ID: 1182590905

View in Genome Browser
Species Human (GRCh38)
Location 22:31379003-31379025
Sequence TGTCTCCGATTGTAAAGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182590905_1182590910 23 Left 1182590905 22:31379003-31379025 CCTGTTCTTTACAATCGGAGACA No data
Right 1182590910 22:31379049-31379071 ACCTGTAATCCCAGCACTTTGGG 0: 71908
1: 300079
2: 246221
3: 151210
4: 174122
1182590905_1182590907 -8 Left 1182590905 22:31379003-31379025 CCTGTTCTTTACAATCGGAGACA No data
Right 1182590907 22:31379018-31379040 CGGAGACAACTGGCTGCGCATGG No data
1182590905_1182590912 26 Left 1182590905 22:31379003-31379025 CCTGTTCTTTACAATCGGAGACA No data
Right 1182590912 22:31379052-31379074 TGTAATCCCAGCACTTTGGGAGG 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
1182590905_1182590908 -5 Left 1182590905 22:31379003-31379025 CCTGTTCTTTACAATCGGAGACA No data
Right 1182590908 22:31379021-31379043 AGACAACTGGCTGCGCATGGTGG No data
1182590905_1182590909 22 Left 1182590905 22:31379003-31379025 CCTGTTCTTTACAATCGGAGACA No data
Right 1182590909 22:31379048-31379070 CACCTGTAATCCCAGCACTTTGG 0: 68945
1: 203244
2: 249087
3: 204446
4: 175427

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182590905 Original CRISPR TGTCTCCGATTGTAAAGAAC AGG (reversed) Intergenic
No off target data available for this crispr