ID: 1182578967

View in Genome Browser
Species Human (GRCh38)
Location 22:31292335-31292357
Sequence GAAGGAGGCAAGGATGCTGT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 544
Summary {0: 1, 1: 0, 2: 5, 3: 53, 4: 485}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182578967_1182578975 27 Left 1182578967 22:31292335-31292357 CCAACAGCATCCTTGCCTCCTTC 0: 1
1: 0
2: 5
3: 53
4: 485
Right 1182578975 22:31292385-31292407 TTTAACCGAGGCCCCCTTGGCGG 0: 1
1: 0
2: 0
3: 4
4: 18
1182578967_1182578974 24 Left 1182578967 22:31292335-31292357 CCAACAGCATCCTTGCCTCCTTC 0: 1
1: 0
2: 5
3: 53
4: 485
Right 1182578974 22:31292382-31292404 GTGTTTAACCGAGGCCCCCTTGG 0: 1
1: 0
2: 0
3: 1
4: 38
1182578967_1182578976 30 Left 1182578967 22:31292335-31292357 CCAACAGCATCCTTGCCTCCTTC 0: 1
1: 0
2: 5
3: 53
4: 485
Right 1182578976 22:31292388-31292410 AACCGAGGCCCCCTTGGCGGCGG 0: 1
1: 0
2: 0
3: 2
4: 87
1182578967_1182578972 15 Left 1182578967 22:31292335-31292357 CCAACAGCATCCTTGCCTCCTTC 0: 1
1: 0
2: 5
3: 53
4: 485
Right 1182578972 22:31292373-31292395 GAACGACCAGTGTTTAACCGAGG 0: 1
1: 0
2: 0
3: 0
4: 20

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182578967 Original CRISPR GAAGGAGGCAAGGATGCTGT TGG (reversed) Exonic
900088137 1:908467-908489 GGAGGAGGCAAAGATACTGAAGG + Intergenic
900352318 1:2241072-2241094 GAGGGAGCCCAGGATGCTGTGGG + Intronic
900588237 1:3444227-3444249 GCAGAAGGCAAGGAAGCAGTGGG - Intergenic
901121990 1:6903262-6903284 GAAAGAGGCAAGGAAGGTTTTGG + Intronic
901518393 1:9764723-9764745 GACAGAGGCAACGATGGTGTGGG - Intronic
901678347 1:10899625-10899647 GAAGGAAGGAAGGGTCCTGTGGG + Intergenic
901763066 1:11483068-11483090 GCCGGAGGCATGGATGCTGCGGG + Intronic
903115494 1:21176158-21176180 GAAGGTGAAAAGGATACTGTTGG + Exonic
903140949 1:21338928-21338950 CAAGGAGGGAAGGGAGCTGTGGG + Intronic
903432712 1:23319718-23319740 GAAGTAGGCAGGGCTTCTGTAGG - Intronic
903451520 1:23456769-23456791 GGAAGAGGCCAGGATGCTATGGG + Intronic
903639383 1:24848256-24848278 GAAGGAGGGAAGGAGGCCGGAGG - Intergenic
903680106 1:25090817-25090839 GGAGCAGGCAAGGCTGCTGCTGG + Intergenic
903742431 1:25565959-25565981 GAAGGAGGCAAGGAAGAGGAAGG - Intronic
904204096 1:28841367-28841389 GCAGGTGGCAAGGAGGCTGGGGG + Intronic
905203990 1:36332437-36332459 GAAGGAGGCAAGGAAGATAATGG - Intergenic
905335760 1:37243655-37243677 GAAGCTGGCAAAGATGCTGGTGG + Intergenic
906189553 1:43887769-43887791 GATGGAGGTGAGGATGATGTTGG + Intronic
907047623 1:51309328-51309350 GCAGGAGGAAAAGATGCTGACGG + Intronic
909253965 1:73394136-73394158 GAAGGAGGCAAGGCCCATGTGGG - Intergenic
909265891 1:73558025-73558047 GAGGGAGGTAAGGAACCTGTTGG + Intergenic
909328244 1:74380117-74380139 GAATGAGGCAAAGATTCTGATGG - Intronic
909981785 1:82111330-82111352 GAAATAGGCAACGATGCTATAGG - Intergenic
909983847 1:82136510-82136532 CAAGGAGGCAACGAGGCTGGGGG - Intergenic
912304457 1:108552667-108552689 GAAGGAGGCAAGGAAGTGGGGGG + Intergenic
912494166 1:110080593-110080615 GAGGGAGGCAAGCCTGCTATAGG + Intergenic
912602590 1:110952273-110952295 GAAGGAGGCAATGATGACGCTGG + Exonic
912895146 1:113578484-113578506 GAAGGATGCAGTGATGCAGTGGG - Intronic
913411425 1:118556136-118556158 GAAAGAGGCAAGAATGCCATCGG + Intergenic
913436526 1:118852764-118852786 CAAGGCGGCAACGAGGCTGTGGG + Intergenic
913583643 1:120251463-120251485 ACAGCAGGTAAGGATGCTGTGGG + Intergenic
913624533 1:120646857-120646879 ACAGCAGGTAAGGATGCTGTGGG - Intergenic
914565631 1:148863299-148863321 ACAGCAGGTAAGGATGCTGTGGG + Intronic
914607194 1:149266953-149266975 ACAGCAGGTAAGGATGCTGTGGG - Intergenic
915894708 1:159802814-159802836 GCAGGAGGGAAGGAGGCTGCTGG + Intronic
916744427 1:167673808-167673830 GAAGGAGGAAGGCATGTTGTAGG - Intronic
916861583 1:168811793-168811815 TAAGGAGGCAAGGGTGCTCATGG + Intergenic
917339554 1:173961093-173961115 GTAGGAGGCAAGGTTGGTGAAGG + Exonic
917536923 1:175881078-175881100 GAGGGAGGCATGGCTGGTGTGGG + Intergenic
918241994 1:182628872-182628894 GAGGGAGGCCAGGGTGCTGTTGG - Intergenic
919785997 1:201259177-201259199 GAGGGAGGCAGGGCTGCAGTGGG + Intergenic
920034911 1:203059457-203059479 GAAGGAGGCAAGGGGGTTATGGG + Intronic
920266918 1:204730883-204730905 GAAGGAGGCAAGGACTCTAGAGG + Intergenic
921692765 1:218170206-218170228 GAAAGAGGCAAGGAGACTGCTGG - Intergenic
922188306 1:223295553-223295575 GAAGGGAGGAAGGGTGCTGTGGG + Intronic
922903279 1:229154862-229154884 GATGCAGGGAAGGAAGCTGTCGG + Intergenic
923318825 1:232808069-232808091 GAAGAAGGCAATGATGATGTTGG + Exonic
924149911 1:241118890-241118912 AAAGGAGGCAAGGAGGCTGAGGG + Intronic
924448538 1:244156939-244156961 GAAGGAGGGAAGGATGGAGGGGG - Intergenic
1062916363 10:1243696-1243718 CATGGGGGCAAGGATGCTGCTGG - Intronic
1065007768 10:21395493-21395515 GAAACAGGCAAGGAACCTGTTGG + Intergenic
1068744007 10:60508496-60508518 GCAGGTGCCATGGATGCTGTTGG - Intronic
1068946074 10:62730030-62730052 GAAGGAAACAAGGAGGCTGTGGG - Intergenic
1069611531 10:69775823-69775845 GAAGGATGCATGGAAGCTGGGGG + Intergenic
1070509464 10:77147415-77147437 GAAGGAGGGAGGGAGGCTGGTGG - Intronic
1070731381 10:78830981-78831003 GAAGGAGGCAGGAAGACTGTGGG - Intergenic
1070811177 10:79298813-79298835 GAAGGATGCAAGGAGGCGGGTGG + Intronic
1071158018 10:82713474-82713496 AAAGGAGTCATGGATGCTTTTGG + Intronic
1071213252 10:83368747-83368769 GAAGGAGCCAAGGATGGAGGAGG - Intergenic
1071359334 10:84830221-84830243 TAAGGAGGTAAGGATGATGAGGG - Intergenic
1071381585 10:85068591-85068613 GAGGGAGGTGAGGATGCTGCAGG + Intergenic
1071922263 10:90363953-90363975 GAAGGAAAAAAGTATGCTGTGGG - Intergenic
1072633853 10:97164900-97164922 GAAGGAGAGAAGGAAGCAGTGGG + Intronic
1073205867 10:101769043-101769065 GAGGGAGGGAGGGCTGCTGTGGG - Intergenic
1074454772 10:113587636-113587658 GAAGGTGGCGAGGATGATGATGG - Intronic
1074715134 10:116211330-116211352 GAAGGAGAGAGGGATCCTGTGGG - Intronic
1075241880 10:120786613-120786635 GTGGGAGGCAGAGATGCTGTAGG - Intergenic
1075329163 10:121560275-121560297 GCTGGAGGCAAAGATGCTGAGGG - Intronic
1075581694 10:123623637-123623659 GAAGAAGGCAATGATGATGGTGG + Intergenic
1075792393 10:125094437-125094459 CAAGGAAGCAACGATGATGTGGG + Intronic
1075879599 10:125839399-125839421 GCAGGTGGCATGGGTGCTGTCGG - Intronic
1076634035 10:131871166-131871188 GTTGGAGGCATGGATGCTCTGGG - Intergenic
1076681655 10:132175332-132175354 GAAGGAGACAAGGATGTTCTTGG - Intronic
1076744849 10:132507706-132507728 GAAGGAGGGAAGGAAGCTTTGGG + Intergenic
1076995548 11:295896-295918 GAAGGAGGCAAGGACGCCTGTGG + Exonic
1077838618 11:5947630-5947652 GAAGCAGGCAGGGAAGCTGATGG - Exonic
1079307274 11:19334285-19334307 GATGGAGGGAAGGATGATATGGG + Intergenic
1079348698 11:19674729-19674751 GAAGGAGGGAAGTATCTTGTGGG - Intronic
1079351729 11:19697604-19697626 GAGGGAGGCAAGGATGGGGCAGG + Intronic
1080636132 11:34125251-34125273 GGAGGAGGAAAGGCTGCTGTTGG + Intronic
1080865630 11:36192363-36192385 GATGGAAGCACAGATGCTGTGGG + Intronic
1083596076 11:63918810-63918832 GAAGGAGGCAAGGGGGATGGGGG - Intergenic
1083994227 11:66264256-66264278 GAGGGAGGCAGGGATGAGGTTGG + Intronic
1084155249 11:67309644-67309666 GAAGGAGGGAAGGACACTGAGGG - Intronic
1085082400 11:73645906-73645928 GAAGGAAGAAAGGAAGCAGTGGG - Intergenic
1086539205 11:87887315-87887337 GAAGAGGGCAAGGATGCTCAGGG - Intergenic
1086838059 11:91650951-91650973 GGAGAAGACAATGATGCTGTTGG - Intergenic
1088558988 11:111093227-111093249 GAAGGTGGCAAGGGTTGTGTAGG + Intergenic
1088976780 11:114822837-114822859 GAAGGAGGCAGGGAGCGTGTAGG - Intergenic
1089169190 11:116500491-116500513 GAAGGTGGCCGGGAGGCTGTGGG - Intergenic
1089278829 11:117358328-117358350 GAGGGAGACAAGCATGCTGAGGG - Intronic
1089299449 11:117489818-117489840 CAAGGAGGCAAGGACGCTGCCGG - Intronic
1089695026 11:120211470-120211492 GAAGGAGACGAGGGTGCCGTCGG - Exonic
1090234690 11:125139010-125139032 GAAGGAATCAAGGTTGCTGAAGG - Intergenic
1090355817 11:126139759-126139781 GAAGGAGCCATGGAGGCTGAGGG - Intergenic
1091118241 11:133035052-133035074 GCGGGAGGAAAGGATGCTCTGGG + Intronic
1091301580 11:134511184-134511206 GTGGCCGGCAAGGATGCTGTGGG + Intergenic
1091532347 12:1371515-1371537 GAAGGGGTGAATGATGCTGTTGG + Intronic
1091532357 12:1371607-1371629 GAAGGGGTGAATGATGCTGTTGG + Intronic
1091840877 12:3619704-3619726 GAAGGAGGCATGCAGCCTGTTGG - Intronic
1091859350 12:3765448-3765470 GAGGAAAGCAAGGATGCTGCAGG + Intergenic
1093047932 12:14471945-14471967 GAAAAAGGCAATGATGCTCTTGG + Intronic
1093643402 12:21554321-21554343 GCAGGAAGGAAGGATGATGTAGG - Intronic
1093732806 12:22585475-22585497 GAAGGATGCAAGGAGACTGTTGG - Intergenic
1096226010 12:49867381-49867403 GAAGGAGGCAAGGAGCCTTTTGG + Exonic
1096751508 12:53761721-53761743 AAAGGAGGGAAGGATGCTGGAGG - Intergenic
1096904107 12:54917281-54917303 AAAGAAGGCAAGGAGGGTGTGGG + Intergenic
1097157831 12:57025756-57025778 GCAGGAGCCAAGGATGGTGGGGG + Intronic
1097233845 12:57526998-57527020 GAAAGAGGCAAGGAGGTTGCTGG - Exonic
1097672533 12:62557234-62557256 GAAGGATGACAGGATGTTGTTGG + Intronic
1098182453 12:67862406-67862428 CCAGGAGGCAAGGATGATGGGGG - Intergenic
1099385516 12:82008246-82008268 GGAGAAGGAAAAGATGCTGTAGG + Intergenic
1099869677 12:88331127-88331149 TAAGGAGGCTAGGAAGCTGATGG + Intergenic
1100962932 12:99984255-99984277 GAGGGGGGCAAGGACTCTGTGGG - Intronic
1101625284 12:106434778-106434800 GAAGGAGGAAAGGATGCTGGAGG - Intronic
1101976456 12:109363786-109363808 GGAGGAGGCATAGATGCTGGTGG + Intronic
1102042754 12:109811072-109811094 GAGGGAGGGAAGGGTGTTGTAGG - Intronic
1102799296 12:115717577-115717599 GAAGGGGACAGGGATGCTCTGGG + Intergenic
1103995798 12:124829271-124829293 GATGGGGGCCAGGATGGTGTTGG - Intronic
1104647380 12:130506868-130506890 GAGGGAGGGAAGGATTCTCTAGG - Intronic
1104993628 12:132640869-132640891 GAAAGAGGCAGGGAGGCAGTTGG - Intronic
1107229010 13:38086144-38086166 GAAGGAGGCCAGGGGGCTGAGGG + Intergenic
1107833928 13:44398567-44398589 GAAGGGGGAAGGGATGCTTTTGG - Intergenic
1108010310 13:46000496-46000518 GAAAGAGGTAAGGAAGCTGCAGG - Intronic
1108063220 13:46553257-46553279 GAAGGAGGGGAGGAGGGTGTGGG - Exonic
1108554566 13:51580488-51580510 GAGAGAGGCAAGGATGCCATGGG + Intergenic
1108681036 13:52780341-52780363 GATGGAGGCATGGAGACTGTGGG - Intergenic
1108908427 13:55509359-55509381 GAAGGAAGGAAGGAAACTGTGGG + Intergenic
1108926026 13:55746382-55746404 GAAGGTGGCTAGGCTGCTGTAGG - Intergenic
1109847350 13:68012738-68012760 GAAAGAGGAAAGAATACTGTTGG + Intergenic
1114386742 14:22262883-22262905 GTAGGAGGTAAGGGTGATGTTGG + Intergenic
1114542780 14:23474801-23474823 GAAGAGGCCAAGGATGCTGCTGG + Intronic
1114650892 14:24284057-24284079 TGAGGGGGCAAGGATGCTCTTGG + Intergenic
1116116464 14:40658022-40658044 GAAGCTGGGAAGGATGCTGGAGG - Intergenic
1117369383 14:55062849-55062871 GAAGGAGGAAAGGGTGCTGGGGG - Exonic
1117406148 14:55405962-55405984 GGATGAGGAAAGGATGATGTGGG + Intronic
1118071237 14:62248731-62248753 TAAGGAGACAAGGAGCCTGTGGG + Intergenic
1118223254 14:63875468-63875490 GAAGGAGGAAGTGATGGTGTTGG - Intronic
1119057583 14:71438837-71438859 GAGGGAGGCAAGTAAGCTGCAGG - Intronic
1119180344 14:72600930-72600952 GAAAGAGGCAAAGATGAAGTGGG + Intergenic
1119202888 14:72771526-72771548 GAATGTGACAAGGATGGTGTGGG - Intronic
1119657327 14:76426270-76426292 GAAGGAGGGCAGGAGTCTGTGGG + Intronic
1120077322 14:80173307-80173329 GAAGGAAGCAGGCATGGTGTGGG + Intergenic
1120145886 14:80978055-80978077 GGAGGAGGCAAGGAAGATGAAGG - Intronic
1120585965 14:86312639-86312661 CAAGGCGGCAAGGAGGCTGGGGG + Intergenic
1121039404 14:90732938-90732960 GGAATAGGAAAGGATGCTGTGGG - Intronic
1121267730 14:92615323-92615345 GGAGGTGGCAAGGATGGGGTCGG - Intronic
1121965570 14:98301068-98301090 GAAGTTGGCAAGGAGGCAGTGGG + Intergenic
1122147905 14:99704756-99704778 GAAAAAGTCAAGGGTGCTGTGGG + Intronic
1122290647 14:100678669-100678691 GGTGGAGGCAGGAATGCTGTGGG + Intergenic
1122359265 14:101149990-101150012 GCAGGAGGCAAGTCTGCTCTCGG + Intergenic
1124220539 15:27846773-27846795 GGAGGAGGAAAGGATGTTGAAGG + Intronic
1126800192 15:52291258-52291280 GAAGGTGGCCTGGATGCTGAGGG + Intronic
1127667134 15:61158844-61158866 GATGAAGGCAAGGATGAAGTGGG + Intronic
1127892687 15:63269247-63269269 GAAGGAGGTAAGGATGAAGGTGG - Intergenic
1127958498 15:63873263-63873285 GAAGGAAGCAAGGAAGCTGTGGG - Intergenic
1128565857 15:68700082-68700104 GAAGGAGGCAGGGAGGCCGTGGG - Intronic
1129503720 15:76063578-76063600 GGAGGAGGAAAGGATGCTGTGGG - Intronic
1129516645 15:76161341-76161363 GAAGGGAGGAAGGATGCTATGGG + Intronic
1129882377 15:79015950-79015972 GGAGAAGGCAAGGCTGCTGGCGG + Intronic
1130566942 15:85004254-85004276 AAATGAGGCAAGGATGTTGCTGG - Intronic
1130663031 15:85845555-85845577 GAAGGAGGCAAGGGGGCTTTGGG + Intergenic
1130694297 15:86114757-86114779 GAAGTGGGCAAGCATGGTGTGGG - Intergenic
1131626365 15:94124692-94124714 GAAGGAGCCGAGGAAGCTTTTGG - Intergenic
1131816735 15:96229379-96229401 TAAGGGGACAAGGATGGTGTGGG - Intergenic
1132501504 16:286483-286505 GAGGGAGGCAGGGGTGGTGTGGG + Intronic
1132575118 16:660582-660604 GAAGGAGACCCGGATGCTGCTGG - Intronic
1132802478 16:1761189-1761211 GAAGGAGGCAGGGAGGGTGAGGG - Intronic
1132882373 16:2168122-2168144 GGAGTAGGCAAGGGTGCTGGAGG - Exonic
1133002395 16:2857964-2857986 GAAGGAGGGAAGGAGGGTGGAGG + Intronic
1134109531 16:11506603-11506625 GGAGGAAGCAAGGGTGCAGTGGG - Intronic
1136293527 16:29289617-29289639 GAAGGGGTCAAGGGTGCAGTGGG + Intergenic
1136580802 16:31149801-31149823 GACGGAGGCTAGGAGGCTGGGGG - Intronic
1137024529 16:35459481-35459503 GGAGGAGGCACAGATGCTCTGGG - Intergenic
1137409179 16:48213527-48213549 CAAGGAGGCCAGCATGCTGAAGG + Exonic
1137606058 16:49787626-49787648 GCAGAAGGCAAGGGTGGTGTTGG - Intronic
1137738680 16:50743080-50743102 GAAGGTGGCAGGGATGATGGGGG - Intronic
1137860481 16:51841727-51841749 GAAGGAGCCAAGGTGGCTGGTGG + Intergenic
1137942058 16:52698064-52698086 GAAGGAGGTAATGTGGCTGTGGG - Intergenic
1138103646 16:54274823-54274845 GAATGGGGCTGGGATGCTGTGGG - Intergenic
1139732043 16:68954270-68954292 GAAGGAGGAAAGAGTGTTGTAGG + Intronic
1140211625 16:72975083-72975105 GAAGGGGGCATGGATTCTGCTGG + Intronic
1140252273 16:73304605-73304627 GAAGGGGGCAGGGATGCTGTGGG - Intergenic
1140561129 16:75982967-75982989 GACAGAGACAAGAATGCTGTTGG - Intergenic
1142006735 16:87692831-87692853 GAAGCAGGTACGGACGCTGTGGG - Intronic
1142099406 16:88263623-88263645 GAAGGGGTCAAGGGTGCAGTGGG + Intergenic
1143152277 17:4815076-4815098 GAAGGATGCATGGATGATGCAGG + Intronic
1143247368 17:5498316-5498338 GACGGAGGAAAGGAAGCTGGGGG + Intergenic
1143254204 17:5543716-5543738 GCAGGAGGCAAGGGGTCTGTGGG + Intronic
1143413380 17:6726457-6726479 GAAGGAGGAAAAGATGCTGATGG + Intergenic
1145109078 17:20145784-20145806 GAAGGAAGGAAGGAAGATGTGGG + Intronic
1145204554 17:20976042-20976064 GGAGGAGGAAAAGATGCTTTTGG - Intergenic
1145812156 17:27770960-27770982 GGAGGAGGAACGGCTGCTGTTGG - Exonic
1147611922 17:41806883-41806905 GAAGGAGGGAAGGACGGGGTGGG + Intronic
1147793719 17:43028355-43028377 GAAAGGGGCATGGAGGCTGTGGG - Intronic
1148124025 17:45227851-45227873 CAAGGGGGCAAAGAAGCTGTAGG + Intronic
1148150028 17:45391451-45391473 GAAGGAGGCAGGAAGACTGTTGG + Intergenic
1148778048 17:50106765-50106787 GCAGGAAGGGAGGATGCTGTTGG - Intronic
1148968518 17:51458501-51458523 GAAGGAGGCAAGGTGGGGGTGGG + Intergenic
1149363701 17:55919825-55919847 GAAGGACACAAGGAAACTGTTGG + Intergenic
1149851901 17:60042342-60042364 ACAGGACGCAAGGATGCTGACGG - Intergenic
1150739208 17:67765977-67765999 GGAGGCAGTAAGGATGCTGTGGG - Intergenic
1150816547 17:68396507-68396529 GGAGGAGGCAAGGAGGCGGAAGG + Intronic
1150917563 17:69451951-69451973 GTGGGTGGCAAGGAGGCTGTTGG + Intronic
1151115837 17:71733902-71733924 GGAGGAGGGAAGAATGCTTTAGG - Intergenic
1152204716 17:78968360-78968382 GAGGGAGGAAAGGATGATTTGGG - Intergenic
1153020599 18:625490-625512 TAAGGAGGCAAGCATGTTGAAGG - Intronic
1153488163 18:5622748-5622770 GAAGGAGACCAGGAGTCTGTGGG - Intronic
1153617571 18:6948530-6948552 AATGCAGGCAGGGATGCTGTGGG + Exonic
1154489528 18:14908993-14909015 GAAGGAGACAGGGAAGCTGTCGG + Intergenic
1155336502 18:24770422-24770444 GTAGGAGGCAGGCAAGCTGTGGG - Intergenic
1155491393 18:26405134-26405156 GGAGGAGGAAAGGATGGTATTGG - Intergenic
1155684881 18:28536393-28536415 GAAGGAAGGGAGGATGGTGTGGG + Intergenic
1156031006 18:32712355-32712377 GTATGAGGCAGGGAAGCTGTGGG - Intronic
1156488392 18:37481295-37481317 GTAGGAGGCAAGGAAGCAGTGGG - Intronic
1156625288 18:38901003-38901025 GAAGAAGGCAAGAAGGGTGTGGG + Intergenic
1156826352 18:41434502-41434524 GAAGGAGGGAGGGATGATGTGGG + Intergenic
1157338094 18:46756195-46756217 GAAGCAAGCAAGGATGCTCTTGG + Intronic
1158133362 18:54177877-54177899 GCAGGAGTCAGGGATGCAGTGGG + Intronic
1158206546 18:54999919-54999941 GAAGGAGGAAAGGAGCCCGTTGG - Intergenic
1158408803 18:57186450-57186472 GGAGGAGGCAAGGTTGCTGGTGG + Intergenic
1160427387 18:78787652-78787674 GAAGGAGGCACAGGTGCTCTCGG - Intergenic
1161188522 19:2939282-2939304 CAAGGAGGCAAGGTTCCTGCAGG + Exonic
1161266196 19:3365925-3365947 GAAGGGAGCCAGGGTGCTGTGGG + Intronic
1161741178 19:6022038-6022060 CAAGGAGGCGAGGACGCAGTGGG + Intronic
1162105504 19:8367338-8367360 GAAGGGGGCAGGGGTTCTGTGGG + Intronic
1162126072 19:8500079-8500101 GAGGGGGTCAAGGATGCTGGGGG - Intronic
1162572575 19:11481543-11481565 GAAGGAGACTGGGACGCTGTTGG + Intronic
1162826957 19:13258696-13258718 GAGGGAGGTGAGGATGCTGAGGG + Intronic
1163323467 19:16587977-16587999 GTGGGAGGGAAGGACGCTGTGGG - Intronic
1163468455 19:17483376-17483398 GAGGGAGGCAATGAGGCTGCTGG + Intronic
1164103874 19:22085904-22085926 GAAAGTGGCAAGATTGCTGTAGG - Intronic
1164347673 19:27286125-27286147 CAAGGGGGCAAGGACGCTGTGGG - Intergenic
1164484507 19:28643329-28643351 AAATGAGGCAAGGCTGCTTTAGG - Intergenic
1164651371 19:29893156-29893178 GTAGGAGGCATGGCTGCTGTGGG + Intergenic
1164802695 19:31090767-31090789 GAAGGAGGAAAGGAAGAGGTAGG + Intergenic
1164912141 19:32021557-32021579 GAAGAAGGCAAGGGAGATGTGGG - Intergenic
1165802426 19:38561327-38561349 GAAGTACTCAAGGATGCTCTCGG - Exonic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1167087453 19:47320100-47320122 GAGGGAGGGCAGGATGCTGCAGG - Exonic
1167488897 19:49780603-49780625 GAGGGAGGCAAGAAGGCTGGAGG + Intronic
1168686531 19:58352540-58352562 GGAGCAGGCAAGGACTCTGTGGG + Exonic
1202646240 1_KI270706v1_random:144638-144660 GAAGGAGGCCAGGGAGTTGTTGG - Intergenic
1202649149 1_KI270706v1_random:165142-165164 GATTGTGGCAAGGATGCTGCTGG + Intergenic
925188895 2:1867377-1867399 GCAGGAGGCAAGGGCGCTGTGGG - Intronic
925396696 2:3538445-3538467 GAATGGGGAGAGGATGCTGTGGG - Intronic
925906921 2:8545168-8545190 GAAGGCGGGGAGGATGCTGTGGG + Intergenic
926150562 2:10423389-10423411 CAGGGAGGCAAGCATGCTGGTGG + Intronic
926261133 2:11263165-11263187 CCAGGAGGCAAGGATGTTGGGGG - Intronic
927055256 2:19360812-19360834 GATGGAAGCAAGGTTGGTGTTGG + Intergenic
927465182 2:23331540-23331562 GCAGGAAGGAAGGATGCTGGGGG - Intergenic
927847095 2:26477255-26477277 GCAGCAGGCCAGGATGCTGCGGG - Exonic
927861030 2:26560019-26560041 GAAGGAGGAAAGAAGGCTCTTGG - Intergenic
929301068 2:40304288-40304310 GAAGGAAATAAGGAGGCTGTTGG + Intronic
929575871 2:43051337-43051359 GATGGAGGAAAGGAGGCTATGGG + Intergenic
929799081 2:45084005-45084027 GAGGGTGGCATGGGTGCTGTTGG - Intergenic
930405847 2:50954639-50954661 GAAGCAGGCAGGGAAGCTGGAGG + Intronic
932803212 2:74761208-74761230 GAAGGAGGCAAAGAGGATGAGGG + Intergenic
933215910 2:79629717-79629739 GAGGGAGGAAAGGATGCTGAAGG + Intronic
933233344 2:79835619-79835641 GAAAGTGGCAAGGATCCTTTAGG - Intronic
933598214 2:84303786-84303808 GAAGGAAACCAAGATGCTGTTGG + Intergenic
933726842 2:85431837-85431859 GCAGGAGGCAAGGATGGGGCGGG - Intronic
933984256 2:87577493-87577515 CCAGGAGGCAAGGATCCTGATGG + Intergenic
934551030 2:95261742-95261764 GGAGGTGGGAGGGATGCTGTGGG + Intergenic
935047342 2:99493982-99494004 GAAGAAGGCAAGGAAGTTGAGGG + Intergenic
935292386 2:101621441-101621463 GAATAAGGAAAGGATACTGTAGG + Intergenic
935369827 2:102333490-102333512 AAGGGAGGCAAGGAGGCTGGAGG + Intronic
936294093 2:111252122-111252144 GACAGAGTCAAAGATGCTGTGGG - Intergenic
936309596 2:111373303-111373325 CCAGGAGGCAAGGATCCTGATGG - Intergenic
936344301 2:111663390-111663412 CAAGGAAGCAAGGCTTCTGTAGG + Intergenic
937809473 2:126183629-126183651 CAAGGCGGCAACGAGGCTGTGGG - Intergenic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
938774110 2:134525933-134525955 TAAGAAGGCAGGGATGCTGCGGG + Intronic
939466363 2:142562006-142562028 GAGGGAGGCCAGGAGGCTGAGGG + Intergenic
939787800 2:146538413-146538435 GCAGGAGGTAAGGCTACTGTGGG + Intergenic
940352105 2:152702213-152702235 GAAGGATGCAAGGATCCTCCAGG + Intronic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
942607784 2:177710234-177710256 GAAGGAGGGAAGGATGGGGATGG + Intronic
943041530 2:182811054-182811076 GGAGGGGGCATGGATGCTGGTGG - Intergenic
943330774 2:186556351-186556373 GAAGGAGGGAGGGAGGCAGTGGG - Intergenic
944389594 2:199203695-199203717 GAAGGAGCCCAGGCAGCTGTGGG - Intergenic
946202802 2:218080743-218080765 GAGGGAGGGAAGGATGCTGATGG - Intronic
946410322 2:219512285-219512307 GATGGAGGCCAGTATGTTGTCGG + Intergenic
946609246 2:221440131-221440153 GCAGTAGGCAGGGATGCAGTGGG + Intronic
947050407 2:226036358-226036380 GAAGGAGATAAGGAAGCTGCAGG + Intergenic
948663444 2:239520494-239520516 GAAGGAGGCGTGGCTGCTGTGGG - Intergenic
1168968115 20:1912442-1912464 GAAGGAAGGAAGGATGTCGTTGG - Intronic
1169663669 20:8009073-8009095 AAAGGATGAAAGGATGCAGTAGG + Intronic
1170738120 20:19028080-19028102 GAAGCAGGCAAGGAGGCTCTCGG + Intergenic
1170763944 20:19274497-19274519 GAAGGAGAGGAGGATGCTGGAGG - Intronic
1170851635 20:20009885-20009907 TAAGCAGGCAAGGAGCCTGTGGG + Intergenic
1171162912 20:22944753-22944775 GAAGGAAATAAGGATTCTGTTGG + Intergenic
1171484753 20:25478636-25478658 GATGGAGGCAATGTTGCTGCCGG + Intronic
1171733185 20:28737064-28737086 CAAGGAGGCAGCGATGCTGGTGG + Intergenic
1172484660 20:35291100-35291122 GAAGGAGGAGAGGAGGCTGCTGG - Intronic
1172628707 20:36363953-36363975 GCAGGAGGGAAGGGTGCTGCAGG + Intronic
1172786602 20:37472916-37472938 GAAGGTGGCAGGGATGGTGCTGG + Intergenic
1173525272 20:43727530-43727552 CAAGGAGACTAGGCTGCTGTGGG - Intergenic
1173746872 20:45444416-45444438 GAAGGAGGGAGGAAGGCTGTGGG - Intergenic
1174296445 20:49548619-49548641 GATGGATGGATGGATGCTGTTGG + Intronic
1174356022 20:49998365-49998387 GGAGGAGACAAGGATGATGCCGG + Intergenic
1174701180 20:52611021-52611043 GAAGGAGGGAAGGATGGAGGAGG - Intergenic
1175144883 20:56888185-56888207 GAATGAGGCGAGGATGGGGTTGG - Intergenic
1175644083 20:60656726-60656748 GAGGAAGGTAAGGATGCCGTGGG - Intergenic
1175956271 20:62611019-62611041 GAAGGAAGCAGGGATGCTCCAGG + Intergenic
1176602669 21:8807400-8807422 GATTGTGGCAAGGATGCTGCTGG - Intergenic
1176605634 21:8828123-8828145 GAAGGAGGCCAGGGAGTTGTTGG + Intergenic
1178069154 21:28942473-28942495 GAAATAGGCTAGAATGCTGTAGG - Intronic
1179137351 21:38691754-38691776 GAAGGAGGCTAGGAAGAAGTGGG + Intergenic
1179302926 21:40128615-40128637 GAAGGAAGCTACCATGCTGTAGG + Intronic
1179908073 21:44434410-44434432 GACGGTGGCAGGGATGCTGTCGG + Intronic
1180344954 22:11698957-11698979 GATTGTGGCAAGGATGCTGCTGG - Intergenic
1180347931 22:11719727-11719749 GAAGGAGGCCAGGGAGTTGTTGG + Intergenic
1180352781 22:11817904-11817926 GATTGTGGCAAGGATGCTGCTGG + Intergenic
1180355709 22:11837829-11837851 GAAGGAGGCCAGGGAGTTGTTGG + Intergenic
1180382544 22:12154496-12154518 GAAGGAGGCCAGGGAGTTGTTGG - Intergenic
1181019776 22:20093585-20093607 GAAGCGGGCCAGCATGCTGTTGG + Intronic
1181296749 22:21846352-21846374 GAAGAAAGTAAGGGTGCTGTAGG - Intronic
1181725545 22:24808443-24808465 GAAAGTGACAAGGATGTTGTTGG - Intronic
1182578967 22:31292335-31292357 GAAGGAGGCAAGGATGCTGTTGG - Exonic
1183337921 22:37261216-37261238 GAGGGAGTCAAGAATGATGTTGG + Intergenic
1184220089 22:43094486-43094508 GAAGGGGGCAAGGCTGCTAGAGG - Intergenic
1184357848 22:43994477-43994499 CAAGGCGCCAAGGGTGCTGTTGG + Intronic
1184562008 22:45268874-45268896 GAAGAAGGCCAGGATGGAGTTGG + Intergenic
1185401386 22:50619887-50619909 AAAGGAGCCAAGGAGGCTGGAGG + Intergenic
950096763 3:10335175-10335197 AAAGGAGGGCAGGATGCTGAAGG + Intronic
950671107 3:14525892-14525914 AAAGGAGGCAAGGACGCAGGAGG - Exonic
950720601 3:14879839-14879861 GGAGGGGGAAAGGATGCTGAGGG + Intronic
950826785 3:15831497-15831519 GAAGGAGGGAAGGATACTATTGG - Intronic
951330112 3:21356682-21356704 GAAGGGGCCAAGGCTGCTGTAGG + Intergenic
951355181 3:21657987-21658009 GAAGGAGACAAAGATTCTGAAGG + Intronic
951801055 3:26596428-26596450 CAAAGGAGCAAGGATGCTGTAGG + Intergenic
952420722 3:33128840-33128862 GAGGGAGCCAAGGATCATGTGGG + Intronic
953108399 3:39908392-39908414 GGAGGTGGCAAGGAAGATGTGGG - Intronic
953164176 3:40449815-40449837 GTAGGAGGCAAGGTTGCAGCTGG - Intergenic
953565448 3:44028296-44028318 GAAGGAGGGACTGAGGCTGTGGG - Intergenic
953576675 3:44118225-44118247 GAAGGAGAAAAGGATGTTCTGGG - Intergenic
953937911 3:47062319-47062341 GAACGAGGAAGGGATGCTGTTGG - Exonic
954111538 3:48436321-48436343 AGAGGAGGCTAGGGTGCTGTGGG - Intronic
954537044 3:51368484-51368506 CAAGGAGGCAGTGAGGCTGTGGG + Intronic
954860222 3:53681916-53681938 GAAGGAGCAGAGGATGCTGGAGG + Intronic
955379400 3:58424793-58424815 GCAGGAGGCAAGGGAGCTGCTGG - Exonic
956012349 3:64845112-64845134 GAAGAAGGCAAAGCAGCTGTGGG - Intergenic
956734912 3:72231047-72231069 GAAGGAGACAAGGCTACTGAAGG - Intergenic
956904832 3:73754963-73754985 CAAGGTGGCAAGGAAGGTGTTGG - Intergenic
957741015 3:84268364-84268386 AAAGGAGGCCAGAATGCAGTGGG - Intergenic
957818590 3:85338005-85338027 GATGGAGGCAATGATGCTTAAGG - Intronic
958839851 3:99191016-99191038 GGAGGAGGAAGGGATGATGTAGG - Intergenic
958912195 3:100006381-100006403 GAAGGAGGAAAAAAGGCTGTTGG - Intronic
960095560 3:113686350-113686372 GAAGGGGGGAAGGGTGGTGTAGG + Intronic
960385822 3:117020623-117020645 GATGGAGTCTAGGAGGCTGTAGG + Intronic
960507132 3:118507406-118507428 AAAGGTGGCAATGATTCTGTTGG - Intergenic
961429635 3:126872134-126872156 GACTGAGGGAAGGATACTGTTGG + Intronic
961693642 3:128688727-128688749 GAAGGAGGAAGGAATGCTGATGG + Intergenic
962198832 3:133384989-133385011 GAAGGAGGCCAGACTGCTCTGGG - Intronic
962862758 3:139419595-139419617 GGATGAGGGAAGGATGGTGTCGG + Intergenic
963020611 3:140869531-140869553 GGAAGAGGGAAGGGTGCTGTAGG + Intergenic
963353784 3:144184899-144184921 TATGCAGGCAAGGATGCTGAAGG - Intergenic
967018417 3:185501717-185501739 AAAGGAGGCAAGGCTCCTGCTGG + Intergenic
967149550 3:186636188-186636210 AAAGATGTCAAGGATGCTGTAGG - Intronic
969119786 4:4899682-4899704 GAGGCATGCAAGGATGCTGCGGG + Intergenic
969338637 4:6527034-6527056 GAAGGAGCCCAGGCTGGTGTCGG + Intronic
970098092 4:12487518-12487540 GAATGAGGAAAGGTTGGTGTAGG + Intergenic
970672779 4:18415501-18415523 GAAGAAGGCAAAGCAGCTGTGGG + Intergenic
971228815 4:24780786-24780808 GAAGGAGGGAAGGATTTTATTGG - Intergenic
971833534 4:31731826-31731848 GAAGGAAGGAAGGAAGATGTAGG - Intergenic
973372476 4:49262866-49262888 GAAGGAGGCCAGGGAGTTGTTGG - Intergenic
973375318 4:49282285-49282307 GATTGTGGCAAGGATGCTGCTGG - Intergenic
973376219 4:49288298-49288320 GATTGTGGCAAGGATGCTGCTGG - Intergenic
973377139 4:49294453-49294475 GATTGTGGCAAGGATGCTGCTGG - Intergenic
973378058 4:49300589-49300611 GATTGTGGCAAGGATGCTGCTGG - Intergenic
973379006 4:49306887-49306909 GATTGTGGCAAGGATGCTGCTGG - Intergenic
973380087 4:49314763-49314785 GATTGTGGCAAGGATGCTGCTGG + Intergenic
973381003 4:49320918-49320940 GATTGTGGCAAGGATGCTGCTGG + Intergenic
973382093 4:49327956-49327978 GATTGTGGCAAGGATGCTGCTGG + Intergenic
973385623 4:49512571-49512593 GATTGTGGCAAGGATGCTGCTGG + Intergenic
973388527 4:49532275-49532297 GAAGGAGGCCAGGGAGTTGTTGG + Intergenic
974014568 4:56637150-56637172 GAAGGAGGCTGGGATCCTGAAGG - Intergenic
974104086 4:57447940-57447962 GGATGAGGTAAGGAGGCTGTAGG + Intergenic
974574608 4:63701729-63701751 GAAGGAGGCAGAGAAACTGTAGG - Intergenic
975322356 4:73023180-73023202 GAAGGAGGGAGGGAGGCTGGTGG - Intergenic
977381922 4:96286413-96286435 GAAGTAAACAAGTATGCTGTAGG - Intergenic
979439968 4:120739949-120739971 AAAGGGGGTAATGATGCTGTCGG + Intronic
979669538 4:123347528-123347550 GAAGGTAGCTAGGATGCTTTAGG - Intergenic
981509858 4:145544181-145544203 GAGGGAGGCTAGGAAGGTGTGGG + Intronic
981822436 4:148901539-148901561 GAAGGAAGCAGGGAGGCTGTAGG - Intergenic
983918245 4:173315323-173315345 GGAGGGGGCAAGGCTTCTGTTGG + Intronic
984630509 4:182055505-182055527 GAAGGAGGCAAGGATCATCAAGG - Intergenic
985151441 4:186951068-186951090 GATACCGGCAAGGATGCTGTTGG - Intergenic
985521680 5:376692-376714 GCTGGAGGGAAGGCTGCTGTTGG + Exonic
985908910 5:2863939-2863961 GAGGGAGGCCTGGATGATGTCGG - Intergenic
985967415 5:3348173-3348195 TAAGGAGGGAGGGATGCTGTGGG - Intergenic
986042585 5:4008100-4008122 GAATGAGGCAAGGATGAAGGTGG + Intergenic
988949592 5:36242715-36242737 AGAGGAGGAAGGGATGCTGTTGG + Intergenic
989727987 5:44610318-44610340 GAAGGAGGGAAGGAAGCTATAGG + Intergenic
989828402 5:45886825-45886847 CAAGGTGGCAAGGAGGCTGGGGG - Intergenic
990934490 5:61133049-61133071 AAAAGAGGCAAGGATACTGTGGG - Intronic
993225833 5:85166614-85166636 GAAGGAGATAAGGAAGTTGTTGG + Intergenic
993776905 5:92011508-92011530 GAAGAAGACAAGAATGATGTGGG + Intergenic
994166580 5:96615516-96615538 GAAACAGACAAGGATTCTGTGGG + Intronic
994675425 5:102815225-102815247 GCAGAAGGAAAGGATGTTGTTGG + Intronic
994683444 5:102919351-102919373 GAGGGAGGCAACAAAGCTGTGGG - Intronic
997367673 5:133336227-133336249 GGAGGAGGCAAGGGTGGGGTGGG + Intronic
997970607 5:138398361-138398383 GAAGGAGGCCATGATGATGGTGG + Exonic
998049728 5:139022295-139022317 CAGAGAGGCAAGGATGCAGTTGG - Intronic
998160925 5:139812630-139812652 GCAGGAGGCCAGTGTGCTGTGGG + Intronic
998454580 5:142261504-142261526 GCAGGAGGCAATGAAGCTGATGG - Intergenic
998650795 5:144119100-144119122 GAAGGAGTGAAGGAGGCTGGTGG + Intergenic
998749824 5:145307722-145307744 TAAGGAGACATGGCTGCTGTTGG - Intergenic
998878021 5:146619857-146619879 TAAGGAAGAAAGGATGCAGTGGG - Intronic
999257003 5:150215291-150215313 GTAGGAGCCAAGGAGGCTTTAGG + Intronic
999701272 5:154230734-154230756 ACAGGAGGAAAGGATGCTGTGGG - Intronic
1000386023 5:160675478-160675500 GAGGGAGGAGAGGATGCTGAAGG + Intronic
1001598925 5:172916306-172916328 CCAGGAGGCAGGGATGCTGGGGG + Intronic
1002989856 6:2228510-2228532 GAAGGAGGCATGGCTGCCCTGGG - Intronic
1003460810 6:6326019-6326041 GAAGAAGGAAAAGAGGCTGTGGG - Intergenic
1004473201 6:15947331-15947353 GAAGTAGGCAAGGCTGTTTTGGG + Intergenic
1005675945 6:28154925-28154947 GAAGGAGACGAAGATGCTTTAGG + Exonic
1005831755 6:29676706-29676728 GAAGGATGCCAGGATGGTGCGGG + Intronic
1006056170 6:31386066-31386088 GAAGGTGGAAAGTATGCTGGAGG - Intergenic
1006299162 6:33184776-33184798 GAAGGAGGCCTGGATACTGAAGG + Intronic
1006369584 6:33635724-33635746 GAAGGAGGTGAGGATCCTGGAGG + Intronic
1006483353 6:34316927-34316949 GAAGAAGGCAAGGGTGCAGGGGG + Intronic
1006536639 6:34704547-34704569 GAAGTAGACAACGAGGCTGTAGG + Intergenic
1007178909 6:39914580-39914602 GGAGGGGGCCAGGATGCAGTAGG - Intronic
1007835625 6:44671658-44671680 GAAGGAGGTGAGGATGCTGAAGG - Intergenic
1008470109 6:51875163-51875185 CAAGGCGGCAACGAGGCTGTGGG + Intronic
1009195961 6:60684710-60684732 GAAAGAGGCAAGCCTGGTGTGGG - Intergenic
1011751679 6:90460699-90460721 GCAGGAGGTAGGGGTGCTGTGGG - Intergenic
1011850032 6:91615047-91615069 GAAGTAGGCAAGAAAGCTTTCGG + Intergenic
1011872464 6:91913071-91913093 GAAGGAGACAAAGAGGCTGAGGG + Intergenic
1012582830 6:100889852-100889874 GAAGGAGTAAAGGGTGCTGGGGG - Intergenic
1013667514 6:112363542-112363564 AAAGGAAGCCAGGACGCTGTTGG - Intergenic
1013749074 6:113381099-113381121 GAGGGAGGGAAGAATGATGTTGG + Intergenic
1014696929 6:124633822-124633844 GGAGGAAGCAAGGTTGCTGGTGG - Intronic
1014743454 6:125172021-125172043 GAGGGAGGGAAGGAGGCAGTAGG - Intronic
1015029728 6:128580430-128580452 CAAGGAGGCAAGGCGGCTGCGGG - Intergenic
1016452138 6:144194444-144194466 GAGTGAGGCCAGGATGCGGTTGG + Intergenic
1016779595 6:147943457-147943479 GGAGGATGGAAGGATGCCGTGGG - Intergenic
1017075768 6:150616408-150616430 GAGGGAGGCAAGGATGCCTTTGG + Intronic
1017744810 6:157436831-157436853 GAAGGAGGCCCAGATGCTGGAGG + Intronic
1018751729 6:166812421-166812443 GAGAGAGGCAAGGGGGCTGTGGG - Intronic
1018768225 6:166950802-166950824 AAAGGAGGCAGGGAAGCTCTTGG + Intronic
1019866043 7:3711560-3711582 GAAGGAGCCAGAGATGCTGCTGG + Intronic
1020042220 7:5012739-5012761 GAAGGGAGGAAGGATGCGGTGGG + Intronic
1020913144 7:14158836-14158858 GAAGGTGTCAAGGATGATCTGGG - Intronic
1022016881 7:26357821-26357843 GAAGGGGAGCAGGATGCTGTGGG + Intronic
1022056021 7:26735101-26735123 GAGAGAGGGAAGGATGCTGTGGG - Intronic
1022066491 7:26864329-26864351 GAAGGCGGCGATAATGCTGTCGG - Intronic
1022399663 7:30025184-30025206 AAAGTAGGGAAGGATGTTGTAGG - Intronic
1022518137 7:30988602-30988624 GAGGGAGGGAGGGATGGTGTGGG - Intronic
1022988162 7:35680553-35680575 TAAGGAGGAAAGAATACTGTCGG - Intronic
1023247733 7:38223586-38223608 GAAGAAGGCAAGGCTGCTGCAGG - Intronic
1023654822 7:42408865-42408887 GAAGGGGTGCAGGATGCTGTAGG + Intergenic
1024337979 7:48228486-48228508 GTGGGAGGCACGGGTGCTGTTGG + Intronic
1024352479 7:48381072-48381094 GAAGTAGGGAGGGGTGCTGTGGG - Intronic
1024683912 7:51724265-51724287 GAATGAAGTAAGGATACTGTGGG - Intergenic
1026376299 7:69754307-69754329 GAAGGAGCAAAGGATGGTTTGGG + Intronic
1028344886 7:89767542-89767564 GAAAGAAGTAAGGAAGCTGTAGG + Intergenic
1028467003 7:91163739-91163761 GAGGGAGGAAAGGAAGTTGTTGG - Intronic
1029443508 7:100600855-100600877 GAAGGAGGCGGGGGTGGTGTAGG + Exonic
1029464109 7:100714788-100714810 GAAGGAAGCAAGAATGCTGGAGG - Intergenic
1029595964 7:101537818-101537840 AGAGGAGGCAGGGATGGTGTGGG - Intronic
1030595654 7:111535805-111535827 GAATCAGGGAAGAATGCTGTGGG + Intronic
1032267096 7:130377339-130377361 GAAACAGGGAGGGATGCTGTGGG + Intergenic
1032487591 7:132299679-132299701 GAAGGTGGAATGGATGCTGGAGG - Intronic
1033310743 7:140260114-140260136 GAAGGAGGCAGGGCTGCTACAGG + Intergenic
1033842057 7:145386743-145386765 GAGGGAGGCAGGGTTGCTGTTGG + Intergenic
1034697457 7:153066483-153066505 GAAGGAGGGCAGGATGCAGTCGG + Intergenic
1035673646 8:1439284-1439306 GAAGGAGGGACAGAGGCTGTGGG + Intergenic
1036127778 8:6079138-6079160 GAAGGAGCCAGGGATGCAGGGGG + Intergenic
1037162338 8:15788729-15788751 GAATGTGCCAAGAATGCTGTAGG + Intergenic
1038521735 8:28238835-28238857 GACGTGGGCAAGGATGCTGAAGG - Intergenic
1038539391 8:28379196-28379218 AAAGGAGAGTAGGATGCTGTAGG - Intronic
1039321534 8:36437160-36437182 GAAGCAGGCATGGGTGCTATGGG - Intergenic
1039584406 8:38694096-38694118 GAAAGAGGAAAGGATGATGGGGG - Intergenic
1039802781 8:40974480-40974502 GAAGGAGGCAGAGCTGCTGGCGG - Intergenic
1040559707 8:48513817-48513839 AAAGGAGGCAAAGATGCTGGAGG - Intergenic
1041285206 8:56253235-56253257 GAAGCATGCCAGGGTGCTGTGGG + Intergenic
1041360808 8:57051970-57051992 ATAGGAAGCAAGGATGCTCTGGG + Intergenic
1042291731 8:67176061-67176083 GAAGAAATCTAGGATGCTGTTGG + Intronic
1042357189 8:67841109-67841131 GCAGGAAGCAGGGATGCTCTGGG + Intergenic
1043172719 8:76985726-76985748 GAGGGAGGCATGGATCCTGCTGG + Intronic
1043803565 8:84642971-84642993 GAGGGAGCTAAGGATGCTTTTGG + Intronic
1044211664 8:89557930-89557952 CAAGGCGGCAACGAGGCTGTGGG - Intergenic
1045298956 8:100894298-100894320 GAAATAGTCAAGGATGCTGTAGG + Intergenic
1046557179 8:115789875-115789897 GAATGGGGCAGGGATGGTGTTGG - Intronic
1047911897 8:129539314-129539336 GCAGGAGGCAGCCATGCTGTGGG + Intergenic
1049102795 8:140591049-140591071 GAAGGAGGGAAGGAAGCTCTGGG + Intronic
1051053291 9:12955598-12955620 GGAGGATGCAAGCATGCTCTAGG + Intergenic
1051084898 9:13337358-13337380 GAAAGAGGTAAGGAAGCTGCAGG - Intergenic
1051469719 9:17423878-17423900 GAATGAGGGAAGGATGATGTAGG + Intronic
1051485339 9:17602469-17602491 GAAAGAGGCAAGGTGGCTGGTGG - Intronic
1051516433 9:17935247-17935269 GCAGGAGGAAAGGAGGGTGTGGG - Intergenic
1051858153 9:21593359-21593381 GCAGGAGGCAAAAATGCTGACGG - Intergenic
1052012917 9:23432247-23432269 GCAGGAAGCAAAGATTCTGTAGG + Intergenic
1052045062 9:23784333-23784355 GAAGGAAAAAAGGATGCTGTGGG + Intronic
1052998644 9:34565332-34565354 GAAAGAGACAAGGATGGGGTGGG - Intronic
1053309209 9:37005209-37005231 GAAGAAGGGATGGGTGCTGTGGG - Intronic
1057138739 9:92714055-92714077 GAAAGAGGAAAGGTAGCTGTAGG - Exonic
1057885111 9:98823855-98823877 GATGGAGGCAAGGAGGGTGGAGG + Intronic
1058367987 9:104232998-104233020 AAAGGAGGCAATGATGCAGCTGG + Intergenic
1058642384 9:107100158-107100180 GAAGGAGCAAGTGATGCTGTAGG - Intergenic
1058666773 9:107325793-107325815 GAACCAGACAAGGATGTTGTTGG - Intronic
1058890441 9:109356347-109356369 CAAGGAGGAAACGAGGCTGTGGG - Intergenic
1059415725 9:114161424-114161446 GCAGGAAGGAGGGATGCTGTGGG + Intronic
1059440686 9:114305158-114305180 GAAGGAGGCAAGGCTGCAAAGGG - Intronic
1060226312 9:121793169-121793191 GAAGAAGGGAAGGAGGCTTTGGG - Intergenic
1060476923 9:123993805-123993827 GAAGGGGTGAAGGATGCTCTGGG - Intergenic
1060907909 9:127324432-127324454 GATGGAGGCACGGAGGCTGGAGG - Intronic
1061198168 9:129119860-129119882 GAGGGAGGGCAGGAGGCTGTGGG + Intronic
1062085481 9:134645937-134645959 GAAGGAGGGAAGGATGGAGGGGG - Intronic
1062226967 9:135457709-135457731 AAAGGAGGCAAAGAAGCAGTTGG + Intergenic
1203699032 Un_GL000214v1:120521-120543 GACTGTGGCAAGGATGCTGCTGG - Intergenic
1203699990 Un_GL000214v1:126831-126853 GACTGTGGCAAGGATGCTGCTGG - Intergenic
1203700895 Un_GL000214v1:132815-132837 GACTGTGGCAAGGATGCTGCTGG - Intergenic
1203479730 Un_GL000224v1:1395-1417 GATTGTGGCAAGGATGCTGCTGG - Intergenic
1203480698 Un_GL000224v1:7691-7713 GATTGTGGCAAGGATGCTGCTGG - Intergenic
1203481659 Un_GL000224v1:14021-14043 GATTGTGGCAAGGATGCTGCTGG - Intergenic
1203549237 Un_KI270743v1:154335-154357 GATGGTGGCAAGGATGCTGCTGG + Intergenic
1203550191 Un_KI270743v1:160649-160671 GATTGTGGCAAGGATGCTGCTGG + Intergenic
1203553027 Un_KI270743v1:180131-180153 GAAGGAGGCCAGGGAGTTGTTGG + Intergenic
1203567692 Un_KI270744v1:105532-105554 GATTGTGGCAAGGATGCTGCTGG - Intergenic
1203568753 Un_KI270744v1:112517-112539 GATTGTGGCAAGGATGCTGCTGG - Intergenic
1203569331 Un_KI270744v1:116769-116791 GACTGTGGCAAGGATGCTGCTGG - Intergenic
1203570280 Un_KI270744v1:123050-123072 GACTGTGGCAAGGATGCTGCTGG - Intergenic
1185508202 X:644232-644254 GAAGGAGGAAAGGCGGGTGTGGG + Intronic
1187932512 X:24306351-24306373 GCTGGAGGCAGGGCTGCTGTGGG - Intergenic
1187968856 X:24639752-24639774 GAAGCTGGCAAGGATGGTTTGGG - Intronic
1188959290 X:36470781-36470803 CAAGGAGGCAACGAGGCTGGGGG - Intergenic
1189107013 X:38246996-38247018 GAAGGAGGCAAAGAATCTGTGGG + Intronic
1190773792 X:53536626-53536648 GAAGAAGGGCAGGATGCTGGTGG - Exonic
1191866771 X:65710060-65710082 GAAGGAGGCAAGGATGCAGATGG - Intronic
1192603792 X:72492476-72492498 AAAGAAGGCAAGGATGGGGTAGG + Intronic
1193979032 X:88158552-88158574 AAATGAGGTAAGAATGCTGTAGG - Intergenic
1195293675 X:103454419-103454441 GAAGGAGGCAAAGTTGGAGTGGG - Intergenic
1196894403 X:120320826-120320848 GAAGGAGACCAGGCTGCTTTCGG + Intergenic
1197817967 X:130517789-130517811 CAAGGCGGCAAGGAGGCTGGGGG + Intergenic
1199770014 X:150969273-150969295 GAAGGAAGCAAGCACTCTGTGGG - Intergenic
1200308050 X:155048288-155048310 GCAGGAGGCAAGCATAATGTTGG + Intronic
1201154309 Y:11115786-11115808 GAAGGAGGCCAGGGAGTTGTTGG + Intergenic