ID: 1182569258

View in Genome Browser
Species Human (GRCh38)
Location 22:31224080-31224102
Sequence CTGCATACACAGAGCGCACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 129}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182569256_1182569258 -7 Left 1182569256 22:31224064-31224086 CCCAGAGAGAACAAAGCTGCATA 0: 1
1: 0
2: 1
3: 17
4: 239
Right 1182569258 22:31224080-31224102 CTGCATACACAGAGCGCACAAGG 0: 1
1: 0
2: 0
3: 12
4: 129
1182569257_1182569258 -8 Left 1182569257 22:31224065-31224087 CCAGAGAGAACAAAGCTGCATAC 0: 1
1: 0
2: 2
3: 23
4: 235
Right 1182569258 22:31224080-31224102 CTGCATACACAGAGCGCACAAGG 0: 1
1: 0
2: 0
3: 12
4: 129
1182569255_1182569258 13 Left 1182569255 22:31224044-31224066 CCTGTGGCAGTCTGTAGTTACCC 0: 1
1: 0
2: 0
3: 6
4: 67
Right 1182569258 22:31224080-31224102 CTGCATACACAGAGCGCACAAGG 0: 1
1: 0
2: 0
3: 12
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182569258 Original CRISPR CTGCATACACAGAGCGCACA AGG Intronic
902331718 1:15734180-15734202 GTGCATCCGCAGAGCCCACAGGG - Exonic
903677315 1:25072561-25072583 CTGCAGACACATGGCCCACATGG + Intergenic
905862011 1:41358140-41358162 CTGCATCCCCAGAGCCCACCTGG - Intergenic
909228686 1:73058738-73058760 CTGCAGAGACAGAGCCCTCAGGG - Intergenic
918993568 1:191729019-191729041 CTGGAGAGACAGAGCCCACATGG - Intergenic
920960283 1:210657388-210657410 CTGCAGTCACAGTGGGCACATGG + Intronic
922707761 1:227798530-227798552 CTGCCTACACGGACCCCACACGG - Intergenic
923026164 1:230205876-230205898 CTTCATACACAGAGAGGAAACGG + Intronic
1063490500 10:6459417-6459439 CTGCACATCCAGAGCACACATGG + Intronic
1064740507 10:18429264-18429286 CTGCATACAAAGAGCTGACATGG - Intronic
1067571873 10:47377783-47377805 CCACATTCACAGAGCACACAGGG + Intronic
1068322809 10:55441899-55441921 GGGCACACACAGAGAGCACAAGG + Intronic
1068449331 10:57165556-57165578 CTGCAAAGACAGAGCCCTCATGG - Intergenic
1074075373 10:110118851-110118873 CTGCATACCCAGAAAGCAAAAGG + Intronic
1075724366 10:124603972-124603994 CTGCCTGCAAAGAGCTCACATGG - Intronic
1075992760 10:126851855-126851877 CTGCATCCAATGAGCGAACACGG + Intergenic
1076559101 10:131349588-131349610 ATGCATATGCAGAGGGCACATGG - Intergenic
1077523116 11:3048002-3048024 CTGCAAAGACAGAGGGCACATGG + Intronic
1077817912 11:5705918-5705940 CAGCATACACAGTGAGTACATGG + Intronic
1078187798 11:9066968-9066990 CTGCATACACAGACACCACAGGG - Intronic
1078667988 11:13341872-13341894 CTGCATTCAAAGAGGGCACAGGG - Intronic
1080317011 11:30960779-30960801 ATGTATACACACAGCCCACAAGG + Intronic
1080422693 11:32125764-32125786 CTGCATCCTCAGAGGGCAAAAGG - Intergenic
1080442879 11:32311579-32311601 CAACACACACAGAGCTCACAAGG + Intergenic
1081386636 11:42480305-42480327 CTGCAGAAACAGAGCCCTCATGG + Intergenic
1082113176 11:48299247-48299269 CTGCCTACAGAGAGGGCAGATGG - Intergenic
1089169911 11:116504752-116504774 CTGCAGACACACAGCGCCCAGGG - Intergenic
1090488377 11:127135484-127135506 CTGCATACACAGACACCACAGGG + Intergenic
1092449590 12:8589569-8589591 CAGCATGCACAGAAAGCACATGG - Intergenic
1098756875 12:74375089-74375111 CTGCATCCACATATCGGACAAGG + Intergenic
1102861462 12:116339916-116339938 CTGCATACCCAAAGTGCAGATGG - Intergenic
1104542186 12:129676098-129676120 CTGCTCACACAGAGCTCAGAAGG + Intronic
1104947688 12:132423919-132423941 CTGGATCCACAGAGAGAACATGG + Intergenic
1106062687 13:26310222-26310244 ATGCACACACAGAGAGCAGATGG - Intronic
1107183148 13:37485506-37485528 TTGCACACACAGAACACACAAGG - Intergenic
1107640876 13:42441907-42441929 CTGTATACACACAGCCAACAAGG + Intergenic
1108167479 13:47708638-47708660 TTGCAGACACAGAGGGCACGAGG - Intergenic
1108190025 13:47928860-47928882 CTGCATATGCAGAAAGCACATGG + Intergenic
1110197024 13:72801488-72801510 ATGCATACACAGACCTTACATGG + Intronic
1112994141 13:105552078-105552100 TTGCACACACACAGCGCACACGG - Intergenic
1113682148 13:112252019-112252041 CTGCATACACTGAGAGCATTTGG + Intergenic
1113990180 14:16022686-16022708 GTGCATGCACACAGCACACATGG - Intergenic
1115380931 14:32738171-32738193 CTGCACACACACAGCTCAAAGGG - Intronic
1119645574 14:76346158-76346180 CCGCATTCACAGAGTGGACATGG + Intronic
1120847320 14:89138100-89138122 TTGCATACTCACAGGGCACAGGG + Intronic
1122239626 14:100354062-100354084 CAGCTAACACAGAGCACACAGGG - Intronic
1122942815 14:104990024-104990046 CACCACACACAGAGGGCACACGG - Intronic
1124160961 15:27269386-27269408 CAGCACACACAGAAAGCACAGGG - Intronic
1125259054 15:37801368-37801390 AGGCATACTCAGAGCCCACAGGG + Intergenic
1131131607 15:89903984-89904006 CTGCAGGCACAGAGCGCAGGAGG + Intronic
1131619772 15:94055266-94055288 CTGCATGTACAGAGATCACACGG - Intergenic
1131816688 15:96228580-96228602 CTCCATACACAAAGGGCACCTGG - Intergenic
1131952421 15:97694942-97694964 CTGCACACACAGAGAGTCCAGGG + Intergenic
1132565207 16:619249-619271 CTGCACACACACTGCACACATGG - Intronic
1132565227 16:619374-619396 CTGCACACACACTGCACACATGG - Intronic
1132943504 16:2519976-2519998 CCGCATACACAGAGCACTCTAGG - Exonic
1138333401 16:56233491-56233513 ATTCATACACAGAGAGGACACGG - Intronic
1143103097 17:4514758-4514780 CTGCATGCACACAGCCCAGAGGG - Intronic
1143843456 17:9753619-9753641 CTTCTTTCAGAGAGCGCACAGGG + Intergenic
1143848120 17:9788523-9788545 CTGCAGACACAGTGGGTACAAGG + Intronic
1144073994 17:11700760-11700782 CTTCATACTCAGAGTGGACAAGG + Intronic
1146130508 17:30269944-30269966 TTGAATACAGAGAGAGCACAGGG + Intronic
1155257112 18:24008415-24008437 CTGCATAAACAGAAGGCAAATGG - Intronic
1156459846 18:37315567-37315589 CTCCAGACACAGAGCAGACAAGG - Intronic
1156740280 18:40318324-40318346 CCACATGCACAGAGCACACAGGG + Intergenic
1164725050 19:30460660-30460682 CTGCACACACAGTGGCCACATGG - Intronic
1164831908 19:31329327-31329349 CTGCTTACACAGAATGCACAAGG - Intronic
1165062190 19:33210394-33210416 CTGCATCCACAGTGGGCACCAGG - Intronic
1166086927 19:40482451-40482473 CTGCATACACTGAGAGAACTGGG + Intronic
1167565092 19:50251011-50251033 CTGGATACACAGATCAAACATGG + Intronic
1167619821 19:50554520-50554542 CTGCATACTGAGAGGGCACCTGG + Intronic
925472338 2:4175799-4175821 TTGCATACACAGAGAGGACAGGG + Intergenic
930653548 2:53986208-53986230 CAGCATATGCAGAGAGCACATGG - Intronic
932948932 2:76270278-76270300 CAGCATGCACAGAGATCACATGG - Intergenic
934916530 2:98305004-98305026 CTGCTTCCACAGAGGCCACACGG + Intronic
935234381 2:101126136-101126158 TGGCATATACAGAGAGCACATGG + Intronic
937362541 2:121239069-121239091 CTGCAGACACACAGGCCACATGG - Intronic
1169698476 20:8418896-8418918 CTGCCTACACAGAGGGGAGAGGG + Intronic
1170204285 20:13781661-13781683 CTGGACACACAGAGCTCCCAGGG - Intronic
1173721007 20:45258074-45258096 CTGCACACATTAAGCGCACAGGG + Intergenic
1175770360 20:61619637-61619659 CTCCATTCTCAGAGAGCACAGGG + Intronic
1175810030 20:61852929-61852951 CTGCACCCGCAGAGCCCACAGGG - Intronic
1175885815 20:62290092-62290114 CTGCAAGCACAGAGCCCACCGGG - Intronic
1179633945 21:42695580-42695602 CTGCATGCACAGAGCTCAGCCGG - Intronic
1179997669 21:44981454-44981476 CTGCTCACACAGCACGCACAGGG - Intergenic
1180121538 21:45752684-45752706 CTGCAAACACAGAGATCACCTGG - Intronic
1180317091 22:11284840-11284862 GTGCATGCACACAGCACACATGG + Intergenic
1180723143 22:17924255-17924277 CTGCAGACACAGAGCTCTCCAGG - Intronic
1182569258 22:31224080-31224102 CTGCATACACAGAGCGCACAAGG + Intronic
1183413100 22:37666762-37666784 CTGAAAACACTGACCGCACAGGG - Exonic
1184020082 22:41814888-41814910 CTGCATGCACAGCGCCCACCTGG - Intronic
1184404268 22:44291385-44291407 CTGCAGCCACACAGCACACAGGG - Intronic
952407867 3:33020892-33020914 CTACATACACAGAGAGAAAAAGG + Intronic
953928965 3:46996578-46996600 CTGCATACCCAGGGTGCACAGGG - Exonic
954116369 3:48469004-48469026 CTGGACACACACAGCACACATGG + Exonic
954763352 3:52893559-52893581 CTGTTCACACAGAGCACACAGGG + Intronic
957374321 3:79336586-79336608 CTGCATGGACAGAGCCCTCATGG + Intronic
958445970 3:94215561-94215583 TGGCATACCCAGAGAGCACATGG + Intergenic
958490635 3:94767282-94767304 CTGCATACTCAGCAAGCACATGG + Intergenic
972322770 4:37988000-37988022 CAGCAAACACAGAGCACACTGGG - Intronic
977941329 4:102862934-102862956 CTGCTTACACTGAGGGCAGAAGG + Intronic
979096183 4:116553787-116553809 CAGCATATACAGAGCCCAGAGGG - Intergenic
984608983 4:181817091-181817113 CTGCATCCAGAGAGTACACAGGG + Intergenic
985596458 5:793069-793091 AAGCAAACACAGAGCCCACAGGG - Intergenic
986561781 5:9067381-9067403 CTGCAGACACAGAGCCCAACAGG + Intronic
987463672 5:18246700-18246722 ATGAATACACAGAGCACAGAGGG - Intergenic
988386594 5:30573842-30573864 CTGCAGACACGGAGCCCTCATGG + Intergenic
995751316 5:115455991-115456013 CTGAATACACAGAGAGGAAAGGG - Intergenic
999424489 5:151475518-151475540 CTGCATGAACACAGAGCACACGG - Intronic
999666619 5:153919409-153919431 CTGCATTCAGAGAACTCACATGG - Intergenic
1002661698 5:180795576-180795598 CTGCACACATAGAGAGCAAATGG + Intronic
1003544291 6:7045414-7045436 CTCCATGCACAGATGGCACAGGG - Intergenic
1004248717 6:14004515-14004537 ATGCAGACACAGAGAGCAAAGGG - Intergenic
1004840496 6:19578500-19578522 ATGCACACACAGACCACACATGG + Intergenic
1012823416 6:104118163-104118185 CTGCATACACATATCTCATATGG - Intergenic
1017650176 6:156573646-156573668 TTGCATGCACAGAACGCACAAGG + Intergenic
1024053683 7:45646126-45646148 CTGAATGCACAGAGCACACCAGG + Intronic
1028927846 7:96379573-96379595 GTGCACACACAGAGCACTCAAGG - Intergenic
1030224983 7:107140249-107140271 CTGCATCCACTGAGCTCACTAGG - Intronic
1030666973 7:112289325-112289347 CAACATACACAGAAGGCACATGG - Intronic
1035203653 7:157281361-157281383 CTGCAGAGACAGAGGGCAGATGG + Intergenic
1035684398 8:1512902-1512924 GTGCACACACAGATGGCACAGGG - Intronic
1035872648 8:3152804-3152826 CTGCATGGACAAAGTGCACATGG - Intronic
1046299579 8:112269570-112269592 CATCATACACAGAGTGCATATGG - Intronic
1047763010 8:127968099-127968121 CTCCATACACAGATTGCATAGGG + Intergenic
1048579178 8:135716789-135716811 CTGCAGACACACAGTGAACAAGG - Intergenic
1049777681 8:144414064-144414086 CTGCATACACACAGCGAAGAGGG - Exonic
1050361812 9:4837616-4837638 CTGCACACCCAGAGAGAACAAGG - Intronic
1054948968 9:70827583-70827605 CTGCATACACATACCCCAGATGG + Intronic
1058551117 9:106116047-106116069 CCACATACACAGAGCTCACCAGG - Intergenic
1059882848 9:118710848-118710870 CTGCATACATAGAAGGCAGATGG + Intergenic
1062570778 9:137184205-137184227 ATGCAGACACAGAGCCGACATGG + Intronic
1062570788 9:137184249-137184271 ATGCAGACACAGAGCAGACACGG + Intronic
1186860783 X:13670461-13670483 CTGCTTTCACACAGCTCACAGGG + Intronic
1189087294 X:38039043-38039065 CTCCATACCCAGAAGGCACATGG + Intronic
1190499200 X:51058373-51058395 CTGCATGCTCAGAGGGCCCAAGG + Intergenic
1190537016 X:51439342-51439364 CAGCATATACAGAGATCACATGG + Intergenic
1195814508 X:108870148-108870170 CTGCTTCCACAGAGACCACAAGG + Intergenic
1196173658 X:112617050-112617072 CTGCATAGACAGAGCCTTCATGG + Intergenic
1198171046 X:134105525-134105547 CTGCATATGCAGAGATCACATGG + Intergenic
1199821516 X:151453730-151453752 CTGCAAACCCTGAGAGCACAGGG - Intergenic
1201978646 Y:19882144-19882166 CTGCAAAAACAGAGCTCACTTGG - Intergenic