ID: 1182595821

View in Genome Browser
Species Human (GRCh38)
Location 22:31419529-31419551
Sequence CTAAAACGTGCAAACTATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 57}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182595818_1182595821 18 Left 1182595818 22:31419488-31419510 CCAAAATAATATATTTTATATGA No data
Right 1182595821 22:31419529-31419551 CTAAAACGTGCAAACTATGGTGG 0: 1
1: 0
2: 0
3: 3
4: 57
1182595819_1182595821 -7 Left 1182595819 22:31419513-31419535 CCATTTATATGAAATTCTAAAAC 0: 6
1: 27
2: 190
3: 752
4: 2321
Right 1182595821 22:31419529-31419551 CTAAAACGTGCAAACTATGGTGG 0: 1
1: 0
2: 0
3: 3
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182595821 Original CRISPR CTAAAACGTGCAAACTATGG TGG Intronic
909068545 1:70964378-70964400 CTAAAACGGGCAATCTATAAAGG + Intronic
909468742 1:76003025-76003047 CTAAAACGTGAACTCTTTGGGGG + Intergenic
909855626 1:80526759-80526781 CTAAAAGGTGCAAAATATATTGG + Intergenic
916203308 1:162292251-162292273 CTAAAGCTAACAAACTATGGGGG - Intronic
918197800 1:182238705-182238727 CTAAAAGTTGCCAACTGTGGTGG - Intergenic
918197964 1:182240378-182240400 CTAAAAGTTGCCAACTGTGGTGG - Intergenic
922121480 1:222673785-222673807 CAAAAACCTGCAAACTAGGTAGG + Intronic
1073799513 10:107026039-107026061 CTCAATCCTGCAACCTATGGTGG - Intronic
1075867182 10:125733908-125733930 CCAAAACGTTTATACTATGGTGG - Intronic
1079646362 11:22868254-22868276 CTAGAACCTGCAAATTATGTAGG + Intergenic
1081453680 11:43199326-43199348 CTAAAACGTGCAAGCAATGATGG + Intergenic
1082640702 11:55656789-55656811 AGAAAACGTGCAATCTTTGGTGG + Intergenic
1095380646 12:41586904-41586926 CTAGAACTTTCAAACTATGTAGG - Intergenic
1104322281 12:127762906-127762928 CTGAAACGTGCAACCAATTGAGG - Intergenic
1116274240 14:42810549-42810571 AAAAAAAGTGCAAACCATGGGGG - Intergenic
1123054137 14:105561256-105561278 TTGAAACGTGCAAAGAATGGAGG + Intergenic
1123078720 14:105681673-105681695 TTGAAACGTGCAAAGAATGGAGG + Intergenic
1124700665 15:31909292-31909314 CAAATGCGTGCAGACTATGGAGG - Intergenic
1124880041 15:33633658-33633680 CACAACTGTGCAAACTATGGGGG + Intronic
1126524010 15:49630124-49630146 CTAGAAAGTACAAACTATAGTGG + Intronic
1127692757 15:61414141-61414163 CTAAAATTTGCAAAACATGGTGG + Intergenic
1133438702 16:5802390-5802412 GTAAAACATGCAAACAAGGGTGG + Intergenic
1135707774 16:24689662-24689684 CTAAAACGTGCACTCTATAAGGG - Intergenic
1137004887 16:35266667-35266689 CTAAAACTTTGAAACTATGTGGG - Intergenic
1137625891 16:49908296-49908318 CTACTATGTGCAAACTATGAGGG + Intergenic
1150584278 17:66503265-66503287 ATAAAACGTGCAAAATACTGTGG - Intronic
1157895881 18:51466647-51466669 CTAAAACTTGCAAAATCTGCAGG + Intergenic
1162242196 19:9364142-9364164 CAAAAACTTGCCAACCATGGGGG - Intronic
1166019886 19:40017660-40017682 ATAAAATGTGCTAACAATGGCGG - Intergenic
1166819912 19:45571783-45571805 CTGAAAGGTGCACAATATGGAGG - Intronic
1168271810 19:55254191-55254213 CTAAAAGTTGCAAAGAATGGGGG - Intronic
926439483 2:12873135-12873157 ATAAAAAATGCAAAATATGGAGG + Intergenic
931014487 2:57960753-57960775 ATTAGATGTGCAAACTATGGTGG + Intronic
935583221 2:104777273-104777295 CTGAAGAGTGCAAACTAAGGGGG - Intergenic
936501621 2:113071501-113071523 CTAACAAGTGCAAATTCTGGAGG - Intronic
945157445 2:206854374-206854396 TTACAACGTGCAAACTAAGAAGG - Intergenic
1182595821 22:31419529-31419551 CTAAAACGTGCAAACTATGGTGG + Intronic
951350920 3:21605951-21605973 TTAAAACGTGCAGACTGTGCTGG + Intronic
963282393 3:143397524-143397546 CTAAAACCTGAAAACCATTGTGG + Intronic
971258452 4:25034483-25034505 CTAACACGAGAACACTATGGGGG + Intergenic
973171892 4:47155558-47155580 CTGAGACGTGCAGACTATGGGGG + Intronic
977750419 4:100603229-100603251 CTAAAAGATGAAAGCTATGGGGG - Intronic
979068454 4:116169167-116169189 CTCAAACGTGAAAACTATTAAGG - Intergenic
987612537 5:20225014-20225036 CTTAAACGTGCAAAGTAAAGTGG + Intronic
990023520 5:51158387-51158409 CTAGAACTTGCAAACTGTGGTGG - Intergenic
998198835 5:140101288-140101310 TTAAATTGTGCAAGCTATGGAGG + Intergenic
998866690 5:146511909-146511931 CTGAAACGAGCAACCTATGAAGG - Exonic
1002038751 5:176494842-176494864 CTACAACTTGCTAATTATGGCGG - Intronic
1007808731 6:44471585-44471607 TGAAAATGTTCAAACTATGGAGG - Intergenic
1014246663 6:119077977-119077999 CAAAACCCTGCAAACTTTGGTGG - Intronic
1015700777 6:136033964-136033986 GAAAAAAATGCAAACTATGGAGG - Intronic
1015828064 6:137336756-137336778 CTAGAAAAGGCAAACTATGGAGG - Intergenic
1025287775 7:57681431-57681453 TTAAAACGTGCAAACTAATATGG - Intergenic
1031039806 7:116827477-116827499 ATAAAAGGTGGAAACTTTGGAGG - Intronic
1032633610 7:133681802-133681824 CTAAAACGTACAACCGATGAAGG - Intronic
1033116413 7:138629609-138629631 CTAAAACATGCTAACTATAAAGG - Intronic
1049959433 9:724188-724210 CTAAAAAATGCAAACCATTGAGG - Intronic
1051777462 9:20651527-20651549 ATAAAACTTGCAAACCTTGGGGG - Intergenic
1057509763 9:95668253-95668275 CAAAGAAGTGGAAACTATGGTGG - Intergenic
1059822458 9:117989154-117989176 CTAGAAGGTGCCATCTATGGGGG - Intergenic
1188362261 X:29269967-29269989 CTAGAAAATGCAAACTATAGTGG - Intronic