ID: 1182588334

View in Genome Browser
Species Human (GRCh38)
Location 22:31359730-31359752
Sequence CTATCAACTGAGGTGGAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182588330_1182588334 2 Left 1182588330 22:31359705-31359727 CCGAGTCTGGCCTGAAAATCAAA No data
Right 1182588334 22:31359730-31359752 CTATCAACTGAGGTGGAGCTTGG No data
1182588329_1182588334 5 Left 1182588329 22:31359702-31359724 CCACCGAGTCTGGCCTGAAAATC No data
Right 1182588334 22:31359730-31359752 CTATCAACTGAGGTGGAGCTTGG No data
1182588331_1182588334 -8 Left 1182588331 22:31359715-31359737 CCTGAAAATCAAATTCTATCAAC No data
Right 1182588334 22:31359730-31359752 CTATCAACTGAGGTGGAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182588334 Original CRISPR CTATCAACTGAGGTGGAGCT TGG Intergenic
No off target data available for this crispr