ID: 1182586746

View in Genome Browser
Species Human (GRCh38)
Location 22:31347689-31347711
Sequence GCCCAGCCACGCGCGCCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 172}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182586741_1182586746 13 Left 1182586741 22:31347653-31347675 CCGCTCGGGATTCCCACCGCTGC 0: 1
1: 0
2: 0
3: 9
4: 74
Right 1182586746 22:31347689-31347711 GCCCAGCCACGCGCGCCCTGAGG 0: 1
1: 0
2: 1
3: 13
4: 172
1182586744_1182586746 -3 Left 1182586744 22:31347669-31347691 CCGCTGCGCGCCGAGCTCGCGCC 0: 1
1: 0
2: 0
3: 14
4: 142
Right 1182586746 22:31347689-31347711 GCCCAGCCACGCGCGCCCTGAGG 0: 1
1: 0
2: 1
3: 13
4: 172
1182586737_1182586746 27 Left 1182586737 22:31347639-31347661 CCCGGCTTCCAACTCCGCTCGGG 0: 1
1: 0
2: 0
3: 5
4: 74
Right 1182586746 22:31347689-31347711 GCCCAGCCACGCGCGCCCTGAGG 0: 1
1: 0
2: 1
3: 13
4: 172
1182586743_1182586746 0 Left 1182586743 22:31347666-31347688 CCACCGCTGCGCGCCGAGCTCGC 0: 1
1: 0
2: 1
3: 16
4: 166
Right 1182586746 22:31347689-31347711 GCCCAGCCACGCGCGCCCTGAGG 0: 1
1: 0
2: 1
3: 13
4: 172
1182586739_1182586746 26 Left 1182586739 22:31347640-31347662 CCGGCTTCCAACTCCGCTCGGGA 0: 1
1: 0
2: 0
3: 1
4: 63
Right 1182586746 22:31347689-31347711 GCCCAGCCACGCGCGCCCTGAGG 0: 1
1: 0
2: 1
3: 13
4: 172
1182586740_1182586746 19 Left 1182586740 22:31347647-31347669 CCAACTCCGCTCGGGATTCCCAC 0: 1
1: 0
2: 0
3: 0
4: 45
Right 1182586746 22:31347689-31347711 GCCCAGCCACGCGCGCCCTGAGG 0: 1
1: 0
2: 1
3: 13
4: 172
1182586742_1182586746 1 Left 1182586742 22:31347665-31347687 CCCACCGCTGCGCGCCGAGCTCG 0: 1
1: 0
2: 0
3: 5
4: 63
Right 1182586746 22:31347689-31347711 GCCCAGCCACGCGCGCCCTGAGG 0: 1
1: 0
2: 1
3: 13
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182586746 Original CRISPR GCCCAGCCACGCGCGCCCTG AGG Intergenic