ID: 1182579244

View in Genome Browser
Species Human (GRCh38)
Location 22:31294498-31294520
Sequence GACTCTAGGGTGTAATTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182579244_1182579247 14 Left 1182579244 22:31294498-31294520 CCTGTGAATTACACCCTAGAGTC No data
Right 1182579247 22:31294535-31294557 CACATATTCATACACAGATACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182579244 Original CRISPR GACTCTAGGGTGTAATTCAC AGG (reversed) Intergenic
No off target data available for this crispr