ID: 1182586300

View in Genome Browser
Species Human (GRCh38)
Location 22:31346023-31346045
Sequence GCAGGCGCGCGCGCGCGCCG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 396
Summary {0: 1, 1: 0, 2: 5, 3: 45, 4: 345}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182586288_1182586300 24 Left 1182586288 22:31345976-31345998 CCAAGAAGGGCACGCGCACGCGG 0: 1
1: 0
2: 1
3: 7
4: 46
Right 1182586300 22:31346023-31346045 GCAGGCGCGCGCGCGCGCCGCGG 0: 1
1: 0
2: 5
3: 45
4: 345

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182586300 Original CRISPR GCAGGCGCGCGCGCGCGCCG CGG Exonic