ID: 1182575195

View in Genome Browser
Species Human (GRCh38)
Location 22:31268190-31268212
Sequence GGTGGGACTCACCATTCCGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 61}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182575195_1182575204 7 Left 1182575195 22:31268190-31268212 CCTCCGGAATGGTGAGTCCCACC 0: 1
1: 0
2: 0
3: 8
4: 61
Right 1182575204 22:31268220-31268242 CTGCCAGCAGGGCGAGAGTAGGG 0: 1
1: 0
2: 0
3: 14
4: 164
1182575195_1182575208 27 Left 1182575195 22:31268190-31268212 CCTCCGGAATGGTGAGTCCCACC 0: 1
1: 0
2: 0
3: 8
4: 61
Right 1182575208 22:31268240-31268262 GGGAGAGGTGTGAGAATTGTGGG 0: 1
1: 0
2: 1
3: 34
4: 440
1182575195_1182575200 -4 Left 1182575195 22:31268190-31268212 CCTCCGGAATGGTGAGTCCCACC 0: 1
1: 0
2: 0
3: 8
4: 61
Right 1182575200 22:31268209-31268231 CACCAACAAACCTGCCAGCAGGG 0: 1
1: 0
2: 2
3: 14
4: 185
1182575195_1182575207 26 Left 1182575195 22:31268190-31268212 CCTCCGGAATGGTGAGTCCCACC 0: 1
1: 0
2: 0
3: 8
4: 61
Right 1182575207 22:31268239-31268261 AGGGAGAGGTGTGAGAATTGTGG 0: 1
1: 0
2: 3
3: 47
4: 517
1182575195_1182575199 -5 Left 1182575195 22:31268190-31268212 CCTCCGGAATGGTGAGTCCCACC 0: 1
1: 0
2: 0
3: 8
4: 61
Right 1182575199 22:31268208-31268230 CCACCAACAAACCTGCCAGCAGG 0: 1
1: 0
2: 1
3: 13
4: 163
1182575195_1182575203 6 Left 1182575195 22:31268190-31268212 CCTCCGGAATGGTGAGTCCCACC 0: 1
1: 0
2: 0
3: 8
4: 61
Right 1182575203 22:31268219-31268241 CCTGCCAGCAGGGCGAGAGTAGG 0: 1
1: 1
2: 5
3: 16
4: 192
1182575195_1182575206 12 Left 1182575195 22:31268190-31268212 CCTCCGGAATGGTGAGTCCCACC 0: 1
1: 0
2: 0
3: 8
4: 61
Right 1182575206 22:31268225-31268247 AGCAGGGCGAGAGTAGGGAGAGG 0: 1
1: 0
2: 2
3: 68
4: 794

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182575195 Original CRISPR GGTGGGACTCACCATTCCGG AGG (reversed) Exonic
901706392 1:11076661-11076683 GGTGGCACTGACCACTCTGGAGG - Intronic
903229625 1:21913854-21913876 GGTGGGACTAACCCAGCCGGAGG + Intronic
905952672 1:41964947-41964969 GGTGGGTCTCACCAGTCAGGAGG - Intronic
906293088 1:44632375-44632397 GGCAGGACTCACCATTCAGTCGG - Exonic
915083131 1:153365735-153365757 GTTGGGACTCTGCATTCCGTGGG - Intergenic
915587012 1:156849378-156849400 CGCGGGGCTCACCATTCCCGTGG - Exonic
921066382 1:211625365-211625387 GGTGGGACTCAGGGTGCCGGGGG + Intergenic
1064347855 10:14548847-14548869 GGGGGGACTCAGCATTCAGTCGG - Intronic
1064977693 10:21135737-21135759 GAGGGGACTCACCATCCCAGTGG + Intronic
1069638697 10:69941306-69941328 GGCTGGACTCAGCATTCCTGTGG - Intronic
1075444979 10:122506791-122506813 GGTGGTGCTCACGATCCCGGTGG - Exonic
1075511299 10:123074691-123074713 GGTGGGCCTCATTATTCCTGGGG - Intergenic
1077556594 11:3228950-3228972 GGAGGGTCTCACCATTCCCTTGG - Intronic
1079450669 11:20597740-20597762 GGTGGGACTGAGAATTCCGCAGG - Intergenic
1084939553 11:72605187-72605209 GCTGGGACTCACCATCCAGTAGG + Exonic
1085478999 11:76806316-76806338 GGTGGGACTCACCTCTCCACAGG - Intergenic
1087651706 11:100875583-100875605 GATGAGACCCACCATTCCAGGGG + Intronic
1088220644 11:107566604-107566626 TGTGGTACTCACCATTCCCCTGG - Intergenic
1090860935 11:130651742-130651764 GGTGGCACTCAGCATTTCGCTGG + Intergenic
1091976556 12:4830469-4830491 AGTGGGACTCACCACTGCAGGGG - Intronic
1092726552 12:11491925-11491947 GGTGGGAGACACCATGCCGTGGG - Intronic
1096453814 12:51769122-51769144 TCTGGAAGTCACCATTCCGGTGG - Exonic
1103613718 12:122139293-122139315 GGTGGCACTCACCCTCCCTGTGG - Intronic
1118819349 14:69334848-69334870 GGTGGGGAGCACCATTCTGGGGG + Intronic
1119310832 14:73645032-73645054 AAAGGTACTCACCATTCCGGCGG - Exonic
1121211600 14:92211555-92211577 GGGGGGCCTCACCATTATGGTGG + Intergenic
1124047267 15:26161773-26161795 GGCTGGACTCAGCATTCTGGTGG + Intergenic
1126265898 15:46753596-46753618 GGTGGGACTTACATTTCAGGCGG + Intergenic
1131259950 15:90883017-90883039 AGTGGGGCTCGCCATGCCGGGGG + Exonic
1136379868 16:29888278-29888300 TTTGGGAGTCACCATTCTGGAGG - Intronic
1137748302 16:50839981-50840003 GGTTGGCATCACCATTCCGGGGG + Intergenic
1142172557 16:88630571-88630593 GGTGGGACTCACCTGTCAGCCGG - Exonic
1147189590 17:38730785-38730807 GGGGGGACTCACCAGCCAGGAGG - Exonic
1155062655 18:22242428-22242450 GGTGGGAGTCACGATCCCTGGGG - Intergenic
1167298806 19:48667453-48667475 GGTGAGACTCACCAGGCCTGAGG - Intronic
935595520 2:104874307-104874329 GGAGGGACTCACCCATCCAGAGG + Intergenic
936363982 2:111834821-111834843 GATGAGACTCAACATTCTGGTGG + Exonic
947835513 2:233172119-233172141 GATGGGACACCCCATTCCGCAGG + Intronic
948566759 2:238892150-238892172 GGAAGGACTCACCCTTCCGGTGG - Intronic
949021500 2:241743554-241743576 GTTGGGACTCACCAGCCCGGGGG + Intronic
1170571308 20:17634362-17634384 GGTGGGACCCACCACCCCGCAGG - Intronic
1182575195 22:31268190-31268212 GGTGGGACTCACCATTCCGGAGG - Exonic
1185222420 22:49635837-49635859 GGTGGGACTGCACCTTCCGGAGG + Intronic
950800427 3:15547442-15547464 GGTGGGAGTCACCACCCTGGAGG - Intergenic
953703397 3:45213634-45213656 GCTGGGACTCTCCATTTCAGTGG + Intergenic
967397475 3:189023946-189023968 GGTAGGTCTCACCACTCAGGAGG + Intronic
971330002 4:25674402-25674424 GGTGTAACTCACCAATCAGGGGG - Exonic
971865858 4:32170734-32170756 GGTGTGACCCACCATGCCTGGGG + Intergenic
974699650 4:65424052-65424074 GGTGGGACTCACCATTAGAGTGG - Intronic
986600554 5:9468369-9468391 TGTAGGAGTCACCATTCAGGAGG - Intronic
996431933 5:123390414-123390436 GGTAGGAATAACCATTCCCGGGG - Intronic
997414811 5:133718212-133718234 GGTGGCACACACCACTCGGGAGG - Intergenic
1002172441 5:177382945-177382967 GGTGGGACTCACCACCCAGGGGG + Intronic
1007500307 6:42291982-42292004 GGAGGGACTCACTATGCCAGTGG - Intronic
1008012095 6:46479027-46479049 GGTGGAACTCTCCATTGCTGAGG - Intronic
1025152826 7:56573790-56573812 GGAGGGACTCAGCATTGCTGAGG + Intergenic
1029349159 7:100000764-100000786 GGAGGGTCTCACCATTCGGGAGG - Intergenic
1030851183 7:114488095-114488117 GGGAGGACTCACAATTACGGTGG + Intronic
1034992922 7:155559556-155559578 TGTGTTTCTCACCATTCCGGAGG + Intergenic
1035353018 7:158259582-158259604 AGTGGGACTCACTCTTCCCGGGG + Intronic
1040389932 8:46941151-46941173 AGTGGCACTCACCATTGCTGAGG + Intergenic
1041464523 8:58145624-58145646 GGCGGATCTCACCAATCCGGAGG + Intronic
1045050117 8:98316696-98316718 GGTAGAACTCATCATTCCTGAGG - Intergenic
1048807095 8:138250932-138250954 GGTGGTGCAGACCATTCCGGGGG + Exonic
1053297598 9:36925888-36925910 GGTGGGACTCACACTTCCTGGGG - Intronic
1056786665 9:89597456-89597478 AGTGGGACTCACCTTCCCTGGGG + Intergenic
1056889984 9:90482951-90482973 TGTGTTACTCACCATTCTGGAGG + Intergenic
1061435538 9:130559015-130559037 GGTGGCACACACCGTTCGGGAGG + Intergenic
1185610486 X:1391550-1391572 GCTGGGACCAACCCTTCCGGTGG - Intronic
1191915356 X:66195117-66195139 GGTGGGTGACACCATTCAGGTGG + Exonic