ID: 1182584186

View in Genome Browser
Species Human (GRCh38)
Location 22:31334342-31334364
Sequence AAGCAGGGAAGTAGTAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182584186_1182584190 -5 Left 1182584186 22:31334342-31334364 CCTTCACTACTACTTCCCTGCTT No data
Right 1182584190 22:31334360-31334382 TGCTTTCACAGCAGGTGTCCTGG No data
1182584186_1182584192 11 Left 1182584186 22:31334342-31334364 CCTTCACTACTACTTCCCTGCTT No data
Right 1182584192 22:31334376-31334398 GTCCTGGTGGTACAAACCCCAGG No data
1182584186_1182584199 30 Left 1182584186 22:31334342-31334364 CCTTCACTACTACTTCCCTGCTT No data
Right 1182584199 22:31334395-31334417 CAGGTATGAAGCTGCAAGGAGGG No data
1182584186_1182584191 -2 Left 1182584186 22:31334342-31334364 CCTTCACTACTACTTCCCTGCTT No data
Right 1182584191 22:31334363-31334385 TTTCACAGCAGGTGTCCTGGTGG No data
1182584186_1182584198 29 Left 1182584186 22:31334342-31334364 CCTTCACTACTACTTCCCTGCTT No data
Right 1182584198 22:31334394-31334416 CCAGGTATGAAGCTGCAAGGAGG No data
1182584186_1182584194 26 Left 1182584186 22:31334342-31334364 CCTTCACTACTACTTCCCTGCTT No data
Right 1182584194 22:31334391-31334413 ACCCCAGGTATGAAGCTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182584186 Original CRISPR AAGCAGGGAAGTAGTAGTGA AGG (reversed) Intronic