ID: 1182586288

View in Genome Browser
Species Human (GRCh38)
Location 22:31345976-31345998
Sequence CCGCGTGCGCGTGCCCTTCT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 46}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182586288_1182586295 -8 Left 1182586288 22:31345976-31345998 CCAAGAAGGGCACGCGCACGCGG 0: 1
1: 0
2: 1
3: 7
4: 46
Right 1182586295 22:31345991-31346013 GCACGCGGGGAGGAGAAGGAGGG 0: 1
1: 0
2: 3
3: 49
4: 757
1182586288_1182586294 -9 Left 1182586288 22:31345976-31345998 CCAAGAAGGGCACGCGCACGCGG 0: 1
1: 0
2: 1
3: 7
4: 46
Right 1182586294 22:31345990-31346012 CGCACGCGGGGAGGAGAAGGAGG 0: 1
1: 0
2: 0
3: 26
4: 316
1182586288_1182586297 6 Left 1182586288 22:31345976-31345998 CCAAGAAGGGCACGCGCACGCGG 0: 1
1: 0
2: 1
3: 7
4: 46
Right 1182586297 22:31346005-31346027 GAAGGAGGGGTCCGCCGCGCAGG 0: 1
1: 0
2: 0
3: 5
4: 126
1182586288_1182586296 -7 Left 1182586288 22:31345976-31345998 CCAAGAAGGGCACGCGCACGCGG 0: 1
1: 0
2: 1
3: 7
4: 46
Right 1182586296 22:31345992-31346014 CACGCGGGGAGGAGAAGGAGGGG 0: 1
1: 0
2: 2
3: 38
4: 433
1182586288_1182586300 24 Left 1182586288 22:31345976-31345998 CCAAGAAGGGCACGCGCACGCGG 0: 1
1: 0
2: 1
3: 7
4: 46
Right 1182586300 22:31346023-31346045 GCAGGCGCGCGCGCGCGCCGCGG 0: 1
1: 0
2: 5
3: 45
4: 345

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182586288 Original CRISPR CCGCGTGCGCGTGCCCTTCT TGG (reversed) Exonic