ID: 1182586117

View in Genome Browser
Species Human (GRCh38)
Location 22:31345249-31345271
Sequence CAGAATGTCCCCAAATACCT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 179}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182586113_1182586117 14 Left 1182586113 22:31345212-31345234 CCAAGCGCACCACGATGCGGGAA 0: 1
1: 0
2: 0
3: 3
4: 13
Right 1182586117 22:31345249-31345271 CAGAATGTCCCCAAATACCTTGG 0: 1
1: 0
2: 1
3: 13
4: 179
1182586115_1182586117 5 Left 1182586115 22:31345221-31345243 CCACGATGCGGGAAGTGTAGGCG 0: 1
1: 0
2: 0
3: 0
4: 58
Right 1182586117 22:31345249-31345271 CAGAATGTCCCCAAATACCTTGG 0: 1
1: 0
2: 1
3: 13
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182586117 Original CRISPR CAGAATGTCCCCAAATACCT TGG Exonic
900877778 1:5357870-5357892 GAGAATGTCCCCTTGTACCTTGG + Intergenic
904340093 1:29828832-29828854 CAGATGGTCACCAAATAACTGGG + Intergenic
907221431 1:52909859-52909881 AAGAATGTCCCCAAATACATTGG - Intronic
909704043 1:78559914-78559936 AAGAATGTTACCAAATAACTAGG - Intergenic
911346532 1:96703185-96703207 GAGTATGTGCCCAAATACTTAGG - Intergenic
913398056 1:118394635-118394657 CAGAATGTACACATATACTTGGG + Intergenic
919248987 1:195028863-195028885 TAGAATGCCTCAAAATACCTAGG - Intergenic
921157314 1:212448862-212448884 CAGACTGGCCTCAAACACCTGGG - Intergenic
921871898 1:220150148-220150170 CAGAATGGCCTCAAACTCCTGGG + Exonic
924025625 1:239830154-239830176 AAGAATTTCCACAAATACTTAGG - Intronic
924257472 1:242196872-242196894 AAGAAAGTCCCCAAATATGTAGG - Intronic
1062831685 10:609950-609972 CAGCCTGTCCCCAAAGCCCTCGG - Intronic
1062854721 10:774149-774171 AAGAATGTCCCCGAATCACTGGG - Intergenic
1066387371 10:34952617-34952639 CAGACTGGCCTCAAATTCCTGGG + Intergenic
1067939546 10:50642691-50642713 CAGACTGGCCTCAAATTCCTGGG - Intergenic
1068745794 10:60529316-60529338 CAAAATGTTCTCAAATGCCTAGG + Intronic
1071717979 10:88116048-88116070 CACAATTTCTCCAAATTCCTTGG + Intergenic
1072307473 10:94121395-94121417 CAGAATGCTACCAAATAGCTAGG + Intronic
1073148575 10:101296412-101296434 CAGACTGGCCTCAAATTCCTGGG + Intergenic
1073283254 10:102370102-102370124 CAGAATGTCCCCAAGAGCCAGGG - Intronic
1076962472 10:133775798-133775820 CAAAATATCCCTAAATTCCTGGG + Intergenic
1078756148 11:14212280-14212302 CAGAATATCCCCAAAAAGCAAGG - Intronic
1078947191 11:16082522-16082544 CAGGATTTCCCCAAATCCCCAGG + Intronic
1082663770 11:55948944-55948966 CAGAAGGTAGCCAAATGCCTAGG + Intergenic
1084384510 11:68834539-68834561 CAGATTGGTCTCAAATACCTGGG - Intronic
1085016964 11:73180186-73180208 CTGAATGACCCCCAACACCTTGG + Intergenic
1085172198 11:74458970-74458992 CAGAATTTCTACAAATAGCTAGG - Intronic
1089563047 11:119355542-119355564 CAAGATGTCCCCAAATACCCAGG + Exonic
1090159531 11:124478158-124478180 CAGGCTGTTACCAAATACCTGGG - Intergenic
1091372848 11:135075559-135075581 CAAAATATCCCTAAATTCCTGGG + Intergenic
1092606482 12:10125365-10125387 CAGCATGTCACTAAATTCCTGGG - Exonic
1093743143 12:22711057-22711079 CTGATTGTCCCCAAATGCATTGG + Intergenic
1096385022 12:51189626-51189648 CAGAAGGTTCCCAAACCCCTGGG - Exonic
1097418533 12:59345021-59345043 CATAATTTCCCCAAATATATGGG + Intergenic
1102534901 12:113574320-113574342 CAGGATGTCCCCAGATAACTGGG - Intergenic
1102929927 12:116854392-116854414 CAGGCTGTCCTCAAATTCCTGGG - Intergenic
1103034821 12:117647917-117647939 CAGGCTGTTCTCAAATACCTGGG + Intronic
1104171775 12:126288795-126288817 CATAACCTCCCCAAATCCCTAGG - Intergenic
1107381173 13:39857653-39857675 CAGAATGTGCCCAGATGCATGGG + Intergenic
1111146109 13:84182761-84182783 AAAAATGTCCCCAAATTCTTGGG + Intergenic
1111403006 13:87765821-87765843 CGAGATGTCCCCAAATCCCTGGG + Intergenic
1113575082 13:111389535-111389557 GATCATGTCCCCAAACACCTGGG - Intergenic
1113609120 13:111630878-111630900 CAGAGTGTCACAAAAAACCTGGG - Intronic
1114358223 14:21938833-21938855 CCACATGCCCCCAAATACCTAGG - Intergenic
1117078903 14:52131696-52131718 CAAAATGTCCTCAGATTCCTGGG - Intergenic
1119153272 14:72385580-72385602 CAAAAGGCCCCCACATACCTGGG - Intronic
1120903004 14:89591847-89591869 CAGTATAACCCCAAATTCCTGGG - Intronic
1122856687 14:104563476-104563498 CAGTCCGTCCCCAAACACCTGGG - Intronic
1125436440 15:39650236-39650258 CAGAATTTCACAAAATTCCTTGG + Intronic
1128485592 15:68083819-68083841 CAGACTGTTCTCAAACACCTAGG - Intronic
1129593566 15:76940252-76940274 CAGACTGGCCTCAAATTCCTGGG - Intronic
1129799343 15:78401864-78401886 CAGAAGGGCCCAAAAGACCTGGG + Intergenic
1132147936 15:99439378-99439400 CAGAACGACCTCAAAGACCTCGG - Intergenic
1134620306 16:15683812-15683834 CAGGATGTCCTCAAACTCCTGGG - Intronic
1135865971 16:26102285-26102307 GAAAATGTTGCCAAATACCTTGG - Intronic
1138503053 16:57460432-57460454 CAGACTGTCCTCAAACTCCTGGG - Intronic
1138681486 16:58686521-58686543 CAGAATGGCCTCAAACTCCTGGG + Intergenic
1139214083 16:65110419-65110441 CAGAAAAACCCCAGATACCTAGG + Intronic
1141964338 16:87431771-87431793 CAAAATGTCAGCAAATACCTAGG + Intronic
1143847836 17:9786542-9786564 CAGGATGTCCCCAAGCACGTGGG + Intronic
1147404771 17:40203220-40203242 CAGAATTTCACCAATTCCCTTGG + Intergenic
1147766663 17:42841290-42841312 CAGAAGGTCCTCAAATAACCTGG - Intronic
1148023784 17:44571075-44571097 CAGACTGGCCTCAAATTCCTGGG - Intergenic
1150262010 17:63801427-63801449 CAGACTGGCCCCAAATCCCCTGG + Intronic
1152579018 17:81157862-81157884 CACACTGTCCCCCAACACCTTGG + Intronic
1152890698 17:82880222-82880244 CAGACTGTACTCAAATTCCTGGG + Intronic
1152951586 17:83237463-83237485 CAAAATATCCCTAAATTCCTGGG + Intergenic
1152963185 18:92719-92741 CAGGATGGCCTCAAACACCTGGG - Intergenic
1153276155 18:3369714-3369736 CAGAATGGTCCCAAACTCCTGGG - Intergenic
1153671399 18:7415693-7415715 CAGGCTGGCCCCAAATTCCTGGG + Intergenic
1154214513 18:12406464-12406486 CAGCATGACCCGAAAGACCTGGG - Intergenic
1155927846 18:31676824-31676846 CAGAATCTCCCATAAGACCTGGG + Intronic
1156931077 18:42644193-42644215 TAGAATTTCCCCAAATAGTTTGG - Intergenic
1157889481 18:51401743-51401765 CAGAGTGTACCCAAATGCTTCGG + Intergenic
1158639671 18:59193127-59193149 AAGAATGTCCCCAAATTGCTTGG + Intergenic
1158855147 18:61536167-61536189 CAGGATGTCCCAAAATTCTTGGG + Intronic
1159273010 18:66177319-66177341 CAGAATGTCACCCAATACATAGG - Intergenic
1161729873 19:5952744-5952766 GAGAATGTACACAAATTCCTAGG + Intronic
1163717589 19:18880907-18880929 CAGAATGGCCTCAAACTCCTGGG + Intronic
1163790473 19:19303197-19303219 CAGAGTGACCCCAGATGCCTGGG + Intronic
1164509455 19:28885577-28885599 GAGAATGTCCCCTAATTCATAGG + Intergenic
1165152594 19:33769837-33769859 CAGAGTGTCCCCATCTTCCTGGG - Intronic
1166931776 19:46305358-46305380 GAGAATGTCAGCAAACACCTGGG + Exonic
1168727617 19:58596502-58596524 CAAAATATCCCTAAATTCCTGGG + Intergenic
926082077 2:9995379-9995401 CAGGATGTTCTCAAATTCCTGGG - Intronic
928112499 2:28522023-28522045 CTCAATGTCCCCAGAGACCTTGG + Intronic
929290633 2:40186734-40186756 CAGAAGTGACCCAAATACCTTGG - Intronic
936570937 2:113614692-113614714 CAAAATATCCCTAAATTCCTGGG - Intergenic
947018733 2:225650332-225650354 CAGAATGTGCCCAATTCCGTTGG - Intronic
1169275722 20:4232558-4232580 CAGAATGACCCCAAACTCCTGGG + Intronic
1169899284 20:10536315-10536337 CAGGCTGTCCTCAAATTCCTGGG - Intronic
1171220028 20:23387859-23387881 CAGAATAACACCAAATATCTGGG - Intronic
1174377800 20:50138109-50138131 CAGAGAGTCCCCATATGCCTGGG - Intronic
1176113291 20:63420345-63420367 AAGAATCTCCCCAAAAACCCTGG + Intronic
1177903020 21:26939873-26939895 CAGAATGTCTACAAGTATCTTGG + Intronic
1178465941 21:32847680-32847702 CAGAATGGCCTCAAACTCCTCGG + Intergenic
1179262551 21:39771211-39771233 CAGAATGTCTTCACTTACCTTGG - Exonic
1179661005 21:42875148-42875170 CTGAATTTCCCCCAATACTTTGG + Intronic
1179838939 21:44057844-44057866 AATAATGTCCACAAATACATGGG + Intronic
1180263057 21:46688304-46688326 CAAAATATCCCTAAATTCCTGGG + Intergenic
1181570546 22:23765912-23765934 CAGATTGTACCCAGATAGCTGGG - Exonic
1182586117 22:31345249-31345271 CAGAATGTCCCCAAATACCTTGG + Exonic
1184384104 22:44164491-44164513 CTGGCTGTCCCCAAACACCTAGG - Intronic
1184630240 22:45771831-45771853 CAGACTGACCTCAAATTCCTTGG + Intronic
1185429256 22:50796183-50796205 CAAAATATCCCTAAATTCCTGGG + Intergenic
951907095 3:27716178-27716200 CAGAATATTCCCAAATATCATGG + Intronic
952933426 3:38376816-38376838 CAAAATGACCCCATATCCCTGGG - Intronic
953556321 3:43949430-43949452 CAGAATCTCCACTAATTCCTAGG - Intergenic
954007931 3:47607830-47607852 CAGACTGGACCCAAATTCCTGGG - Intronic
954018445 3:47716897-47716919 CAGACTGGCCTCAAATTCCTGGG - Intronic
954737886 3:52721876-52721898 CAGGAGGTGGCCAAATACCTAGG + Intronic
954784985 3:53086008-53086030 CAGTCAGTCCCCAATTACCTTGG - Intronic
956235099 3:67060777-67060799 CTGAATTTCCCCCAATACTTGGG + Intergenic
956712560 3:72051298-72051320 TAGAATGTCCCCCAACACCTAGG + Intergenic
956770375 3:72520811-72520833 GAGGATGTCCACAAATACTTCGG - Intergenic
957079822 3:75627592-75627614 CAAAATATCCCTAAATTCCTGGG - Intergenic
958099816 3:88995056-88995078 CAGAGTGCCCTCAAATACCTGGG - Intergenic
963065371 3:141259628-141259650 CAACATGTCCCCCAATGCCTTGG - Intronic
963177734 3:142318500-142318522 AAGAATGTACTCAAATATCTAGG - Intronic
963792900 3:149602470-149602492 CGGAATGTCCCCAAGTATTTAGG - Intronic
965518877 3:169652890-169652912 CTGAATATTCCCAAATCCCTAGG + Intronic
965643435 3:170855600-170855622 TAGAAAGCCCCAAAATACCTTGG + Intronic
966005322 3:175004161-175004183 CAGGATGTTCTCAAACACCTGGG - Intronic
967271938 3:187739518-187739540 CACAATGTCCCCGAACACCTCGG - Intronic
968373467 4:17000-17022 CAAAATATCCCTAAATTCCTGGG - Intergenic
970763741 4:19521897-19521919 CAGCATGTCCACATATAGCTTGG - Intergenic
971835592 4:31759174-31759196 CATTATTTCCCCAACTACCTTGG - Intergenic
972048451 4:34698082-34698104 AAGAGTATCCCCAAATTCCTTGG - Intergenic
975560632 4:75705270-75705292 CAGAATGCCCACAAAAGCCTGGG + Intronic
979315100 4:119252911-119252933 CACAATGTACCCAAATCTCTGGG - Intronic
980911469 4:138998353-138998375 CAGACTGGTCTCAAATACCTGGG + Intergenic
980951685 4:139385204-139385226 CAGACTGGCCTCAAATTCCTGGG - Intronic
981961110 4:150540088-150540110 AAGAATATCACAAAATACCTAGG + Intronic
984636032 4:182110534-182110556 CAGACTGTTCTCAAATTCCTGGG + Intergenic
984974556 4:185219001-185219023 GAGATTATCCCCAAATACATGGG - Intronic
985461929 4:190115554-190115576 CAAAATATCCCTAAATTCCTGGG + Intergenic
985465705 4:190193278-190193300 CAAAATATCCCTAAATTCCTGGG + Intergenic
989764122 5:45059195-45059217 CAGAATATCCCAAAAGAGCTGGG - Intergenic
990353077 5:54938219-54938241 CAGAATGTGCCCCAATTCTTCGG - Intergenic
990392757 5:55343788-55343810 CAGAATTTCCCCTAATGCCTTGG + Intronic
994663560 5:102682095-102682117 CAGAATGTGCCCAGAGAGCTAGG + Intergenic
994894466 5:105684772-105684794 CAGAACTTCTCCAAATGCCTTGG - Intergenic
998496687 5:142596392-142596414 CAGACTGGCCTCAAATTCCTGGG - Intronic
998496706 5:142596530-142596552 CAGACTGGCCTCAAATTCCTGGG - Intronic
999943137 5:156566399-156566421 CAGCATGTCATCAAATCCCTGGG + Intronic
1000020863 5:157318341-157318363 CAGAATGGCTCCAAATACAGAGG - Intronic
1000700656 5:164445032-164445054 CAGAATGTCCCATGATGCCTAGG - Intergenic
1002454724 5:179339461-179339483 CAGCATGGCCCCAATTATCTGGG - Intronic
1003007849 6:2398179-2398201 TAGAATGTCCCCCAAGACCCAGG - Intergenic
1003684312 6:8285863-8285885 CACAATGCCCCCAAGGACCTGGG - Intergenic
1008947858 6:57118911-57118933 TAGAATGTCACCTACTACCTGGG + Intronic
1010901032 6:81427646-81427668 CAGATTGGCCTCAAATGCCTGGG + Intergenic
1011311059 6:85980459-85980481 CACAATGTACCAAAATCCCTGGG + Intergenic
1012213919 6:96558211-96558233 AAGAATTTCCCCCAATACATGGG + Intergenic
1012377205 6:98576827-98576849 GAGAATGTCCCCAGGTACTTGGG - Intergenic
1012803027 6:103858172-103858194 AAGATTGTCCACAGATACCTGGG - Intergenic
1018179166 6:161205559-161205581 CAGGATGTCACCAATTACCATGG + Intronic
1019234721 6:170600992-170601014 CAAAATATCCCCAAATTCCTGGG + Intergenic
1020268191 7:6575902-6575924 CAGACTGTTCCCAAACTCCTGGG + Intergenic
1021390543 7:20087497-20087519 CAGACTGTTCTCAAATTCCTGGG - Intergenic
1022132069 7:27414099-27414121 CAGAATCACGCCCAATACCTTGG - Intergenic
1022376552 7:29817652-29817674 CAAAATTTCCAAAAATACCTAGG + Intronic
1027524317 7:79247402-79247424 CAGACTGTTCTCAAATTCCTAGG - Intronic
1029424576 7:100487930-100487952 CAGACTGGTCCCAAATTCCTGGG - Intronic
1031549454 7:123090540-123090562 CAAAATGACCCCAAATACCAAGG + Intergenic
1031680703 7:124670737-124670759 CAAAATGTCCTCACATACTTTGG - Intergenic
1034972897 7:155430269-155430291 CAGCAATTCCCCAAATTCCTAGG - Intergenic
1035401436 7:158568913-158568935 CAGACTGTCCTCAAACTCCTGGG - Intronic
1035513894 8:215143-215165 CAAAATATCCCCAAATTCCTGGG - Intergenic
1037077059 8:14733204-14733226 TAGATTGTCCCTAGATACCTGGG - Intronic
1037592677 8:20326431-20326453 CAGACTGGTCTCAAATACCTGGG - Intergenic
1039782393 8:40798074-40798096 CAGTATGTCGCCAAAGAACTGGG + Intronic
1041174389 8:55178854-55178876 CACCATGGCCCCAACTACCTTGG + Intronic
1041777225 8:61536679-61536701 CAGAATAGCCCCAAATAGCCAGG - Intronic
1043519441 8:81028088-81028110 CACAAGGTCCCCAGACACCTGGG + Intronic
1045453774 8:102355292-102355314 GAGACTGTCCCCAGAGACCTTGG - Intronic
1046091227 8:109504875-109504897 CAGGATGTCCTCAAACTCCTGGG - Intronic
1048144961 8:131832543-131832565 CATAATCTCGCCAAATACTTAGG + Intergenic
1048243613 8:132768813-132768835 TTGAATGTCCACAATTACCTTGG + Intergenic
1050224664 9:3439023-3439045 TAGAATATCCCCAAATATTTTGG + Intronic
1050352729 9:4755691-4755713 CAAACTGTCACCAACTACCTTGG - Intergenic
1050971050 9:11874616-11874638 CATTATGTAACCAAATACCTAGG + Intergenic
1052924401 9:34002802-34002824 CATAATTTCCCCCAATAGCTGGG + Intronic
1057707001 9:97401976-97401998 CAGCATGTCCCTAAAAAGCTGGG + Intergenic
1060955303 9:127634563-127634585 CAGGCTGGCCTCAAATACCTGGG - Intronic
1061547924 9:131315459-131315481 CAGAGTGTCCCTAAATGCCCAGG - Intergenic
1186160443 X:6771766-6771788 CAGAAAGGCCTAAAATACCTGGG - Intergenic
1186944313 X:14548380-14548402 CAGAAAGTGCACAAAAACCTGGG - Intronic
1187176892 X:16904147-16904169 CAGAATGGTCTCAAATTCCTGGG - Intergenic
1193312481 X:80024556-80024578 CAGCATGTCCCCAGATGCCCAGG - Intronic
1195230803 X:102845058-102845080 CAGAGTTTCCCCAATTGCCTGGG + Intergenic
1196312649 X:114186437-114186459 CAGAATGTACCAGAATATCTGGG + Intergenic
1196627547 X:117893820-117893842 CTAAATGTCCTCAAACACCTAGG - Intergenic
1201888739 Y:18917896-18917918 CAAACTGTACCCAACTACCTTGG + Intergenic