ID: 1182573767

View in Genome Browser
Species Human (GRCh38)
Location 22:31259080-31259102
Sequence AAGGGTGTACAAAGGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 518
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 490}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182573767_1182573779 4 Left 1182573767 22:31259080-31259102 CCTTCCTCCCTTTGTACACCCTT 0: 1
1: 0
2: 1
3: 26
4: 490
Right 1182573779 22:31259107-31259129 CCACCTGCTCACAGGTGGCTGGG 0: 1
1: 0
2: 2
3: 21
4: 220
1182573767_1182573774 -1 Left 1182573767 22:31259080-31259102 CCTTCCTCCCTTTGTACACCCTT 0: 1
1: 0
2: 1
3: 26
4: 490
Right 1182573774 22:31259102-31259124 TCTCCCCACCTGCTCACAGGTGG 0: 1
1: 0
2: 2
3: 20
4: 237
1182573767_1182573777 3 Left 1182573767 22:31259080-31259102 CCTTCCTCCCTTTGTACACCCTT 0: 1
1: 0
2: 1
3: 26
4: 490
Right 1182573777 22:31259106-31259128 CCCACCTGCTCACAGGTGGCTGG 0: 1
1: 0
2: 3
3: 40
4: 289
1182573767_1182573780 5 Left 1182573767 22:31259080-31259102 CCTTCCTCCCTTTGTACACCCTT 0: 1
1: 0
2: 1
3: 26
4: 490
Right 1182573780 22:31259108-31259130 CACCTGCTCACAGGTGGCTGGGG 0: 1
1: 0
2: 1
3: 28
4: 495
1182573767_1182573773 -4 Left 1182573767 22:31259080-31259102 CCTTCCTCCCTTTGTACACCCTT 0: 1
1: 0
2: 1
3: 26
4: 490
Right 1182573773 22:31259099-31259121 CCTTCTCCCCACCTGCTCACAGG 0: 1
1: 0
2: 6
3: 54
4: 477

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182573767 Original CRISPR AAGGGTGTACAAAGGGAGGA AGG (reversed) Intronic
901001297 1:6150140-6150162 ATGGGTGGACAAATGGATGATGG + Intronic
901560443 1:10066088-10066110 AGGGAGGTACAAAGGGAGGGAGG - Intronic
901920074 1:12529709-12529731 AAGGGTGGACCCAGGAAGGATGG - Intergenic
902210234 1:14899702-14899724 AGTGGTGGACAGAGGGAGGAGGG - Intronic
902380255 1:16049306-16049328 AGGGGTGTACACAGGGGAGAAGG - Intronic
902786876 1:18738571-18738593 AAGGGAGTGGAAAGAGAGGATGG - Intronic
903172124 1:21560855-21560877 AAGGGTGTTTAAAAGGATGAGGG + Intronic
904614769 1:31743745-31743767 GGGGGTGTCCAAAGGAAGGAGGG + Intronic
904933644 1:34110743-34110765 GAGGGTGGAGAACGGGAGGAGGG + Intronic
905258381 1:36700355-36700377 AAGGAAGTAAAAAGGAAGGAGGG - Intergenic
906835342 1:49077813-49077835 AAAGATGACCAAAGGGAGGAGGG + Intronic
907486022 1:54778696-54778718 AAGGGTGGACAAAGGCACCAAGG + Intergenic
909156402 1:72083301-72083323 AAGGGAGGAGAGAGGGAGGATGG - Intronic
910612576 1:89160926-89160948 GAGGGTGGATAATGGGAGGAGGG - Intronic
910813325 1:91260366-91260388 GAGGGTGGACAGTGGGAGGAGGG + Intergenic
911429214 1:97762005-97762027 GAGGGTGGACAGTGGGAGGAGGG + Intronic
911450420 1:98054217-98054239 AAGGGAGGACCAGGGGAGGAGGG - Intergenic
911519271 1:98909103-98909125 AAGGAGGGACAGAGGGAGGAAGG + Intronic
912418612 1:109528782-109528804 AGAGGTGTACAAAGGGCAGAAGG - Intergenic
912430039 1:109624153-109624175 AAAGCTGGACAAAGGGAAGAGGG - Intronic
913457771 1:119051174-119051196 AAGGGTGTCGAATGGGAGGAGGG - Intronic
913481313 1:119291971-119291993 AAGGAAGAACAAAGGAAGGAAGG - Intergenic
915615336 1:157033461-157033483 AAGGGTGGAGAGAGGGAAGATGG - Intronic
915626843 1:157119023-157119045 AAGGATGGGCAAAGGGATGAGGG - Intergenic
915779655 1:158532662-158532684 AAGGGTGCAGAAGGGGAAGAGGG - Intergenic
915966398 1:160312494-160312516 AAGGGTTTTCTAAGGGATGATGG - Intronic
915978795 1:160407726-160407748 GAGGGTGGACAATGGGAGGTGGG - Intronic
917451547 1:175151479-175151501 AATGGTGGAGAAGGGGAGGAGGG + Intergenic
919613555 1:199776937-199776959 AAGGGGGAAGGAAGGGAGGAAGG - Intergenic
920611749 1:207446843-207446865 AGGGGAGTATAAAGGGAGGATGG - Intergenic
921262591 1:213396966-213396988 AAGCCTCTACAAAGAGAGGAAGG - Intergenic
921433425 1:215089047-215089069 TAGTGTGTAAACAGGGAGGAAGG + Intronic
921599110 1:217088755-217088777 AAGGGAAAAGAAAGGGAGGAGGG + Intronic
923015932 1:230126708-230126730 AAAGTTGTACAAAGGGATGGTGG + Intronic
923413286 1:233730984-233731006 AAGGGTGCCCAAAGGCAGGCTGG - Intergenic
923706173 1:236346616-236346638 AAGTGTGTGCAAAGAGAGGTGGG - Intergenic
924005122 1:239600676-239600698 AAGGGAGAAGAAAGGAAGGAAGG - Intronic
924171056 1:241341572-241341594 AAGGAAGTAAAAAGGAAGGAAGG + Intronic
924510468 1:244725562-244725584 AAGAGTTTTCAAAGGAAGGAAGG + Intergenic
1063915118 10:10873819-10873841 AAGGCTGGACAAAGGGGTGAAGG - Intergenic
1065173112 10:23051515-23051537 AAGGGTTTTCAAAGGCAGAAAGG - Intergenic
1065757071 10:28940593-28940615 CAGTGAGTACAAAGGGAGCAAGG + Intergenic
1066502427 10:36007089-36007111 GAGGGTGGGGAAAGGGAGGAGGG - Intergenic
1066522702 10:36240276-36240298 AAGGGTGGAGGATGGGAGGAAGG - Intergenic
1067280647 10:44869490-44869512 AAGGAGGTAGAAAGGGAGGAAGG + Intergenic
1067517408 10:46963580-46963602 ATGTGTGTACAGAGGGATGAGGG + Intronic
1067678705 10:48411830-48411852 GAGGGTGGAGAAAGGAAGGAAGG - Intronic
1067853477 10:49769877-49769899 AAGGGAGGAAAAAGAGAGGAAGG + Intergenic
1068417095 10:56737518-56737540 AAGGGTGTTTTAAGGCAGGATGG + Intergenic
1068850354 10:61731749-61731771 GAGGGAGGACAGAGGGAGGAAGG + Intronic
1068948662 10:62755351-62755373 AAGGAGGAAGAAAGGGAGGAGGG + Intergenic
1069047885 10:63762200-63762222 AAGGGTGGCCACAGGGAAGAGGG + Intergenic
1069157284 10:65046796-65046818 AAGTGTGTAGAGTGGGAGGAGGG + Intergenic
1069388905 10:67911708-67911730 AAGGATGGACGAAGGAAGGAAGG - Intronic
1070758525 10:79008646-79008668 AGGGGTGGTGAAAGGGAGGAGGG + Intergenic
1072284001 10:93895207-93895229 GAAAGTGCACAAAGGGAGGAGGG - Intronic
1072815784 10:98507739-98507761 AAGGAGGAACAAAGGGAGGAAGG - Intronic
1073251227 10:102121246-102121268 AAGGCTGGAGAAAGGGGGGAAGG - Intergenic
1073657585 10:105434165-105434187 CAGGGAGTACAAAGAGATGAGGG - Intergenic
1074708076 10:116153314-116153336 AAAGATGTATAAAGGGAGGAAGG - Intronic
1075164812 10:120058154-120058176 AAGGGTGGAGGATGGGAGGAAGG + Intergenic
1075940277 10:126385727-126385749 TAGGGTGAGCAAAGGGAGAATGG + Intronic
1076558721 10:131347062-131347084 AAGGAAGAAGAAAGGGAGGAAGG - Intergenic
1076667676 10:132102402-132102424 CATGGGGTACAGAGGGAGGAAGG - Intergenic
1077498723 11:2899248-2899270 AAGGGTGTACAGTGGGGTGACGG - Intronic
1077733845 11:4766720-4766742 AAGGATGAAAAAAGGAAGGAAGG - Intronic
1077760567 11:5091863-5091885 GAGGGCGGACAAAGGGAGGTTGG + Intergenic
1077964603 11:7115313-7115335 AACAGAGTACAAAGGGTGGATGG + Intergenic
1078123595 11:8536095-8536117 AAGGGTGAACGTGGGGAGGAGGG + Intronic
1078687875 11:13549792-13549814 AAGAGTTTACAAGGGGAGTAGGG + Intergenic
1079339866 11:19602952-19602974 AAAGATGGAGAAAGGGAGGAAGG + Intronic
1080864181 11:36178800-36178822 ATGGATGTTCAAAGGCAGGAGGG - Intronic
1082703868 11:56468268-56468290 AAGGGTGGAGATTGGGAGGAGGG + Intergenic
1084021062 11:66418592-66418614 AAGGGTCTAGAAAGGGACAAGGG - Intergenic
1084131807 11:67141794-67141816 AGGGGTGCATAAAGAGAGGATGG - Intronic
1085235659 11:75013342-75013364 AATGGAGATCAAAGGGAGGATGG - Intronic
1085849515 11:80103424-80103446 AAGGGGGAAAAAAGGAAGGAGGG - Intergenic
1086847422 11:91768689-91768711 AGGGATGGAAAAAGGGAGGAAGG + Intergenic
1087182866 11:95156824-95156846 AGGGGTGTACCAAGGAAGGGTGG - Intergenic
1088059888 11:105634427-105634449 AAGGGAGGAGAAAGGAAGGAAGG + Intronic
1090020651 11:123125488-123125510 AAGGGAGGAAGAAGGGAGGAAGG - Intronic
1090716509 11:129436616-129436638 AAGGAGGTACAGATGGAGGAAGG - Intronic
1091142804 11:133250481-133250503 AAGAATGAAGAAAGGGAGGAAGG + Intronic
1091842012 12:3628118-3628140 AAGGGTGAAGGAAGGGAGGGAGG - Intronic
1091919199 12:4290677-4290699 AACGGGGGACAAAGGGAGGTGGG - Intronic
1093491203 12:19706733-19706755 GAGGGTGAAAAATGGGAGGAGGG + Intronic
1093802247 12:23388510-23388532 GAGGGTGGAGAAAGGGAGGAGGG + Intergenic
1095572257 12:43696680-43696702 AAGTGTGTGCAAAAGGAGGGTGG - Intergenic
1096402511 12:51318992-51319014 AAGGGTGGAGCCAGGGAGGATGG - Intronic
1096421885 12:51465741-51465763 AAGGGGCTACAATGGGAGGAAGG - Intronic
1096815793 12:54200993-54201015 AAGGCTGAACAAAGGGAAGTTGG - Intergenic
1097326531 12:58283651-58283673 AAGAGTGGACACAGGGAGGCTGG - Intergenic
1099252854 12:80279435-80279457 AAGGGTGAAGGATGGGAGGAGGG - Intronic
1099664557 12:85611192-85611214 AAGGGTGGACTACAGGAGGAGGG - Intergenic
1099686444 12:85895522-85895544 AAGGGTGGAAGATGGGAGGAGGG - Intergenic
1099723066 12:86389186-86389208 GAGGGTGCAGAATGGGAGGACGG - Intronic
1101383276 12:104232997-104233019 AATGGAGAACAAAGGAAGGAAGG + Intronic
1101638305 12:106565878-106565900 AAGGGGGTAGGGAGGGAGGAAGG + Intronic
1102575242 12:113852069-113852091 AATGCTGTTAAAAGGGAGGAAGG + Intronic
1102946020 12:116988848-116988870 ATGGGTGTACGAAGGAAGCAAGG + Exonic
1103199162 12:119072429-119072451 AAGGATGAAGAAAGGGAGCAGGG + Intronic
1103729106 12:123014122-123014144 AGGGGTGTGGAAAGGGAGGAGGG + Intronic
1104338290 12:127922118-127922140 AAGGGTGAAGGATGGGAGGAGGG - Intergenic
1105643706 13:22293695-22293717 AAGGGTGGAGGATGGGAGGAGGG - Intergenic
1105737059 13:23282473-23282495 AAGGGTGGAGGATGGGAGGAGGG - Intronic
1105764992 13:23550404-23550426 AAAGGTGTTAACAGGGAGGAAGG + Intergenic
1106627983 13:31440850-31440872 CAGAGAGTACAAAGGGAGGGGGG - Intergenic
1107015806 13:35706869-35706891 AAGGGAGGAGAAAGAGAGGAAGG + Intergenic
1108530903 13:51326145-51326167 GAGGGTGCATAAAGGCAGGAGGG - Intergenic
1109527948 13:63600924-63600946 GAGAGTGAAGAAAGGGAGGAGGG - Intergenic
1109554630 13:63955820-63955842 AAGGGAGAGCAAAGGGAGTATGG - Intergenic
1109642862 13:65213098-65213120 AAGGATGGAAAGAGGGAGGAAGG + Intergenic
1109986143 13:69988106-69988128 GAGGGTGTAGGATGGGAGGAAGG - Intronic
1110228403 13:73143600-73143622 ATGGGTGAACAAGAGGAGGAAGG - Intergenic
1110659419 13:78041909-78041931 AAGGGTGCAGAATAGGAGGAAGG - Intergenic
1113397109 13:109958133-109958155 GAGGGTGGAGAGAGGGAGGAAGG - Intergenic
1113983063 13:114292770-114292792 GAGGGTGGAGAATGGGAGGAGGG - Intronic
1114582429 14:23774586-23774608 AGGTGTGCACAAAGGCAGGAAGG + Intergenic
1114859953 14:26504885-26504907 ATGTGTGTACAAAGGGAAAAGGG + Intronic
1114965943 14:27959300-27959322 AAGGGGGGAAAAAGGAAGGAAGG + Intergenic
1116177074 14:41484818-41484840 ACAGGTGTCAAAAGGGAGGAAGG - Intergenic
1116558690 14:46347590-46347612 GAGGGTGGAGAGAGGGAGGAGGG + Intergenic
1116635507 14:47389727-47389749 CAGGGTGAAAAAAGGGGGGAGGG + Intronic
1116659610 14:47692206-47692228 AAGAGGGAAGAAAGGGAGGAAGG - Intergenic
1116844753 14:49854865-49854887 GAGGGTGGAGAATGGGAGGAGGG + Intergenic
1116918473 14:50548278-50548300 TAGGGTGTACAATGGGCTGAGGG - Intronic
1117590955 14:57268369-57268391 CCGGGTGTCCCAAGGGAGGAGGG - Intronic
1117863427 14:60118516-60118538 AAGGGTGAAAAGAGGGAGTAAGG - Exonic
1118426196 14:65665930-65665952 GAGGGTGGACAATGGGAGGAGGG + Intronic
1118665915 14:68069428-68069450 AAGGGTGGAGAGTGGGAGGATGG - Intronic
1120287125 14:82518104-82518126 AAGGATGAAGAAAGGAAGGAAGG + Intergenic
1120336101 14:83157065-83157087 AAGGGTGAAGAGTGGGAGGAGGG + Intergenic
1120506816 14:85362983-85363005 AAGGGAGCACAAAGGAAAGAGGG + Intergenic
1120689849 14:87580409-87580431 AAGGATGGACATCGGGAGGATGG + Intergenic
1120910492 14:89662288-89662310 GATGGTGTACAAAGGTAGGGGGG + Intergenic
1121489834 14:94349841-94349863 AAGGAAGGAAAAAGGGAGGAAGG - Intergenic
1122266079 14:100547504-100547526 AAAGCTGTGCAAAGGCAGGAGGG + Intronic
1122315950 14:100826244-100826266 AAGGATGTGCAAAAGGAAGACGG + Intergenic
1122650044 14:103221154-103221176 AAGGGTGTACAGCTGGACGATGG + Intergenic
1122704456 14:103611419-103611441 AAGGGGGTAAAAATGGAAGATGG + Intronic
1123470490 15:20548366-20548388 AAGGAAGAAGAAAGGGAGGAAGG + Intergenic
1123647569 15:22452334-22452356 AAGGAAGAAGAAAGGGAGGAAGG - Intergenic
1123730789 15:23143344-23143366 AAGGAAGAAGAAAGGGAGGAAGG + Intergenic
1123748928 15:23340770-23340792 AAGGAAGAAGAAAGGGAGGAAGG + Intergenic
1123894596 15:24816028-24816050 AAGAGTATAAAAAGGGAGAAAGG - Intergenic
1124281300 15:28364653-28364675 AAGGAAGAAGAAAGGGAGGAAGG + Intergenic
1124301402 15:28546968-28546990 AAGGAAGAAGAAAGGGAGGAAGG - Intergenic
1125040582 15:35181407-35181429 AATAGTGAACACAGGGAGGATGG - Intergenic
1125173225 15:36790991-36791013 GAGGGTGGACAGTGGGAGGAGGG - Intronic
1125187611 15:36949757-36949779 AGCCGTGTACAAAGGGTGGATGG + Intronic
1126216885 15:46165706-46165728 GAGGATGGACAAAGGGAAGATGG + Intergenic
1126436903 15:48645868-48645890 AGGGGAGTGGAAAGGGAGGATGG - Intergenic
1127469341 15:59276401-59276423 CACACTGTACAAAGGGAGGAGGG + Intronic
1127582777 15:60352803-60352825 AAATGTGCCCAAAGGGAGGAGGG - Intronic
1127788652 15:62378767-62378789 AAGGAAGGACAAAGGAAGGAAGG + Intergenic
1128103778 15:65028489-65028511 AAGGGTGTGCAAAGGGAACATGG + Intronic
1128204357 15:65837674-65837696 AGGGGTGCCTAAAGGGAGGAAGG - Intronic
1128793679 15:70450087-70450109 ATGGGTGGACAGAGGGATGAGGG + Intergenic
1129485942 15:75872040-75872062 AAAGGTGCACACAGGGAGAAGGG + Intronic
1129681796 15:77662342-77662364 AAGGGCGGTCAGAGGGAGGAAGG + Intronic
1130059194 15:80557453-80557475 GAGGGTGGACAGTGGGAGGAGGG + Intronic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1130265920 15:82403062-82403084 AAAGGTGCACACAGGGAGAAGGG + Intergenic
1130372747 15:83299975-83299997 AAGGGTGAACATCAGGAGGAAGG + Intergenic
1130474621 15:84253525-84253547 AAAGGTGTAAAAAGGAAGGGAGG - Intergenic
1130482037 15:84367579-84367601 AAAGGTGTAAAAAGGAAGGGAGG - Intergenic
1130506101 15:84543823-84543845 AAAGGTGCACACAGGGAGAAGGG - Intergenic
1130507999 15:84564487-84564509 AAAGGTGTAAAAAGGAAGGGAGG + Intergenic
1130586114 15:85184245-85184267 AAAGGTGTAAAAAGGAAGGGAGG - Intergenic
1130924654 15:88375871-88375893 AGGATTGTAGAAAGGGAGGAAGG - Intergenic
1131303677 15:91222168-91222190 AAGGGGTTCCAAAGGAAGGAGGG - Intronic
1131449285 15:92525860-92525882 AAGGGGGAAGGAAGGGAGGAAGG - Intergenic
1131857749 15:96616798-96616820 AAGAGTTTGGAAAGGGAGGAAGG - Intergenic
1132010737 15:98274048-98274070 AAGGGGGAAGAAAGGGAGGTGGG - Intergenic
1132307016 15:100823143-100823165 AAGGGAGGAGAAAGGGAGTAGGG - Intergenic
1132462572 16:62715-62737 CAGGGTGGACACAGGCAGGAAGG + Intronic
1132754948 16:1479303-1479325 AAGGGTGGAGGACGGGAGGAGGG + Intergenic
1132997912 16:2832896-2832918 AAGTGGAGACAAAGGGAGGAGGG + Intronic
1133658965 16:7896254-7896276 GAGGGTGGAGAATGGGAGGAGGG - Intergenic
1135179373 16:20259547-20259569 CAGGGGGTAAAAAGGGAGGGAGG + Intergenic
1135632625 16:24047962-24047984 AAGGGTGAGGGAAGGGAGGAGGG + Intronic
1137438268 16:48476185-48476207 GAGGATGTAGAACGGGAGGAGGG + Intergenic
1137977316 16:53042514-53042536 AAAGATGAAGAAAGGGAGGAGGG - Intergenic
1138010158 16:53371992-53372014 AAGGAAGAAGAAAGGGAGGAAGG + Intergenic
1138265727 16:55658071-55658093 AAGGGAGGTCAGAGGGAGGAAGG + Intronic
1138653127 16:58473139-58473161 AAGGGAAGAGAAAGGGAGGAAGG - Intronic
1139320451 16:66109812-66109834 AAGGGGGAAGGAAGGGAGGAGGG + Intergenic
1139332661 16:66205557-66205579 GAGGGGGAACAAAGGGAGGGAGG + Intergenic
1140018678 16:71215247-71215269 AAGGAGGAAGAAAGGGAGGAAGG + Intronic
1140862176 16:79027432-79027454 CAGGGTGTAAAATGGGAGGCAGG - Intronic
1144163905 17:12588923-12588945 AAGGGTGGAGGAAGGGAGGAGGG + Intergenic
1144365637 17:14541859-14541881 AAGGGAGGGAAAAGGGAGGAAGG - Intergenic
1147007312 17:37413942-37413964 GAGGGTGAACAGTGGGAGGAGGG - Intronic
1147167621 17:38601868-38601890 AGGGGTGGTCAGAGGGAGGAAGG + Intronic
1147755212 17:42762910-42762932 AAGGGAGTAGGAGGGGAGGAGGG - Exonic
1148326464 17:46786101-46786123 AAGCCTGGAAAAAGGGAGGAGGG + Intronic
1148531426 17:48396816-48396838 AAAGATGTACTAAGGGAGAAAGG + Intronic
1148579640 17:48734680-48734702 GAGGGAGGAGAAAGGGAGGAAGG + Intergenic
1148713638 17:49700009-49700031 GAGGGTGGAGAAAGGAAGGAAGG + Intergenic
1148979043 17:51555285-51555307 AAGAATGTAGAAAGGGAGAAAGG - Intergenic
1149810891 17:59670434-59670456 AAGGGTGGAGGATGGGAGGAGGG - Intronic
1151327651 17:73388905-73388927 AAGGGGGGAAAAAGGGAGGGAGG - Intronic
1152395723 17:80031633-80031655 AAGGGTGCACAAATGGCAGATGG - Intronic
1152467582 17:80474805-80474827 AAGGTTGTAAAAGGGGAGGGGGG - Intronic
1152978209 18:245304-245326 AAGGATGTACACAGAGAGGGAGG - Intronic
1153137084 18:1929420-1929442 AAAACTGTACAAAAGGAGGAAGG + Intergenic
1153414504 18:4831907-4831929 AAGGGTGTGCAATGGGACAAGGG - Intergenic
1155823839 18:30413495-30413517 GAGGGAGGAGAAAGGGAGGATGG + Intergenic
1157392926 18:47317873-47317895 AAGGGGGAAGGAAGGGAGGAAGG - Intergenic
1157609824 18:48949463-48949485 AAGGGGGTGCAGAGGGAGGTGGG - Intronic
1158281664 18:55834780-55834802 GAGGGTGGAGAATGGGAGGAGGG + Intergenic
1159237133 18:65691076-65691098 AAGGGGGAACAAAGAGAGAATGG + Intergenic
1159325969 18:66918312-66918334 GAAGGTGAAGAAAGGGAGGAAGG - Intergenic
1160758788 19:772121-772143 AAGGGGGGAGACAGGGAGGAGGG - Intergenic
1163007969 19:14408187-14408209 AGTGGTGGACGAAGGGAGGATGG - Exonic
1163383608 19:16985546-16985568 ATGGGTGGAGAAAGGAAGGAAGG + Intronic
1164455611 19:28404134-28404156 CAGGGTGTACATGGGGAGGCTGG + Intergenic
1164703489 19:30302911-30302933 CAGGGGGTAAAAAGGGATGAAGG - Intronic
1164818745 19:31227562-31227584 AAGGGGGAAGAAAGAGAGGATGG + Intergenic
1164849319 19:31468388-31468410 AAGGGAGCAGGAAGGGAGGAGGG + Intergenic
1165096496 19:33412589-33412611 AAGTCTGTCCAAAGGGGGGAAGG + Intronic
1165257565 19:34588950-34588972 TGGGGTGTACAGAGGGAGGGTGG + Intergenic
1166318373 19:42001635-42001657 AAGGCTCAACAAAGGGTGGAGGG - Intronic
925363491 2:3295588-3295610 GAGGGTGTGCAGAGAGAGGAGGG - Intronic
925363510 2:3295688-3295710 GAGGGTGTGCAGAGAGAGGAGGG - Intronic
925991850 2:9260644-9260666 AAGGGAGAAGAAAGGCAGGAAGG - Intronic
926044763 2:9702497-9702519 CAATGTGTACAAAGGCAGGAAGG - Intergenic
928498707 2:31863415-31863437 AAGGGAGGGGAAAGGGAGGAAGG + Intergenic
929137531 2:38638848-38638870 ATGGGGGTACAAAGGAGGGAGGG + Intergenic
929255311 2:39804516-39804538 GAGGGTGGAGAATGGGAGGAGGG - Intergenic
929591536 2:43150671-43150693 AGGGGTGCACAGAGGGAGGAAGG - Intergenic
930325615 2:49913659-49913681 AAGGGTGTAAAGAGGTAAGAGGG + Intergenic
931360694 2:61575327-61575349 AAGGGACTCCAAAGGGAGAAAGG - Intergenic
933101577 2:78265644-78265666 AAGGGTGGAGAGTGGGAGGAGGG + Intergenic
933280412 2:80326884-80326906 AAGTGTGTAAAAGGGAAGGAGGG - Intronic
933319489 2:80755926-80755948 AAGGGTGGAGTGAGGGAGGAGGG - Intergenic
933628830 2:84633427-84633449 AAGGGAGAACAGAGAGAGGAAGG + Intronic
934138590 2:89022044-89022066 GAGGGGAGACAAAGGGAGGAAGG - Intergenic
934230655 2:90178519-90178541 GAGGGGAGACAAAGGGAGGAAGG + Intergenic
935172962 2:100624984-100625006 GACGGGGTACAAAGGGATGAAGG - Intergenic
935688468 2:105708735-105708757 AATGGAGTACAAGGGGAGAATGG + Intergenic
935787145 2:106559572-106559594 ACGGATGAACGAAGGGAGGAAGG - Intergenic
937501582 2:122484859-122484881 AACGGTACAGAAAGGGAGGAAGG - Intergenic
939175119 2:138739489-138739511 GAGGGTGTAGAACAGGAGGAAGG + Intronic
939988815 2:148858389-148858411 GAGGGTGGAGAATGGGAGGAAGG + Intergenic
940835774 2:158519869-158519891 AAGGGTATACAAAGATAGGATGG - Intronic
941682945 2:168418588-168418610 AAGGGTGTGGAAAGTGGGGAGGG + Intergenic
941753084 2:169154146-169154168 CAAGGTGTACAATGGTAGGAAGG + Intronic
942189233 2:173454648-173454670 AGGGGTGTAGAAATGGCGGAGGG - Intergenic
943180954 2:184540384-184540406 AGGGATGGAAAAAGGGAGGAAGG + Intergenic
943997179 2:194784720-194784742 AAGGAGAGACAAAGGGAGGAAGG + Intergenic
945135448 2:206622769-206622791 GAGGTTGTAGAAAGGTAGGAAGG - Intergenic
945529355 2:210931277-210931299 AAGCTTATACACAGGGAGGAGGG - Intergenic
945547381 2:211173322-211173344 CAGGGAGTACAAAGTGAAGAGGG - Intergenic
945942668 2:215965470-215965492 CAGGGGATACAGAGGGAGGAAGG + Intronic
946170610 2:217893128-217893150 AAGGGAGAACATAAGGAGGAAGG + Intronic
946836036 2:223773597-223773619 AAGGGGGAAAAAAGGGAGGGAGG + Intronic
946928478 2:224648927-224648949 AAAGGTGTACAAGTGAAGGAAGG + Intergenic
947273945 2:228370485-228370507 TAGGGTGTACCATGGGTGGAGGG - Intergenic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
947683864 2:232062946-232062968 AAGGGGGTACAAATGTGGGAAGG - Intronic
948367399 2:237466035-237466057 AAGGGTGTTCAAAGGCAGTTTGG - Intergenic
1170357372 20:15507339-15507361 AAGGAAGGAAAAAGGGAGGAGGG - Intronic
1170621160 20:17997455-17997477 ATGGCTGAACAAAGGGAGGAAGG - Intronic
1171943967 20:31359286-31359308 AAGGCAGAACAAAGGGAAGAAGG + Intergenic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1172778492 20:37422037-37422059 AAGGGTGGAGAAGAGGAGGAAGG - Intergenic
1173336730 20:42118201-42118223 GAGGGTGTAAAAAGGGATGAAGG + Intronic
1173541662 20:43857268-43857290 AAAGGGGGAAAAAGGGAGGAAGG + Intergenic
1174256695 20:49261550-49261572 AAGGGTGGAGGATGGGAGGAGGG + Intronic
1174708249 20:52678822-52678844 AAGGACCTAAAAAGGGAGGAGGG - Intergenic
1176033099 20:63023319-63023341 AAGGGTGTGAAGAGGGAAGAGGG - Intergenic
1176666875 21:9695901-9695923 GTGGGTGTGCAATGGGAGGAAGG + Intergenic
1178142277 21:29698072-29698094 AAAGAAGTAAAAAGGGAGGAAGG - Intronic
1179255906 21:39715018-39715040 AAGGGAGAAAAAAGGAAGGAAGG - Intergenic
1179372749 21:40821861-40821883 AAGGGTGGAAAGTGGGAGGAGGG + Intronic
1179874838 21:44262358-44262380 AAGGGTGAAGAAAGGGATGAGGG + Intergenic
1180036881 21:45254688-45254710 AAGGGTGAACAGAGGCAGGCAGG + Intergenic
1180104262 21:45607597-45607619 AAGGGAGGTGAAAGGGAGGAGGG + Intergenic
1180104272 21:45607627-45607649 AATGGAGGAGAAAGGGAGGAGGG + Intergenic
1180681912 22:17633952-17633974 GGTGGTGTGCAAAGGGAGGAGGG - Intronic
1180875742 22:19174529-19174551 TTGGGGGTACAAAGGGAGCACGG - Intergenic
1181484736 22:23223601-23223623 CAGGGGGTACTCAGGGAGGAGGG + Intronic
1181662855 22:24365971-24365993 AAGGTTGTAGACAGGGAGGGTGG + Intronic
1182439962 22:30357312-30357334 AAGGGGGGACTAAGGGAGTAGGG - Intronic
1182573767 22:31259080-31259102 AAGGGTGTACAAAGGGAGGAAGG - Intronic
1183348608 22:37321588-37321610 GAGGGTGGACAGTGGGAGGACGG + Intergenic
1184242083 22:43216698-43216720 AAGGGGGGACAAAGGGAGCTTGG - Intronic
1184411249 22:44327685-44327707 AGGGGTGCAAAAAGGGAGGGAGG + Intergenic
950369977 3:12520929-12520951 GAGGGTGAAGAGAGGGAGGAGGG - Intronic
950956221 3:17056046-17056068 ATGGGTTTACGAAGGAAGGAGGG - Intronic
951510922 3:23501153-23501175 AAGGATGCACAGAGTGAGGAAGG + Intronic
952047093 3:29335822-29335844 AAGGGAGGAAAAAGGAAGGAGGG - Intronic
952198138 3:31097484-31097506 AAGGATGGAAAAACGGAGGAAGG + Intergenic
952687513 3:36167290-36167312 GAGGGTGAAGAATGGGAGGAGGG - Intergenic
953428565 3:42817465-42817487 ATGGGTGTTCAGTGGGAGGAGGG - Intronic
953432262 3:42850029-42850051 AAGGATGTACAAAAGGGGGGAGG + Intronic
953695923 3:45159133-45159155 GAGGGTGAAGAATGGGAGGAGGG - Intergenic
954382880 3:50228935-50228957 AAGGGAGTAATAGGGGAGGAGGG - Intronic
955254580 3:57317113-57317135 AAGGGAGGACAAAGAAAGGAAGG - Intronic
955554115 3:60117815-60117837 AAGGTTGTACAGAGGAAGCAGGG - Intronic
955960207 3:64332856-64332878 TGGGGTGGATAAAGGGAGGACGG + Intronic
957201853 3:77146278-77146300 GAGGGTGGAGAGAGGGAGGAAGG + Intronic
957922162 3:86759926-86759948 AAGAGTTTGCAAAGGGAGTAGGG + Intergenic
957954168 3:87162095-87162117 GAGGGAGGATAAAGGGAGGAGGG - Intergenic
959438918 3:106352457-106352479 GAGGGTGAAGAATGGGAGGAAGG - Intergenic
960442814 3:117710214-117710236 AGGAGTGGAGAAAGGGAGGACGG - Intergenic
961144114 3:124579956-124579978 CATGGTCTCCAAAGGGAGGAAGG + Intronic
961207953 3:125102266-125102288 CAGGGTGTATGAAGGCAGGAAGG + Intronic
961660261 3:128464894-128464916 AAGGAAGGAGAAAGGGAGGAAGG - Intronic
962349209 3:134644489-134644511 AAGGCTGGGCAAGGGGAGGATGG + Intronic
963632097 3:147746242-147746264 AAGGGTGGAGAGTGGGAGGAGGG - Intergenic
964451888 3:156821294-156821316 AAAACTGTACAAAGGGAGCATGG - Intergenic
965463608 3:168999963-168999985 AAGGAAGGAGAAAGGGAGGAAGG + Intergenic
965515855 3:169620175-169620197 AGGGGAGTACAAAAGAAGGAAGG - Intronic
966291834 3:178368358-178368380 AAGGGAGGAAAAAGGAAGGAAGG - Intergenic
966593895 3:181710233-181710255 AAGGGTAGACCAGGGGAGGAGGG + Intergenic
966621249 3:181966612-181966634 ATGGGTCTACAATGGGAGGGCGG - Intergenic
967106699 3:186260311-186260333 AAGGGAGTAAAATGGCAGGAAGG + Intronic
969571753 4:8012901-8012923 AAGGGTGAACAGAGGGTAGATGG - Intronic
970689969 4:18611596-18611618 AAGGAAGGAGAAAGGGAGGAAGG + Intergenic
970689998 4:18611691-18611713 AAGGGGGGAGAAAGGAAGGAAGG + Intergenic
970690076 4:18611913-18611935 AAGGGGGGAGAAAGGAAGGAAGG + Intergenic
970690133 4:18612056-18612078 AAGGAAGGAGAAAGGGAGGAAGG + Intergenic
970690162 4:18612151-18612173 AAGGGGGGAGAAAGGAAGGAAGG + Intergenic
970690219 4:18612294-18612316 AAGGAAGGAGAAAGGGAGGAAGG + Intergenic
970690248 4:18612389-18612411 AAGGGGGGAGAAAGGAAGGAAGG + Intergenic
971723911 4:30283533-30283555 AAAGGAGAACAAAGGAAGGAGGG - Intergenic
971932420 4:33102108-33102130 AAGGGAGGAAAAAGGAAGGAGGG - Intergenic
973567603 4:52204007-52204029 AAGGGAGGATAAAGGGAAGAAGG - Intergenic
973709081 4:53608958-53608980 GAGGGTGGAGAAAGGGAGGAGGG + Intronic
973722034 4:53733807-53733829 AGGGGAGGACAAAGGAAGGAAGG + Intronic
974480249 4:62433545-62433567 AAGGATGCACAACTGGAGGATGG + Intergenic
974552649 4:63398142-63398164 AAGGGTGGAGAATGGGAGGGGGG - Intergenic
974570176 4:63635629-63635651 AAGGGTGAAGAGTGGGAGGAGGG + Intergenic
975158384 4:71097165-71097187 AAGGGTGGATGATGGGAGGAGGG - Intergenic
975211525 4:71706063-71706085 ACATGTGTACAATGGGAGGAAGG - Intergenic
976126079 4:81835053-81835075 AAGGAGGAACAGAGGGAGGAAGG + Intronic
976517508 4:85985481-85985503 GAGGGTGGATAATGGGAGGAGGG + Intronic
976567206 4:86564680-86564702 AAGGTGGTAGAAAAGGAGGAAGG - Intronic
976790097 4:88868721-88868743 AAAAGAGTACAAAGGGAGGGAGG - Intronic
977421817 4:96810444-96810466 GAGGGTGGAAAATGGGAGGAGGG - Intergenic
977630842 4:99240963-99240985 AAGGGAGTACAGAGGTGGGAGGG - Intergenic
978072106 4:104486949-104486971 AAGAGTGTAATAGGGGAGGAGGG - Intronic
978115410 4:105014556-105014578 TTGGGTTTACAAAGAGAGGAAGG - Intergenic
978769743 4:112442464-112442486 GAGGGTGGACAGTGGGAGGAGGG + Exonic
981351314 4:143733188-143733210 GAGGGTGGAGAATGGGAGGAAGG - Intergenic
982302863 4:153898041-153898063 AAGAGAGAACAGAGGGAGGAGGG - Intergenic
983515530 4:168652264-168652286 AAGGATATAAAAATGGAGGAAGG + Intronic
985179332 4:187239555-187239577 AGGCAGGTACAAAGGGAGGAAGG - Intergenic
985214615 4:187637641-187637663 GAGGGTGAAGAGAGGGAGGAGGG - Intergenic
985257048 4:188080710-188080732 TAGTGTGGTCAAAGGGAGGATGG + Intergenic
985358886 4:189151141-189151163 AAGGGGGAACAAAGGAAAGAAGG - Intergenic
985408134 4:189656447-189656469 GTGGGTGTGCAATGGGAGGAAGG - Intergenic
985829569 5:2218278-2218300 AAGGAGGTAGGAAGGGAGGAAGG + Intergenic
986706555 5:10458568-10458590 GATGGTGTACATAGGGGGGATGG - Intronic
987246504 5:16054382-16054404 AAGGGGGAACAAAAGGAAGAAGG + Intergenic
987785817 5:22497420-22497442 ACGGGTGAGCAAAGGAAGGAAGG - Intronic
988663321 5:33297707-33297729 AAGGGTTTTTAAAGGCAGGAAGG - Intergenic
988872567 5:35406863-35406885 AATGGGGTACAGAGGGAGGCAGG - Intergenic
988978837 5:36543413-36543435 GAGGGTGGAGAATGGGAGGAGGG - Intergenic
989264901 5:39462217-39462239 CAGGAAGTACCAAGGGAGGATGG - Intronic
989788760 5:45365337-45365359 AAGGGTGGAGAATGGGAGGTGGG - Intronic
990295660 5:54399031-54399053 AATAGTGAACAGAGGGAGGAAGG - Intergenic
991302180 5:65139602-65139624 AAGGGTGGAGGAAGGGAGGAAGG - Intergenic
992123509 5:73618053-73618075 AAGGCTTTACAAAGGCAGAAAGG - Intergenic
992489127 5:77223969-77223991 ATGGATGAACAAAGGGAAGATGG - Intronic
994073142 5:95622991-95623013 AAGGAGGAACAAAGAGAGGAAGG - Intergenic
994842613 5:104946086-104946108 GAGGGTGGACAGTGGGAGGAGGG - Intergenic
995131959 5:108640252-108640274 AAGGTTTTTCAAAGGAAGGAAGG - Intergenic
995582365 5:113615428-113615450 AAGGGCTTAAAAAGGGAGGTTGG + Intergenic
995858069 5:116614647-116614669 AAGGGCCTACAATGGGAAGAGGG - Intergenic
996305389 5:122040497-122040519 GAGGGTCAATAAAGGGAGGAGGG + Intronic
997181735 5:131836041-131836063 AAGGGTGGAGAGTGGGAGGAGGG - Intronic
997957003 5:138286553-138286575 CTGGGTGTCCAAAGGGACGATGG + Exonic
998894505 5:146785188-146785210 AAGAGTATAGAAAAGGAGGAAGG + Intronic
999167553 5:149563271-149563293 AAGGGTGTAGAAAGGCTGGTGGG - Intronic
999383040 5:151135063-151135085 GAGGATGCACAAAGGGAAGAGGG + Intronic
1000073990 5:157767733-157767755 GAGGGTGGCCAAATGGAGGAAGG + Intergenic
1000291728 5:159877233-159877255 AGTGGTTTACAAAGGGTGGAGGG - Intergenic
1000974984 5:167754892-167754914 AAGGGAGCAGAAAGGGAGGAGGG + Intronic
1002102353 5:176863772-176863794 AAGGGGGTAAAGAAGGAGGAGGG - Intronic
1003745769 6:9000304-9000326 GAGGGTGGAGAATGGGAGGAGGG - Intergenic
1004826597 6:19428168-19428190 ATGGATGTACACATGGAGGAAGG - Intergenic
1004947834 6:20635342-20635364 CAGGGACTACAAAGGAAGGAAGG - Intronic
1005603701 6:27453886-27453908 AAGGATGTTCAAATGTAGGATGG + Intronic
1005822016 6:29606341-29606363 AGGGATGCACAAAGGCAGGAGGG - Intronic
1006902241 6:37510727-37510749 CATGGTGTGCACAGGGAGGAGGG + Intergenic
1008330608 6:50240439-50240461 AAGGGTGAGCAAAGCGAAGAGGG + Intergenic
1010048764 6:71478834-71478856 ACTGATGTACAAAGTGAGGAAGG + Intergenic
1011231787 6:85169983-85170005 AAGGGTGCACAAAAGGTGGTAGG + Intergenic
1011350835 6:86421900-86421922 GAGGATGTACAAAGGGAAAATGG + Intergenic
1011870244 6:91884241-91884263 GAGGGTGGAGAATGGGAGGAGGG - Intergenic
1012512720 6:100022925-100022947 AAGGGAGGAAAAAGGGAGAATGG + Intergenic
1012703561 6:102494221-102494243 AAAAGTGTACAAAGGGAAGGTGG - Intergenic
1014913027 6:127116961-127116983 TAGGGATTACAAATGGAGGAAGG + Intergenic
1015895399 6:138011891-138011913 ACGGAAGTACAAAGGGAGGTAGG - Intergenic
1017193515 6:151677798-151677820 CAGAGTTTGCAAAGGGAGGAGGG + Intronic
1017505434 6:155064849-155064871 AAGGGTGGACAAAAGGAGTGGGG - Intronic
1017739071 6:157389768-157389790 CAGTGGGTACAAAGGGTGGAAGG - Intronic
1019334897 7:478438-478460 AAGGGAGGACAAAGGGAGGAAGG + Intergenic
1020741341 7:12022726-12022748 GAGGGTGGAGAATGGGAGGAGGG + Intergenic
1020986333 7:15139505-15139527 AAGGGTGGAGAGTGGGAGGAGGG - Intergenic
1021364226 7:19756511-19756533 GAGGGTGGACGATGGGAGGAGGG - Intronic
1021407483 7:20289105-20289127 AAGGGTGGAGGGAGGGAGGAGGG + Intergenic
1021779932 7:24094076-24094098 AAGGGTGAAGAATGGGAGAAAGG - Intergenic
1021889932 7:25177950-25177972 GAGGGTGGAGAGAGGGAGGAAGG - Intronic
1022228743 7:28392122-28392144 GAGGGTGGACGGAGGGAGGAAGG + Intronic
1022506626 7:30911787-30911809 GGGGGAGCACAAAGGGAGGAAGG - Intergenic
1022600915 7:31758802-31758824 AATGGTGTAGAAAGGGGAGAGGG + Intronic
1022624790 7:32024201-32024223 AAGGGAGGAAACAGGGAGGAAGG + Intronic
1023234720 7:38072812-38072834 AAGGGTGGAGATTGGGAGGAGGG - Intergenic
1023904230 7:44510646-44510668 AAGAATATACAAAGAGAGGAAGG - Intergenic
1024845216 7:53634554-53634576 AAGGGTGGAGGATGGGAGGAGGG + Intergenic
1025198843 7:56949844-56949866 TAGGGAGGAGAAAGGGAGGAGGG - Intergenic
1025673103 7:63627089-63627111 TAGGGAGGAGAAAGGGAGGAGGG + Intergenic
1025736551 7:64153697-64153719 AAGGGTGTATAAAAGGAAAAAGG + Intronic
1025814688 7:64900575-64900597 AATGGTGAGGAAAGGGAGGATGG - Intronic
1026146752 7:67753158-67753180 AAGGGAGGAAAAAGGAAGGAAGG + Intergenic
1026871030 7:73852018-73852040 AAGGGGGAAGGAAGGGAGGAAGG - Intergenic
1027759776 7:82262834-82262856 GAAGGTGTTCAAAGGGAGAAGGG - Intronic
1027813077 7:82930827-82930849 ATGGGTCTAGAAAGGTAGGAAGG + Intronic
1028267242 7:88741399-88741421 AAGGGTGAACAAAAGGAGAGTGG - Intergenic
1029064002 7:97829816-97829838 AAGGGTGGAGGATGGGAGGAGGG + Intergenic
1030175038 7:106643778-106643800 AAGGGTCTTAAAAAGGAGGAGGG + Intergenic
1030847252 7:114435366-114435388 AAGGGTACACAAAGACAGGAAGG + Intronic
1031030342 7:116727488-116727510 AAGGGAGGAAAAAGGAAGGAAGG - Intronic
1031995269 7:128226491-128226513 AAGGATGGACAATAGGAGGATGG - Intergenic
1031995274 7:128226514-128226536 AAGGATGGACAATAGGAGGATGG - Intergenic
1032344112 7:131104186-131104208 GGGGGTGGACAATGGGAGGAGGG + Intergenic
1032361204 7:131256798-131256820 AAGGGTGGAGGGAGGGAGGAGGG + Intronic
1032539922 7:132694421-132694443 ATGGGTGGAGAAAGGGAGGCTGG - Intronic
1032875641 7:136035209-136035231 GAGGGTGGAGAATGGGAGGAGGG - Intergenic
1035776301 8:2191278-2191300 AAGGGAGGAGGAAGGGAGGAAGG - Intergenic
1035776347 8:2191393-2191415 AAGGGAGGAGGAAGGGAGGAAGG - Intergenic
1035776536 8:2191760-2191782 AAGGGAGGAGGAAGGGAGGAAGG - Intergenic
1035776567 8:2191823-2191845 AAGGGAGGAGGAAGGGAGGAAGG - Intergenic
1036217987 8:6896798-6896820 GAGGGTTTACAGAGGTAGGAGGG - Intergenic
1036288354 8:7464098-7464120 AGGGGGGTCCAAAGTGAGGAAGG - Intergenic
1036333121 8:7847430-7847452 AGGGGGGTCCAAAGTGAGGAAGG + Intergenic
1036586342 8:10127410-10127432 TATGGAGTACAAAGGGATGAAGG + Intronic
1036978777 8:13445131-13445153 AAGAGAGCACAGAGGGAGGAAGG + Intronic
1037564480 8:20105935-20105957 AAGGCTGCACAGAGGGAGAAGGG + Intergenic
1037809180 8:22076277-22076299 AAGATTGTACAGAGAGAGGAGGG + Intronic
1038051406 8:23816653-23816675 AAGGGTTTAGAAATGGGGGAAGG + Intergenic
1038763699 8:30408136-30408158 AAGGGTCTAGACAGGCAGGATGG - Intronic
1040549687 8:48428545-48428567 GAGGGTGAACCAAGGAAGGAGGG + Intergenic
1041389845 8:57338589-57338611 AAGGGTGGACAGAGTTAGGAGGG - Intergenic
1041577296 8:59413508-59413530 AAGGGTGGAGAGAGGGAGGCAGG + Intergenic
1042624845 8:70746909-70746931 AAGGGAGAAGACAGGGAGGAGGG - Intronic
1043117763 8:76280933-76280955 AAAGGTGTAAAAAAGGTGGAAGG - Intergenic
1043633346 8:82364388-82364410 GAAGGTGTACAAATGGAGGGGGG - Intergenic
1043822814 8:84889538-84889560 CAGGGTGTAGAAAGAGAAGATGG - Intronic
1044744866 8:95362225-95362247 AGGGGTGAACAAAGGCATGAAGG + Intergenic
1044946047 8:97391103-97391125 AAGGGTGCAGGAAGGTAGGATGG - Intergenic
1045978861 8:108160760-108160782 AAGTGTGTAGAAAGGAAGGATGG + Intergenic
1046346330 8:112932696-112932718 GAGGGGGTACAAAGAGAGGTTGG + Intronic
1046405044 8:113762431-113762453 GAGGGTGTAGAGCGGGAGGAGGG + Intergenic
1046699709 8:117386370-117386392 AAGGGCTGTCAAAGGGAGGAAGG - Intergenic
1047358420 8:124144940-124144962 AAGTGTGGGAAAAGGGAGGATGG + Intergenic
1047832297 8:128648055-128648077 AAGGGAGGAAAAAGGGAGGGAGG - Intergenic
1048494632 8:134925029-134925051 ATGGGTGTACAAAAGAAGAAAGG - Intergenic
1050290161 9:4145730-4145752 GAGGGGGAACAAAGGGAGGAGGG - Intronic
1050376921 9:4984100-4984122 AAAGGAGTAGAAAGTGAGGAGGG - Intergenic
1051347300 9:16163768-16163790 CAGGGTGTAAAGAGAGAGGAAGG - Intergenic
1051688816 9:19687128-19687150 AAGGGTGGAGAATGAGAGGAGGG + Intronic
1052026638 9:23580953-23580975 AGGGGTGGACAAAGGGACTACGG - Intergenic
1052210877 9:25901823-25901845 AAGGGGCTACAGAGGAAGGAAGG + Intergenic
1053306363 9:36986947-36986969 CTGGGTGTCCAGAGGGAGGAAGG + Intronic
1056540008 9:87563000-87563022 AAGGTTGGACAATGGAAGGAGGG + Intronic
1056545156 9:87606817-87606839 AAGGGGGGAGAAAGGGAGGAAGG - Intronic
1058727333 9:107816877-107816899 AGGGGTGGGAAAAGGGAGGAGGG - Intergenic
1058966110 9:110040025-110040047 AAGGAAGTACAAATGAAGGAAGG + Intronic
1059573441 9:115465406-115465428 AAGGGGGTGCAAGGGGAGCAAGG + Intergenic
1059669665 9:116480103-116480125 ATGGGTGAAGAAAGGAAGGAAGG + Intronic
1060006803 9:120007812-120007834 AAGGAAGGAGAAAGGGAGGAAGG + Intergenic
1061738872 9:132684572-132684594 GCGGGAGGACAAAGGGAGGAAGG - Intronic
1203659222 Un_KI270753v1:25860-25882 GTGGGTGTGCAATGGGAGGAAGG - Intergenic
1185965024 X:4590542-4590564 GAGGGTGGAAGAAGGGAGGAAGG + Intergenic
1186094990 X:6091010-6091032 AGGGATGTAGAAAGGAAGGAAGG + Intronic
1186111945 X:6266901-6266923 AAGGGAGGAAAGAGGGAGGAGGG + Intergenic
1186157067 X:6736851-6736873 GAGGGTGGACAGTGGGAGGAGGG + Intergenic
1186625254 X:11286520-11286542 AGGGGTGTATAAAGTGAGGTGGG - Intronic
1186790725 X:12995698-12995720 AAGGGTGGAGGATGGGAGGAGGG + Intergenic
1187256457 X:17647503-17647525 AAGTGTGTGGAAAGGGAGGGTGG + Intronic
1187747795 X:22428694-22428716 AAGGATGAAAAAAGGCAGGAAGG - Intergenic
1187836514 X:23437134-23437156 AAGGCTGAACAAAGGTAGCAGGG - Intergenic
1189319371 X:40078419-40078441 AAGGGTGCAAGAAGGGTGGAAGG + Intronic
1189749773 X:44208487-44208509 AAAGGGGGAGAAAGGGAGGAAGG + Intronic
1189871656 X:45390595-45390617 GAGGGTGGAAAATGGGAGGAGGG - Intergenic
1190160919 X:48030782-48030804 AAGGGGAGCCAAAGGGAGGAAGG + Intronic
1190802467 X:53804225-53804247 GAGGGTGGAGAATGGGAGGAGGG + Intergenic
1191822097 X:65321890-65321912 AGGGGTGTAGGGAGGGAGGAAGG + Intergenic
1191837853 X:65484201-65484223 GAGGGTGGAGAATGGGAGGAGGG + Intronic
1192866432 X:75137871-75137893 GAGGGTAGACAATGGGAGGAGGG + Intronic
1192877362 X:75245791-75245813 GTGGGTGGAGAAAGGGAGGAGGG + Intergenic
1193702415 X:84779569-84779591 CAGGGTGTACAATGGGAGTGTGG + Intergenic
1193718810 X:84964246-84964268 GAGGGTGGAGAATGGGAGGAGGG + Intergenic
1194027779 X:88775323-88775345 AAGGGTGGAAAGTGGGAGGAGGG - Intergenic
1194914382 X:99686862-99686884 AAGGGTGGAGAGTGGGAGGAGGG + Intergenic
1194942429 X:100027113-100027135 AAGGAAGTAAAAAGGAAGGAAGG + Intergenic
1195479288 X:105324230-105324252 AATGGAGTACAGAGGGAGGAAGG + Intronic
1195548979 X:106144951-106144973 GAGGGTGGAGAATGGGAGGAAGG + Intergenic
1195878972 X:109572970-109572992 AATGTTTTCCAAAGGGAGGAAGG - Intergenic
1195915194 X:109928669-109928691 AATGGTGTGCAAATGGAGGTTGG - Intergenic
1196008709 X:110863597-110863619 AAGAGTGTCCAAAGTCAGGATGG + Intergenic
1196200678 X:112882551-112882573 GAGGGTGGACAGTGGGAGGAGGG + Intergenic
1196494606 X:116309754-116309776 AAGGGTGGAGGGAGGGAGGATGG - Intergenic
1196541586 X:116916879-116916901 AAGGGTGGAGAAAGGGAGAAGGG - Intergenic
1197094880 X:122581991-122582013 AAGGGTGGAAGATGGGAGGAAGG + Intergenic
1198441717 X:136669770-136669792 AAGTGAGTAGAAAAGGAGGAGGG - Intronic
1198518748 X:137431762-137431784 AAGGAAGAACAAAGGAAGGAAGG + Intergenic
1198608084 X:138366559-138366581 GAGGGTGTAGGATGGGAGGAGGG + Intergenic
1200031059 X:153295927-153295949 AAGGTTGTACAAAGGCAATAAGG + Intergenic
1200812257 Y:7498461-7498483 GAGGGTGCAGGAAGGGAGGAGGG + Intergenic
1201712686 Y:17009931-17009953 GAGGGTGGAGAATGGGAGGAGGG - Intergenic
1202386219 Y:24328744-24328766 AAGGGTTTTTAAAGGGGGGAAGG - Intergenic
1202484567 Y:25341384-25341406 AAGGGTTTTTAAAGGGGGGAAGG + Intergenic