ID: 1182574935

View in Genome Browser
Species Human (GRCh38)
Location 22:31266648-31266670
Sequence CTGAGTGAACAGAAGTCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 238}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182574935_1182574942 23 Left 1182574935 22:31266648-31266670 CCCCCAGACTTCTGTTCACTCAG 0: 1
1: 0
2: 2
3: 18
4: 238
Right 1182574942 22:31266694-31266716 ACCAGAGCCCCTGCTTGGCTTGG 0: 1
1: 0
2: 0
3: 20
4: 244
1182574935_1182574941 18 Left 1182574935 22:31266648-31266670 CCCCCAGACTTCTGTTCACTCAG 0: 1
1: 0
2: 2
3: 18
4: 238
Right 1182574941 22:31266689-31266711 AAATGACCAGAGCCCCTGCTTGG 0: 1
1: 0
2: 2
3: 21
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182574935 Original CRISPR CTGAGTGAACAGAAGTCTGG GGG (reversed) Intronic
900720849 1:4174848-4174870 CTGAGTGTGGACAAGTCTGGGGG - Intergenic
901207752 1:7506386-7506408 CTGAGTGCACAGGTGTCCGGTGG - Intronic
904606534 1:31700959-31700981 CTGACTGAGCAGAAGTGTTGGGG + Intronic
904865510 1:33575596-33575618 ATGGGTCAACTGAAGTCTGGTGG + Intronic
905045680 1:34998636-34998658 ATCACTGAAGAGAAGTCTGGAGG + Intronic
905530979 1:38678500-38678522 CAGCATGAACAAAAGTCTGGGGG - Intergenic
905791855 1:40793890-40793912 CTGGGTGAACAGAACTCTGGGGG - Intronic
906105682 1:43290737-43290759 CTGAGTGAACAGCAGGAAGGGGG + Intergenic
906155433 1:43611472-43611494 CTGAGCCAAGAGAAGACTGGAGG + Intronic
906190642 1:43897588-43897610 CTGAGAGCACAGAAGTCATGGGG + Intronic
907845945 1:58206956-58206978 CTGAGAGAGCAGAAGTGTGCAGG - Intronic
908167741 1:61474945-61474967 CTCTGTGAACAGAAATCTGCAGG + Intergenic
908710057 1:67005125-67005147 CTAAGTGGAAAGTAGTCTGGAGG + Intronic
909639411 1:77855332-77855354 CTAAGCGAAAAGAATTCTGGAGG - Intronic
909958349 1:81803440-81803462 CAGAGTGAACAGAGGATTGGAGG - Intronic
910326360 1:86012647-86012669 CTGTGTGAACATAAGACTGTGGG - Intronic
910781169 1:90935328-90935350 CTGAATTAACACCAGTCTGGTGG + Intronic
911987776 1:104651819-104651841 ATGAGTGACCACAAGTCTTGGGG + Intergenic
914084541 1:144440962-144440984 CTGAGTAAAGAGAAGTCGGCCGG - Intronic
914190554 1:145406228-145406250 CTGAGTAAAGAGAAGTCGGCCGG - Intergenic
914588360 1:149083102-149083124 CTGAGTAAAGAGAAGTCGGCCGG - Intronic
914890798 1:151621044-151621066 CTGAGTGGACTGAAGACGGGGGG + Intronic
914915934 1:151819221-151819243 CTAAGTGACTAGAAGTATGGGGG - Intronic
917778935 1:178370241-178370263 CTGAGTCGAGAGGAGTCTGGGGG + Intronic
919537369 1:198804906-198804928 CTAAGTGAAAGGAAGTCAGGAGG - Intergenic
920255047 1:204648984-204649006 CAGAGTCATCAGAAGTCAGGTGG + Intronic
921874327 1:220176985-220177007 CTGTGTGAAAAGGAGGCTGGGGG - Intronic
922537493 1:226391835-226391857 TTGATTAAACAGAAGGCTGGAGG + Intronic
924458010 1:244233612-244233634 CTGAGCCAACCGCAGTCTGGAGG + Intergenic
924944344 1:248836053-248836075 GTGTTTGAACAGAAGTCTGAAGG + Intergenic
1066259608 10:33716423-33716445 ATGAGTAAACTGAAGTCAGGAGG + Intergenic
1067896614 10:50188143-50188165 CTGAGTCTGCAGAAATCTGGAGG + Intronic
1067952358 10:50753890-50753912 CTGAGTCTGCAGAAATCTGGAGG - Intronic
1068826677 10:61447881-61447903 ATGAGTGATCAGAACTCTGAAGG - Intronic
1068958323 10:62841567-62841589 CTGGGAGACCAGAAGTTTGGGGG - Intronic
1069244971 10:66192898-66192920 CTCAGGGAACAAATGTCTGGTGG - Intronic
1069862555 10:71480714-71480736 CTGAGTGCAGAGAAGGCTGGAGG + Intronic
1069936945 10:71924108-71924130 GTGAGTGCACAGAAGTCAGAGGG + Intergenic
1070501381 10:77075887-77075909 GTTAGTGCCCAGAAGTCTGGAGG + Intronic
1071449071 10:85777321-85777343 TTGAGTGGACAGTAGGCTGGAGG - Intronic
1073281992 10:102361249-102361271 TTGATTGAACCGAACTCTGGAGG - Intronic
1074457968 10:113612151-113612173 CTGAGCCAACAGGAGCCTGGAGG + Intronic
1075030560 10:119021915-119021937 CTTAGTGACCAGAAGGCAGGTGG - Intergenic
1075260463 10:120959016-120959038 CTGGGTGAACAGAAGACAGGTGG - Intergenic
1076250408 10:128980035-128980057 CTGAATCAACAGAACTCCGGTGG - Intergenic
1076782752 10:132733264-132733286 CTGGGTGAACATGAATCTGGGGG + Intronic
1077322556 11:1948774-1948796 CTGAGGGAACTGAGGGCTGGTGG + Intronic
1080514328 11:33006157-33006179 CAGAGTGAACAGATGTCTGGAGG + Intergenic
1081800996 11:45859238-45859260 CTGTGTGAACAGAGGTCTGTTGG - Intronic
1083853904 11:65382756-65382778 CTGACTGAAGAAGAGTCTGGAGG - Intronic
1084434833 11:69132597-69132619 ATGAGTAAACGGAGGTCTGGAGG - Intergenic
1084955471 11:72689036-72689058 CCGTGTGAACAGAAGGCTTGAGG + Intronic
1085527941 11:77174923-77174945 CTGAGTGCACAGAGGGCAGGAGG + Intronic
1085597358 11:77821496-77821518 CTGAGGGAACGGAACTCTGGGGG + Intronic
1086344512 11:85882567-85882589 CTGAGTGAAGAGAAGGCAGAGGG + Exonic
1086448882 11:86896571-86896593 GTGACTGAACAGATGTTTGGGGG - Intronic
1086848245 11:91778378-91778400 CTGAGTGAACAAAAGTATTAAGG - Intergenic
1088546420 11:110963928-110963950 CTGTGAGAACATAAGACTGGGGG - Intergenic
1090426969 11:126614629-126614651 CTGAGGAACCAGAAATCTGGAGG - Intronic
1090717103 11:129440433-129440455 CTGGGAGACCAGAAGTCTGTGGG + Intronic
1202805573 11_KI270721v1_random:4087-4109 CTGAGGGAACTGAGGGCTGGTGG + Intergenic
1095427071 12:42087493-42087515 ATGAGTCAACAGAAGTCTGCAGG + Exonic
1095796543 12:46225461-46225483 CTGAGTGAACACATGCCTGCTGG + Intronic
1096499143 12:52054884-52054906 CTGAAGGAAAAGAAGGCTGGAGG - Exonic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1097181870 12:57176215-57176237 CCCAATGAACAGAAGTGTGGGGG - Intronic
1097394275 12:59054717-59054739 CTGAGTGAACATAAATTTTGGGG - Intergenic
1097399634 12:59113547-59113569 CTGTGTGAACAGACAACTGGAGG + Intergenic
1099302684 12:80917784-80917806 CAAAGGGAACAGAAATCTGGAGG - Intronic
1099438683 12:82673806-82673828 CTGAGTGAACAGATGACAAGTGG + Intergenic
1100589405 12:96011783-96011805 CTGAGAGAAGAGACGTTTGGGGG - Intronic
1100998543 12:100330714-100330736 CTGAGTGAGCAGAGTTTTGGAGG + Intronic
1103067654 12:117913421-117913443 CTGGGTGAACATAAATTTGGGGG - Intronic
1103185875 12:118956608-118956630 CTGAGTAAAAAGGAGTTTGGGGG - Intergenic
1103602856 12:122065091-122065113 CTGACTGAGCAGAGGGCTGGAGG + Intergenic
1105431369 13:20340356-20340378 CTGTGTGTACAGAAGTCCCGGGG - Intergenic
1107125236 13:36839337-36839359 CTGAATGAAGAGATGTCTGTGGG - Intergenic
1107431541 13:40345042-40345064 CTGGGAGAGCAGTAGTCTGGAGG - Intergenic
1107549105 13:41458243-41458265 CTCAGTGCACGGAAGTCAGGGGG - Intronic
1107930489 13:45303032-45303054 CTGTGTAAAGAGAAGTCAGGGGG + Intergenic
1109828250 13:67752490-67752512 CTGGATGAACAGTAGTCTTGTGG - Intergenic
1111640907 13:90968622-90968644 TTGGGTGAACAGAAGTCATGGGG + Intergenic
1113199763 13:107854419-107854441 CGTAGTGAACAGCAGACTGGTGG - Intronic
1114388917 14:22284520-22284542 CTGAGTTAACACAACTATGGAGG - Intergenic
1115648285 14:35385128-35385150 CGAAGTGAACAAAAGTCAGGAGG - Intergenic
1116842022 14:49828067-49828089 CTGAGTGAACAGAAAAATGAAGG + Intronic
1117920019 14:60720018-60720040 CTGAGTTAGCAGAACTCTGGAGG + Exonic
1119515213 14:75242585-75242607 CTGTGTGAACAGGAGCCTGCGGG + Intronic
1119971824 14:78979495-78979517 ATGAGTGAACAGTAGTTGGGTGG - Intronic
1122033498 14:98931074-98931096 CTGTGTGCACAGAAGACAGGTGG - Intergenic
1122499662 14:102188372-102188394 CTGAGTGGACAGAAATGTGGAGG - Intronic
1123022636 14:105408811-105408833 CTGAGTAGACAGAATGCTGGTGG - Intronic
1124997776 15:34740462-34740484 CTGAGTGATCAAAACTCTGCTGG - Intergenic
1125083964 15:35708207-35708229 TTTATTGAACAGATGTCTGGAGG + Intergenic
1125258264 15:37791998-37792020 CTTAGTGGGCAGAAGTCTGTTGG - Intergenic
1125827687 15:42690223-42690245 CTGGGTTGACAGAAGTCTGCAGG + Exonic
1128154285 15:65383073-65383095 CTGAGTGAAGAGGAGGCAGGAGG + Exonic
1129759656 15:78122089-78122111 CTGCCTGATCACAAGTCTGGTGG + Intronic
1130793172 15:87178428-87178450 TTGAGTGAACAGATGGCTGCAGG - Intergenic
1137529969 16:49273109-49273131 CTGCGTGAACAGATGGATGGAGG - Intergenic
1138160018 16:54744776-54744798 CTCAGTGAACTGAAAACTGGAGG + Intergenic
1138301693 16:55935637-55935659 CAGAGTGAAAAGGAGTGTGGTGG - Intronic
1138348029 16:56331807-56331829 CTGAGTAGGCAGAAGTCAGGAGG - Intronic
1141222037 16:82080042-82080064 CTGAGTGACAAGAATTTTGGTGG + Intronic
1141817483 16:86422498-86422520 CTGAGGGTAAAGAGGTCTGGAGG + Intergenic
1142373231 16:89694429-89694451 CTGGGAGCACAGAGGTCTGGAGG + Intronic
1142468017 17:147096-147118 CTGAGAGGACAGGAGTGTGGGGG - Exonic
1142468595 17:149391-149413 GTGTGTGAACAGAAGTGCGGTGG - Intronic
1144655113 17:17030167-17030189 GGGAGTGGACAGAAGGCTGGGGG - Intergenic
1145985788 17:29045293-29045315 CAGAGTGGACAGGAGTCTGCTGG + Intronic
1148777460 17:50103751-50103773 CTGTGTGAACAGAAGCGTGGAGG + Intronic
1149449942 17:56742092-56742114 CTGGGTGAACATAAGTTTTGTGG - Intergenic
1149467374 17:56890785-56890807 CTGGATCAACAGAAGCCTGGTGG - Exonic
1150465408 17:65388490-65388512 CTGTGTGAACAGAAGGATAGTGG - Intergenic
1152077012 17:78165972-78165994 CTGAGTGAAGAGGAGTTTGGGGG + Exonic
1152371844 17:79893127-79893149 CTAAGAGAACTGAAGTCTAGAGG - Intergenic
1153450251 18:5219189-5219211 CTGTGTGCACAGAAGTCAGAAGG - Intergenic
1155872720 18:31047186-31047208 CTGAGTAAAAAGAAGACTGATGG - Intergenic
1158227106 18:55212901-55212923 CTGAGTGAAGAGAAGGCCAGAGG - Intergenic
1158337029 18:56423431-56423453 CTGGGTGAACAGTGGTCTTGGGG - Intergenic
1160153526 18:76413409-76413431 TTGATTGAACAGACGTCTGTTGG - Intronic
1162549698 19:11351615-11351637 CTGAGAGGACAGGAGACTGGGGG + Intronic
1163566105 19:18052204-18052226 CTGAGTGGACAGAACCTTGGCGG - Intergenic
1163889721 19:20000115-20000137 CTGAGTAATCAGTAGCCTGGCGG + Intronic
1165895064 19:39136463-39136485 CTGACTGAACAGAAGGAAGGAGG - Intronic
1166385446 19:42378093-42378115 CTGAGTGAAGAGATGTCTGAAGG - Intronic
1166567886 19:43776251-43776273 CAGAGTGGACAGAGGCCTGGGGG + Intronic
927062336 2:19435617-19435639 CCGAGTGAAGTGAAGCCTGGTGG - Intergenic
933411888 2:81936279-81936301 CTCAGTGAGCAGAACTCTGTGGG - Intergenic
933750257 2:85598713-85598735 CAGAGGGGATAGAAGTCTGGTGG - Exonic
934487857 2:94734353-94734375 ATGAGTCAACAGAAGTTTGCAGG + Intergenic
934496035 2:94800239-94800261 CTGAGTGAAGAGAAAACCGGTGG + Intergenic
936157055 2:110054599-110054621 CTCTGTGAACAAAAGTGTGGAGG + Intergenic
936187639 2:110316845-110316867 CTCTGTGAACAAAAGTGTGGAGG - Intergenic
936748078 2:115604517-115604539 CTGACAGAACAGAACTATGGTGG - Intronic
937299408 2:120830081-120830103 CTGAGTGAGTGGGAGTCTGGTGG + Intronic
938247998 2:129793843-129793865 CTGAGTGTAAAGAAGGCTGGGGG - Intergenic
939285911 2:140128999-140129021 CATAGTGAAGAGCAGTCTGGAGG - Intergenic
940129737 2:150367782-150367804 CTGACTTAACAGAAGACAGGTGG + Intergenic
940985790 2:160050846-160050868 CTGTGTGAACAGCAGACTGGAGG + Intronic
941855119 2:170223085-170223107 AGGAGAGAACAAAAGTCTGGGGG - Intronic
942841852 2:180371524-180371546 CTGAGTGAACAGAAGCTAAGTGG - Intergenic
942979104 2:182057394-182057416 CTGTTTGAACAGAACTCTGAGGG + Intronic
943191684 2:184685773-184685795 ATGAATGAACTGAAGCCTGGGGG - Intronic
943522876 2:188975854-188975876 ATGAGTGAAGAGAAGTCTAAAGG - Intronic
944711208 2:202336465-202336487 CTGAGTGAGCCGTAGCCTGGAGG + Intergenic
946001791 2:216488565-216488587 CTGAGTGAATAGCAGACAGGTGG - Intergenic
1169385610 20:5146803-5146825 CTCACTTAAAAGAAGTCTGGAGG + Intronic
1170084268 20:12511723-12511745 CTGAGTGAAGAGAAGTAATGAGG - Intergenic
1170264848 20:14454519-14454541 TTGCATAAACAGAAGTCTGGTGG + Intronic
1172767762 20:37359773-37359795 CTGTGTGAAGAGCAGACTGGGGG + Intronic
1173350147 20:42237430-42237452 CTGTGTTCACAGAAGTCTGGGGG + Intronic
1175974777 20:62705222-62705244 CTGAGGGAAGAGAAGGTTGGAGG + Intergenic
1176839113 21:13824113-13824135 ATGAGTCAACAGAAGTTTGCAGG + Intergenic
1178456590 21:32759724-32759746 CTGAGGGAACAGAAAGCTAGCGG + Intronic
1178696392 21:34796473-34796495 CTGATTCAGCAGAAGTGTGGGGG + Intronic
1180261796 21:46675258-46675280 CAGAGGGAACAGAAGGTTGGAGG - Intergenic
1180697356 22:17760605-17760627 CTGAGGGAACTGAATTGTGGTGG - Intronic
1182485615 22:30636872-30636894 CAGGGTGAACAGAGGTGTGGTGG - Exonic
1182574935 22:31266648-31266670 CTGAGTGAACAGAAGTCTGGGGG - Intronic
1183095294 22:35548399-35548421 CTGACTCAACAGAAGACTTGGGG - Intronic
1183319449 22:37156152-37156174 CAGAGGGAACAGGAGGCTGGAGG - Intronic
1185059491 22:48598853-48598875 CTGACTGAATATAAGTCAGGGGG + Intronic
950297343 3:11843325-11843347 CCTAGTGATCAGAACTCTGGGGG + Intronic
952384799 3:32832518-32832540 CTGAATGAACAGTACTCTTGGGG + Intronic
954673978 3:52305569-52305591 CTCACTGGTCAGAAGTCTGGGGG + Intergenic
956718194 3:72096693-72096715 CTGGGTGAACAGGAGCATGGTGG - Intergenic
959874505 3:111366235-111366257 CTGAGAGTGCTGAAGTCTGGGGG - Intronic
959980819 3:112514920-112514942 CTGAGTGACCAGAGGCCTTGTGG - Intergenic
960673981 3:120177230-120177252 CTGAGGGAGCAGAGGGCTGGGGG + Intronic
961557721 3:127708039-127708061 CTGAGTGAGCAGGACTATGGGGG - Intronic
962109396 3:132428124-132428146 ATGAGTGAAGACAAGTCTAGAGG - Intronic
971435905 4:26623180-26623202 CAGACAGAACAGAAGTCTGTTGG - Intronic
975464294 4:74692027-74692049 CTGAGGAACCAGAAGTCTGCAGG - Intergenic
976034994 4:80807102-80807124 CTGAATGAACAGAAATCTGCAGG + Intronic
977532293 4:98214523-98214545 CTGGGTGAACACAAATGTGGGGG + Intergenic
980916161 4:139035091-139035113 CTGAGCGACCAGAAGGATGGAGG - Intronic
982165896 4:152613495-152613517 ATGAGTGAAAAGAAGGCTGTTGG + Intergenic
983071231 4:163270188-163270210 GTGAGAGAAGAGAGGTCTGGAGG + Intergenic
983991330 4:174123629-174123651 CTGAATGAACAGCAATCTTGGGG + Intergenic
985880704 5:2636862-2636884 CTTGGTGAAGAGAAGTCTCGGGG + Intergenic
985882850 5:2653601-2653623 CTGGCTGAACAGACCTCTGGGGG + Intergenic
986171803 5:5320451-5320473 CTGAGTGAAGAGGAGGCTGCAGG + Intergenic
986789059 5:11143041-11143063 CTGAGTGAGCAGAAGTCAAGGGG - Intronic
986789985 5:11150145-11150167 CTGACTCAACAGTAGTGTGGGGG - Intronic
986798841 5:11239445-11239467 CTGGGAGAACAGAAGTGGGGAGG - Intronic
986978103 5:13415842-13415864 CTGAGTGAACATTTGTCTAGAGG - Intergenic
987249954 5:16089871-16089893 GTGAGAAAACAGAAGTATGGAGG + Intronic
987723282 5:21664991-21665013 GTGAGTGAATATAAGGCTGGAGG - Intergenic
990240235 5:53809852-53809874 CTGAGTGAAAAGAAAGTTGGAGG - Intergenic
994745377 5:103671338-103671360 CTAAGTTAACAGAAATGTGGAGG + Intergenic
995254927 5:110035210-110035232 CTGGGTGCTCAGAAGGCTGGTGG + Intergenic
995578947 5:113574241-113574263 CTGAGGCAACTGAGGTCTGGTGG - Intronic
996033131 5:118729005-118729027 CTGAAAGAGCAGAAGTCAGGGGG - Intergenic
997177610 5:131796328-131796350 CTGAGTTGAGAGAAGGCTGGAGG - Intronic
997353741 5:133249014-133249036 CTGAGAGAACAGTGGGCTGGGGG - Intronic
998443734 5:142182591-142182613 ATGCTTGAACAGATGTCTGGAGG + Intergenic
998527992 5:142860047-142860069 CCCAGTGCACAGAATTCTGGTGG - Intronic
999246461 5:150157624-150157646 CTCTGTGAACAGGGGTCTGGGGG - Intergenic
999402004 5:151272155-151272177 ATTAGTGAACAGAAGTATGATGG + Intergenic
1000626590 5:163546287-163546309 CTGGTTGAACTGAAGTCAGGAGG - Intergenic
1002393834 5:178938076-178938098 TTGGGTGAACAGAAGACGGGAGG + Intergenic
1003559766 6:7170891-7170913 CTGAGTTAACAGCTCTCTGGAGG - Intronic
1003684340 6:8286140-8286162 TTGAGTGAACAGAAGAATAGAGG - Intergenic
1004878369 6:19979190-19979212 GAGAGTGAAGATAAGTCTGGAGG - Intergenic
1005375200 6:25174841-25174863 CTGCGTGAAGAGAAGCCTGTGGG + Intergenic
1012549062 6:100451201-100451223 CTGAGTGACCGGAGGCCTGGGGG + Intronic
1013339740 6:109201801-109201823 ACAAGTGAACACAAGTCTGGCGG + Intergenic
1015594328 6:134851737-134851759 GTGAGTTAACAGAAGGCAGGCGG + Intergenic
1017086583 6:150718231-150718253 CTGCATGAACAAAAGCCTGGTGG + Intronic
1017525086 6:155235345-155235367 AGGAGTGCACAGAAGGCTGGGGG + Intronic
1019477462 7:1250951-1250973 CAGAGTGAAGTGAAGTCAGGGGG - Intergenic
1021397796 7:20171898-20171920 GTGAGTTACAAGAAGTCTGGAGG + Intronic
1022352122 7:29576245-29576267 CTGATGGAATAGAAGTCTGATGG - Intergenic
1024230095 7:47357363-47357385 GTGAATGAGCTGAAGTCTGGAGG - Intronic
1026131836 7:67627380-67627402 TTGAGAAAACAGAAGTATGGAGG + Intergenic
1029126962 7:98301153-98301175 CTGTGTTGACAGAAGTCTGCTGG + Intronic
1030667841 7:112300797-112300819 CTGAGTGACCAGGAGAATGGTGG - Intronic
1030692990 7:112553824-112553846 CTCAGTGAAAAGAAATTTGGAGG - Intergenic
1030957150 7:115868391-115868413 GTGAGTAACCAGAAGTCTGGGGG + Intergenic
1033303987 7:140210870-140210892 CTGCAGGAACAGAAGCCTGGAGG + Intergenic
1033849082 7:145472466-145472488 CTGAGTAGACAGAAGACTGTGGG - Intergenic
1034198524 7:149266199-149266221 CTGAGTTAGCAGCAGACTGGGGG - Intronic
1034776764 7:153834677-153834699 TTGAGTAAACTGAAGTCAGGAGG + Intergenic
1035692368 8:1568598-1568620 CTGAGTGAACAGTGGCATGGGGG - Intronic
1036466990 8:9007711-9007733 CTAAGTAAAAAGAAGACTGGTGG - Intronic
1039288523 8:36068806-36068828 CTCAGTGTCCAGAAGGCTGGTGG - Intergenic
1039442950 8:37608024-37608046 CCGAGTGATCAGGAGTCTGGGGG + Intergenic
1041410191 8:57545117-57545139 CTGTGTGAACAGAATTGTGGGGG + Intergenic
1044340318 8:91040133-91040155 CTGAGTGAACAGAGCACTGTTGG + Intronic
1046350621 8:113006341-113006363 CAGAGTTAAAAGAAGACTGGTGG + Intronic
1046681973 8:117180602-117180624 CTGAGTGAATATAAGGCTAGAGG - Intergenic
1049291107 8:141802512-141802534 CTGAGAGAACAGGGGCCTGGAGG - Intergenic
1049344214 8:142129854-142129876 CTGAGTGCACAGGGGCCTGGAGG - Intergenic
1051452945 9:17217433-17217455 CTGAGTGAACAGTGGCCTGTGGG + Intronic
1051454403 9:17237888-17237910 TTGAGAGAACTGAATTCTGGTGG + Intronic
1052508036 9:29380406-29380428 CTGTATGAACAGCAGTCTCGGGG - Intergenic
1053669942 9:40350064-40350086 ATGAGTCAACAGAAGTTTGCAGG - Intergenic
1053919736 9:42976316-42976338 ATGAGTCAACAGAAGTTTGCAGG - Intergenic
1054381070 9:64490065-64490087 ATGAGTCAACAGAAGTTTGCAGG - Intergenic
1054514671 9:66026233-66026255 ATGAGTCAACAGAAGTTTGCAGG + Intergenic
1056319376 9:85421951-85421973 CTGGGTGAAGGGAAGTTTGGTGG + Intergenic
1059742344 9:117164412-117164434 AAAAGTGAACAGAAGCCTGGAGG + Intronic
1060268776 9:122127142-122127164 CTGAGAGAACACAGGTTTGGGGG + Intergenic
1061845183 9:133383982-133384004 CTGGATGAAGAGAAGGCTGGAGG + Intronic
1062452779 9:136622524-136622546 CTGAGTGAGCCGAGGGCTGGGGG + Intergenic
1186336922 X:8599329-8599351 TTTGGTGAACAGAAGTCTAGGGG + Intronic
1186721286 X:12307050-12307072 CTGAATGAACACAAATATGGAGG + Intronic
1191901236 X:66042601-66042623 TTGAGAGAACTGAGGTCTGGAGG + Intergenic
1192019825 X:67376308-67376330 CTGAGGGAACAGCAGTCTATAGG + Intergenic
1192292863 X:69815723-69815745 CTGAGTCAACTGAACTGTGGAGG - Intronic
1192868119 X:75157522-75157544 CTGAGTGAACAGAGACCTGATGG + Intergenic
1193021790 X:76799974-76799996 CAGAGTTACCAGAAGTCTTGGGG + Intergenic
1195565008 X:106330526-106330548 CTCAGTGAACAGGAGCCTGCAGG + Intergenic
1200690457 Y:6303510-6303532 GTGAGTGAACACAGGTCTGAGGG + Intergenic
1200814811 Y:7520167-7520189 CTGATTGGACAGCAGTCTGCAGG + Intergenic
1201044817 Y:9871206-9871228 GTGAGTGAACACAGGTCTGAGGG - Intergenic