ID: 1182584191

View in Genome Browser
Species Human (GRCh38)
Location 22:31334363-31334385
Sequence TTTCACAGCAGGTGTCCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182584186_1182584191 -2 Left 1182584186 22:31334342-31334364 CCTTCACTACTACTTCCCTGCTT No data
Right 1182584191 22:31334363-31334385 TTTCACAGCAGGTGTCCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182584191 Original CRISPR TTTCACAGCAGGTGTCCTGG TGG Intronic