic
1134621902 16:15695738-15695760 ACTTCTGGTTTTTGGCTGTCTGG + Intronic
1136561028 16:31039378-31039400 ACTCCTTGGGGATGGCTTCCAGG - Intronic
1138265545 16:55657212-55657234 TCTTCTGCTGTTTTGCTTCCAGG - Intronic
1139579012 16:67860932-67860954 ACTCCTGTTGTTTGGACTCTAGG + Intronic
1141151122 16:81565339-81565361 ACTCCTGGAGTTGGGCTGCTGGG - Intronic
1141157320 16:81606405-81606427 TCTCCTGAAGTCTGGCTTCCTGG + Intronic
1141270030 16:82531210-82531232 ACTCTTGATGTTTCGCTTCATGG + Intergenic
1142912107 17:3102993-3103015 ACTCCTGGTGTCAGGCCTCATGG + Intergenic
1143831510 17:9655597-9655619 CCTCGTGGTGTTTGCATTCCTGG - Intronic
1144437447 17:15254458-15254480 ACTCTAGATGTTTGGCTTGCTGG + Intronic
1145186564 17:20799563-20799585 ACTGCTGGTGTCTGGGTTCAGGG + Intergenic
1145256351 17:21325154-21325176 ACTTCTGCTATTTGGCTACCTGG + Intergenic
1145320260 17:21762790-21762812 ACTTCTGCTATTTGGCTACCTGG - Intergenic
1150207200 17:63418004-63418026 AGGGTTGGTGTTTGGCTTCCGGG + Intronic
1152164746 17:78695331-78695353 AGTCCTCGTGTTTAGTTTCCTGG - Intronic
1152172952 17:78765689-78765711 CCTCTTGGTGTTTGTCTTCTGGG - Intronic
1153195847 18:2595558-2595580 ACTTCTGTTGTTCAGCTTCCAGG - Exonic
1154365299 18:13702545-13702567 ACTCTTGGTCTCTGCCTTCCAGG + Intronic
1155629174 18:27871936-27871958 ACACCTGGTGCTTTGCTCCCAGG - Intergenic
1157571125 18:48713112-48713134 ATTCCTGGTTTCTGGGTTCCTGG + Intronic
1158339130 18:56446495-56446517 ATTCCTGGGTTTTGGATTCCTGG - Intergenic
1158695469 18:59699292-59699314 ACTCAGGCTGTTTGGTTTCCTGG + Intergenic
1159565386 18:70042323-70042345 ATTCCTGGTTTTTCTCTTCCTGG - Intronic
1161700200 19:5790280-5790302 TCTCCTGCCCTTTGGCTTCCAGG + Exonic
1161993299 19:7697497-7697519 ACTCCTGGAGTTGGGGTTGCAGG - Intronic
1162326430 19:10002357-10002379 ACTCCTGGTGTTTGTATTCTTGG + Intronic
1165618759 19:37226382-37226404 ACTCCTGGTGTTACACATCCAGG + Intronic
1165716533 19:38049493-38049515 TCCCCTGGTGTTGGGCATCCAGG + Intronic
927872851 2:26634660-26634682 AACCCAGGTCTTTGGCTTCCAGG + Intronic
931466104 2:62488228-62488250 AGTCCTTGTTTTTGCCTTCCTGG + Intergenic
933012287 2:77081840-77081862 ACTACTGGAGTATTGCTTCCAGG - Intronic
933632249 2:84671652-84671674 CTTCCTGCTGCTTGGCTTCCAGG + Intronic
935107568 2:100059780-100059802 ACTCCTGGCAGTTGGCTTCTTGG - Intronic
935396160 2:102611442-102611464 ACTCTTTATGTTTGGCTCCCTGG + Intergenic
937990873 2:127661624-127661646 ACCTCTGGGGTTTGGCTTCCAGG - Intronic
938098133 2:128476329-128476351 ACTAATGGTATTTGGCTTTCAGG + Intergenic
940432306 2:153607126-153607148 AGTCATGGTATTTGGGTTCCTGG - Intergenic
940521536 2:154756611-154756633 ACTTGTGGTGTTTGGTTTTCTGG + Intronic
940806356 2:158191859-158191881 AACCCTGGTGTTTGGATTTCAGG + Intronic
940918368 2:159282725-159282747 ACTCCACGTGTTTGGCATCAGGG - Exonic
942798812 2:179852512-179852534 ACTCATGGTATATGGATTCCAGG - Intronic
946129100 2:217591744-217591766 AGTACTGGGGCTTGGCTTCCTGG + Intronic
946146788 2:217737353-217737375 ACCCCTGTTGTTTGGCTTTGAGG - Intronic
948380746 2:237548309-237548331 TCTCCTGGTGTCTGGCACCCTGG - Intronic
948555549 2:238807626-238807648 AATTCTGGTGCCTGGCTTCCTGG - Intergenic
948624917 2:239262970-239262992 CTTCCTGGGGCTTGGCTTCCCGG - Intronic
1169280442 20:4262619-4262641 ACTGCTGGGGTTTGGCTTCCTGG + Intergenic
1170736693 20:19019026-19019048 ACCCCTGGTGTCTACCTTCCTGG - Intergenic
1170928704 20:20748920-20748942 AGTCCTGGTGGTTGGTTTTCTGG - Intergenic
1172888213 20:38246006-38246028 TCTCCTGGACTCTGGCTTCCAGG - Exonic
1173589879 20:44216510-44216532 AATGCTTGTGTTTGCCTTCCAGG - Intergenic
1174815692 20:53684980-53685002 ACTCCCTGTGTTTGGATTCACGG + Intergenic
1175874870 20:62224569-62224591 ACTCCTGCTGTTCTCCTTCCTGG - Intergenic
1176140183 20:63541567-63541589 ACTCCTGGGCTTTGCCTGCCAGG - Exonic
1179542705 21:42093957-42093979 ATTCCTGCTCTGTGGCTTCCAGG + Intronic
1179972587 21:44844467-44844489 ACTCCCGGCGTTTGGAGTCCAGG - Intergenic
1180589646 22:16926149-16926171 ACTCCTTGTCTTTGTCTTCAGGG - Intergenic
1180914124 22:19473492-19473514 ACCCCTGGTGTCTGGCTCCTGGG + Intronic
1181137047 22:20775076-20775098 CCTCCTGGTGTATGGTCTCCAGG - Intronic
1182566587 22:31204644-31204666 ACTCCTGGTGTTTGGCTTCCTGG + Exonic
949168026 3:963908-963930 AGGCTTGTTGTTTGGCTTCCTGG + Intergenic
950743306 3:15066577-15066599 TCTCTTGGTGTTTGGTTTACGGG + Intergenic
955509701 3:59667096-59667118 TCTCTTGGCCTTTGGCTTCCAGG - Intergenic
956196251 3:66655979-66656001 TTTCCTGGTGAATGGCTTCCCGG + Intergenic
956802108 3:72769107-72769129 ACTCCATCTGTTTGGCTTCTAGG - Intronic
960974960 3:123164465-123164487 TCTAGAGGTGTTTGGCTTCCAGG + Intronic
960975209 3:123166894-123166916 TCTAGAGGTGTTTGGCTTCCAGG - Intronic
961207129 3:125093452-125093474 ACTCCTGATGTGTTGGTTCCTGG + Intronic
962844117 3:139260406-139260428 CCCCCTGGTGTGTGGCCTCCAGG + Intronic
965687937 3:171325202-171325224 TCTGTTGGTGTTTGTCTTCCTGG - Intronic
967493099 3:190115714-190115736 ACTTTAGTTGTTTGGCTTCCTGG - Intronic
967623925 3:191664669-191664691 AGTACTGGGGTTTGGTTTCCCGG - Intergenic
971658146 4:29376707-29376729 AGTTCTGCTGTTTGGCTTCCAGG + Intergenic
972110999 4:35559851-35559873 ACTCCTGTAGTTAGGCTACCGGG - Intergenic
972406505 4:38751552-38751574 TCTCCTGGAGTTTGGCCTTCCGG - Intergenic
977561589 4:98538364-98538386 ACTGCTGGTGTGTGGCTTTCTGG - Intronic
979558574 4:122077754-122077776 ACTCCTGGTGTTTGGCTTCCTGG - Intergenic
980416142 4:132491396-132491418 TGTCCTGGTGATTTGCTTCCAGG - Intergenic
981348430 4:143700687-143700709 GCTCCTGGCGTTGGGATTCCCGG + Intergenic
984783724 4:183549512-183549534 ACTCCTTGAGTGTGGCTTCCGGG + Intergenic
986717172 5:10533078-10533100 ACACCTGGAGTTTGGATTTCTGG + Intergenic
986746438 5:10749006-10749028 AGTCCAGGTGACTGGCTTCCAGG - Intronic
989693153 5:44169857-44169879 ACTGCTGCTGCTTGGCCTCCTGG - Intergenic
992886571 5:81165901-81165923 ACTCCTGGTGCTTGACTCTCTGG + Intronic
993169320 5:84396983-84397005 TATCCAGGTGTTTGGCTTCCTGG - Intergenic
998468920 5:142367903-142367925 AGTGCTGGTGTTCTGCTTCCTGG + Intergenic
998561865 5:143179556-143179578 ACACCTGGGGCTTGGCTCCCTGG + Intronic
1002105974 5:176879611-176879633 AGTCATTGTGTTTGGCTTCGGGG + Intronic
1002564003 5:180099982-180100004 ACTCCTGGGGTTTGGCCCCCAGG + Intergenic
1002566868 5:180117080-180117102 ACCCCTGCTGTCTGGCTTCCCGG + Intronic
1003254003 6:4458764-4458786 TCTCCTGGTGTTGGGTTTCCTGG + Intergenic
1004622072 6:17339734-17339756 CCTCCTTGTGCTTGGCTCCCAGG + Intergenic
1011046242 6:83086622-83086644 ATACCTTGTTTTTGGCTTCCGGG - Intronic
1014705633 6:124742813-124742835 AGTCCTGGAGTTCTGCTTCCTGG + Intronic
1015721236 6:136244646-136244668 ACTACAGGTTTTTGGCTTGCAGG + Intronic
1016556906 6:145348921-145348943 ACTCCTGGTGATTTGTTTACTGG - Intergenic
1017019202 6:150126891-150126913 ACCTCTGGTGTTTGGAGTCCAGG + Intergenic
1017728119 6:157289944-157289966 CCTCCTGGTGATGGGCTGCCGGG + Exonic
1017801334 6:157898909-157898931 ACTCCTGGGGTCTGGCTCTCTGG + Intronic
1018277719 6:162150721-162150743 ATTCTTGGTGTTTGGGTACCTGG + Intronic
1019425587 7:975179-975201 ACTCCTTGCGTCAGGCTTCCGGG - Intronic
1019432905 7:1007620-1007642 CCTCCTGGTGTGTGGATCCCAGG + Intronic
1019553525 7:1617068-1617090 TCCCTTGGTGTTTGGGTTCCTGG + Intergenic
1019756420 7:2773862-2773884 CCTCCTGGTGATGGGCGTCCGGG - Intronic
1022728983 7:33005324-33005346 GTTCATCGTGTTTGGCTTCCTGG - Exonic
1023033078 7:36107984-36108006 GCTCCTGGTGGTGGGATTCCTGG - Intergenic
1024462417 7:49672131-49672153 CCTCCTGGCGTATGACTTCCAGG - Intergenic
1030573786 7:111261003-111261025 ATTCATAGTGCTTGGCTTCCTGG - Intronic
1035645350 8:1214529-1214551 ACTCCTGGGATCTGACTTCCGGG - Intergenic
1042888686 8:73582619-73582641 AGTCCTGGTGTTTGCTTTCCTGG - Intronic
1048316954 8:133369730-133369752 ACTCCAGCTGTTGGGCTGCCTGG - Intergenic
1049334623 8:142076616-142076638 ACTTCTGGTTTCTGGCTGCCAGG - Intergenic
1049377198 8:142294963-142294985 ACTCCGGGTGTTGGGTATCCAGG - Intronic
1049909473 9:251530-251552 ACTTCTGGTATTTTCCTTCCCGG - Intronic
1051938570 9:22474549-22474571 ATTCCTGGTCTTGTGCTTCCAGG - Intergenic
1052008867 9:23382773-23382795 ACACATGGTGTTGGGCTTGCAGG + Intergenic
1052134951 9:24898067-24898089 TCTCCTGGAGTTGGGCTGCCTGG - Intergenic
1054968088 9:71052847-71052869 ACTCCTGTTCTTTGACTTTCAGG - Intronic
1055186664 9:73464721-73464743 ACAGGTGGTGTTTGGTTTCCTGG + Intergenic
1055272401 9:74575993-74576015 ACTCCTTTGGTTTGGCTTCGAGG - Intronic
1056136958 9:83639960-83639982 GCTCCTGCTGTGTGGCTGCCTGG + Intronic
1059929773 9:119249402-119249424 ACTCCTGATATTTGTCTCCCTGG - Intronic
1060268448 9:122125768-122125790 AGTCCTGGTCTGTGGCGTCCAGG + Intergenic
1061744298 9:132728303-132728325 ACTCCTGGGGTTGGGACTCCCGG + Intronic
1062338822 9:136084462-136084484 CCTCCTGGTGATTGGCGTCTTGG - Intronic
1062469485 9:136696311-136696333 AGTGTTGGTGTGTGGCTTCCTGG - Intergenic
1187460518 X:19482904-19482926 AAGTCTGGAGTTTGGCTTCCTGG + Intronic
1188382781 X:29517886-29517908 ACTTCTGCTGTTTGGTTTCTAGG + Intronic
1188722945 X:33544739-33544761 ACACCTGGTGTCTCGATTCCAGG + Intergenic
1189038437 X:37516815-37516837 ACTGCTGTTGGTTGGCTTCAAGG - Intronic
1189275855 X:39785609-39785631 AATCCTGGTGCATGGTTTCCAGG - Intergenic
1189282983 X:39832299-39832321 ACTCCTGCTGGTCTGCTTCCTGG + Intergenic
1190629624 X:52372551-52372573 GCTCCTGGAGATCGGCTTCCAGG - Exonic
1192279699 X:69671965-69671987 AGACCTGGTCTTTGGCTTCATGG - Intronic
1194417873 X:93636027-93636049 ACTCCTTAAGTTTTGCTTCCAGG + Intergenic
1194966320 X:100292740-100292762 AGTCCTAGTGTTTGCCTTCTTGG - Exonic
1196051900 X:111314436-111314458 CCTCCTCTTGTTTGTCTTCCAGG - Intronic
1196197761 X:112854062-112854084 ACTCCTGGCGTTAGTCTTCTTGG - Intergenic
1197001678 X:121447297-121447319 ACATCTATTGTTTGGCTTCCAGG + Intergenic
1198629267 X:138616807-138616829 ACACATGGTGTTGGGCTTGCAGG - Intergenic
1199087458 X:143644581-143644603 AATCCTGTAGTTTGGCTTTCTGG - Intergenic