ID: 1182596283

View in Genome Browser
Species Human (GRCh38)
Location 22:31423441-31423463
Sequence CTGAATTGGAAGCCTTGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 164}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182596283 Original CRISPR CTGAATTGGAAGCCTTGTGA TGG Intronic
901175792 1:7298161-7298183 CTCAATGGGAAGCCTTTGGATGG + Intronic
901861569 1:12078008-12078030 CTGGGTTGGAAGCCATCTGAGGG + Intronic
902533824 1:17107496-17107518 CTGAATTGGATGCTCTGAGATGG - Intronic
903803302 1:25986055-25986077 CTAGATTGTAAGCCTTCTGAAGG - Intronic
905044820 1:34988152-34988174 CTGAATTGGAAACATTGTGTTGG - Exonic
906754932 1:48302657-48302679 CTGAATGTGAAGCCTTGTGAAGG - Intronic
907154906 1:52324678-52324700 CTGAATTGTGAGCCTCTTGAGGG + Intronic
907162639 1:52382474-52382496 CTGAACTGCAAGGCCTGTGAGGG + Intronic
907291856 1:53419358-53419380 GTGAATTCCCAGCCTTGTGAAGG + Intergenic
910107163 1:83644170-83644192 CTGGACTAGAAGCCTTGTGAAGG - Intergenic
911138330 1:94467406-94467428 CTAAATTGAAAGCCCTATGAGGG + Intronic
911402407 1:97392866-97392888 ATTGATTGCAAGCCTTGTGAGGG - Intronic
913237701 1:116799046-116799068 CTGCATTGGGAGCCTTGGGTGGG + Intergenic
914452812 1:147807645-147807667 CTGAATTGTAAGTCGGGTGAAGG - Intergenic
914973332 1:152331938-152331960 AGGAATTGGAAGCTTGGTGAGGG - Intergenic
917303869 1:173607552-173607574 GTGAATTGTAAGCTTTTTGAGGG - Intergenic
917325658 1:173829372-173829394 TTGAATTTGAAGCCATGTGACGG + Intronic
917990255 1:180368623-180368645 CTGAATAGGAAGTCTTTTCAGGG + Intronic
919505945 1:198397648-198397670 CTGAAATGGAAGCCCCATGAGGG - Intergenic
921147812 1:212376363-212376385 CTAAATTGGAAGTCTTTTGTTGG - Intronic
921931323 1:220756649-220756671 CTTAATTGGAAGACATGTGAAGG + Intronic
922083175 1:222318156-222318178 CTGCGTTGGAAGCTTTCTGAAGG - Intergenic
923101829 1:230823157-230823179 CTGACTTGGTAGCCTGGTCAGGG + Intergenic
923693424 1:236220871-236220893 GTGAGTTGGAAGCCTTTAGATGG + Exonic
924501719 1:244644530-244644552 CTGCAGTGGGAGACTTGTGAGGG - Intergenic
1064772278 10:18735752-18735774 CTGATGTGGAGGCCTTGTGGTGG + Intergenic
1064913987 10:20435981-20436003 CTGAATTTGAATACTTATGAAGG - Intergenic
1068070112 10:52184730-52184752 CATAATTGGAAGCTTTCTGAGGG - Intronic
1070268889 10:74932599-74932621 CTAAATGGGAAGTCTTGGGAGGG + Intronic
1070698014 10:78577434-78577456 CTGAGTTGGAAGCCTGGGCAAGG + Intergenic
1071000323 10:80824209-80824231 CTGGACTGAAAGCCTTGTTAAGG - Intergenic
1071858430 10:89648600-89648622 CTGAATTGTAAGCCCTTTGAGGG - Intergenic
1073279057 10:102338626-102338648 CTGAATTGTATGCTGTGTGAGGG + Intronic
1073669810 10:105575081-105575103 CTGATGTGGAATACTTGTGATGG - Intergenic
1074939564 10:118221229-118221251 CTGGATTGGAAGCTTCTTGAAGG + Intergenic
1074939607 10:118221522-118221544 CTGGATTGGAAGCTTCTTGAAGG - Intergenic
1078740745 11:14064181-14064203 CTGAATTCCAAGCTTTTTGAGGG - Intronic
1080534256 11:33206197-33206219 CTGAGTTGGAAGGCCTGAGAAGG - Intergenic
1081777551 11:45685889-45685911 CTGCATTGGAAGCTCTGTGGGGG - Intergenic
1083474094 11:62904471-62904493 CTGAATGGGAAGGCTTTTGAAGG + Intergenic
1083608221 11:63991820-63991842 CTGAACTGTAAGTTTTGTGAGGG - Intronic
1087052781 11:93903248-93903270 GTGAAATGGAAGCCTTTGGAGGG + Intergenic
1090187941 11:124750554-124750576 CTGAATTAGAAGACTTGGAAAGG + Intronic
1090677296 11:129011503-129011525 CTGAGCTGGAAGCCATGAGAGGG + Intronic
1092023117 12:5218565-5218587 ATGAATTAGCAGTCTTGTGATGG + Intergenic
1092672841 12:10882825-10882847 CTAATTAGGAAGCCTTGGGAAGG - Intronic
1092676871 12:10930513-10930535 CTAATTAGGAAGCCTTGGGAAGG + Intronic
1092744954 12:11664682-11664704 CTGGAATGGAAGCTTTGGGAGGG + Intronic
1094179107 12:27572289-27572311 CTGTACTGGCAGCCTAGTGAAGG - Intronic
1097277721 12:57824501-57824523 ATCCATTGGAAGCCTGGTGAGGG - Intronic
1097975107 12:65677108-65677130 CTGATTTGGAAGGCTTCTCAAGG - Intergenic
1098213266 12:68188333-68188355 CGGAAATGAAAGCCTTGGGACGG + Intergenic
1101525516 12:105524919-105524941 CTGAGTTGAAAGCTTTGTAAAGG + Intergenic
1102233178 12:111277498-111277520 CTAAATGGGCAGCCTGGTGAGGG - Intronic
1102915120 12:116746811-116746833 CAGAATGGGAAGCCCTGGGAGGG + Intronic
1103021575 12:117538883-117538905 CTGAGTTGGAAGCATTCTTAGGG + Intronic
1105656566 13:22447276-22447298 CTGAGTTGGAAGCCTTCAGCAGG - Intergenic
1108377601 13:49828057-49828079 ATGAGTTGGAAGCCTTGTGCTGG - Intergenic
1109941758 13:69376907-69376929 CTTCATGGGAACCCTTGTGAAGG + Intergenic
1110461161 13:75747249-75747271 CTGAATTGTAAACCCTATGATGG - Intronic
1111242698 13:85496544-85496566 CTGCATGGGAAGCTTTGAGAAGG - Intergenic
1113506282 13:110818936-110818958 CTGAATTGGGGGCGTTGTGAGGG - Intergenic
1114024713 14:18514476-18514498 CTGTTCTGGAATCCTTGTGATGG - Intergenic
1114727434 14:24953991-24954013 CTGAATTGGCAGCCTTTGCAAGG - Intronic
1117564368 14:56978273-56978295 CTGACCTGGAAGCTCTGTGAGGG - Intergenic
1118026887 14:61778272-61778294 CTTTACTGGAAGCCTTGTGGAGG + Intronic
1118172533 14:63402153-63402175 CAGAATTGGGAGCCTGGTCAGGG - Intronic
1120807627 14:88769908-88769930 CAGAATTGGTAGCCCTGTGGAGG + Intronic
1127653530 15:61033335-61033357 CTGAACTGGAAGCATTGTTGGGG - Intronic
1128932064 15:71714222-71714244 CTGAAATGTAAGCTTTATGAGGG + Intronic
1130245091 15:82239809-82239831 TTAAAATGGAAGCCTTGAGATGG - Intronic
1130418032 15:83712811-83712833 CTGAAGTGGAAGGTCTGTGAAGG - Intronic
1131804888 15:96110964-96110986 CTGAATTGGCAGGCTTGGGGTGG - Intergenic
1137767603 16:50990194-50990216 CTGATTTGGGAGCATGGTGACGG + Intergenic
1142222413 16:88861997-88862019 GTGAATTGGAAGCCCTGGAATGG + Exonic
1143348175 17:6265805-6265827 CTAAAACGGAAGCCTTGGGAAGG + Intergenic
1143477376 17:7210674-7210696 GGGAATTGGAGGCCTTGTGAAGG - Intronic
1144377248 17:14656922-14656944 CTGTATTTGAAGTCTTGTGCAGG + Intergenic
1145179852 17:20737941-20737963 CTTAACTGGAAGCCTTGGAATGG + Intergenic
1149839570 17:59947604-59947626 CTTAACTGGAAGCCTTGGAATGG + Exonic
1149865923 17:60150910-60150932 CTGAATTGGGAGCCTGGCGGGGG + Intronic
1153426433 18:4969937-4969959 CTGAATCAGAAGCCTTAAGAAGG - Intergenic
1155065470 18:22265414-22265436 CTGAGAAGGAAGCGTTGTGATGG + Intergenic
1156590372 18:38481333-38481355 CTGAAATGAAAGCCTCATGATGG - Intergenic
1156795933 18:41046066-41046088 CTGAATTGAACACCTTGTTAGGG - Intergenic
1157383364 18:47241097-47241119 CTTGATTGGAAGCAATGTGAGGG + Intronic
1159096325 18:63906390-63906412 CTGTATAGGAAGCATAGTGATGG - Intronic
1165739169 19:38195465-38195487 CTAAAGTGGCAGCCCTGTGAGGG - Intronic
1166658010 19:44626461-44626483 CTGGACTGTAAGTCTTGTGAAGG - Intronic
1167238061 19:48326820-48326842 CTGCAGTGGAAGCCTGGGGAGGG - Exonic
925249866 2:2422902-2422924 TTGAATTGGTATCCTTGTGGGGG + Intergenic
927946526 2:27138109-27138131 CCGAATTGGAAGCCAGGAGAGGG + Exonic
931908598 2:66869830-66869852 CTGAAATGGAAGCCACATGAGGG - Intergenic
940318834 2:152352529-152352551 GTAAATTGACAGCCTTGTGATGG + Intronic
940618848 2:156084833-156084855 CTGAAATGGGAGCAATGTGAAGG + Intergenic
941908693 2:170741808-170741830 CTGAAATGAAAGCTCTGTGAAGG - Intergenic
942594731 2:177582181-177582203 CTGAATTGTAAGCTCTCTGAGGG - Intergenic
946558920 2:220890819-220890841 CTGAATTGGAACCTTGGTGAAGG - Intergenic
1171077388 20:22142497-22142519 CTGAATAATAACCCTTGTGATGG + Intergenic
1171179697 20:23083742-23083764 CTGAAGTGGAAGCTGTGTGTTGG - Exonic
1171982214 20:31636170-31636192 CAGAATTGTAAGCCCTGTGGGGG + Intergenic
1172601652 20:36187983-36188005 CTAGATTGGGAGCATTGTGAGGG + Intronic
1179038297 21:37779300-37779322 CTGGATTCCAAGCTTTGTGAGGG + Intronic
1180448873 22:15441957-15441979 CTGTTCTGGAATCCTTGTGATGG - Intergenic
1182149965 22:28020987-28021009 CTGCCTTGGAAGCCAGGTGAGGG - Intronic
1182183742 22:28379198-28379220 CTGATTTGGAAACAGTGTGATGG + Intronic
1182578344 22:31289111-31289133 CTCACTTAAAAGCCTTGTGAGGG - Intronic
1182596283 22:31423441-31423463 CTGAATTGGAAGCCTTGTGATGG + Intronic
949255846 3:2044878-2044900 CTGATTTGGTTGCCTGGTGAGGG - Intergenic
950902036 3:16506379-16506401 CTGAGTTGGAAGCCTCTGGAAGG + Intronic
951529334 3:23684026-23684048 CAGACTTGGAAGCCTTCTCAGGG + Intergenic
952096743 3:29962974-29962996 CAGAACTGGAAGCAATGTGAAGG - Intronic
953265378 3:41381779-41381801 GTGAAGTGGAAGCCTTTGGAGGG - Intronic
954325118 3:49859299-49859321 CTGAGTAGGCAGCCTGGTGAGGG - Exonic
954615088 3:51965441-51965463 CTGACTTGGAAGCCTGCGGAGGG - Intronic
958660602 3:97061878-97061900 CTAAATTGGGAGCCTCTTGAAGG - Intronic
960663784 3:120090556-120090578 CTGAAGTGGAATATTTGTGAAGG - Intronic
960688717 3:120321293-120321315 CTGAACTGGAAGTGTTTTGAGGG - Intergenic
964362297 3:155911250-155911272 CTGAATTCCAAGCTTTTTGAGGG - Exonic
966624362 3:182000485-182000507 CTGAAGTGGAAACCTTGGGAAGG + Intergenic
970030062 4:11664118-11664140 CTGAAATGGAAAATTTGTGAAGG + Intergenic
972170172 4:36336072-36336094 CTGAATTATAAGCCTCTTGAGGG - Intronic
972720214 4:41688834-41688856 CTAAACTGGAAGCCTCTTGAGGG - Intronic
977689330 4:99887783-99887805 TTACATTGGAAGCCATGTGAAGG - Intronic
979074981 4:116259887-116259909 CTCAATTGGAAGACTTGCAAGGG + Intergenic
981475862 4:145186218-145186240 AAGACTTGGAAGGCTTGTGAAGG - Intergenic
981861777 4:149364095-149364117 CTGAACTGGAAGACTGGAGAAGG + Intergenic
984074617 4:175159911-175159933 CTAAATAGGAAGCATGGTGACGG - Intergenic
986058049 5:4158845-4158867 CTGAGTTGAAAACATTGTGAAGG + Intergenic
991078017 5:62563962-62563984 GTGAGGTGGTAGCCTTGTGATGG + Intronic
991296401 5:65085756-65085778 CTGTACTGGAAGCCCTGTTATGG + Intergenic
992630411 5:78675100-78675122 CTGATTTGGAAGCCCTGTATTGG + Intronic
993306237 5:86278925-86278947 CTGAATTGGAAAACTTGGAATGG + Intergenic
993363623 5:87007688-87007710 CTGTGTTTTAAGCCTTGTGATGG + Intergenic
996388986 5:122939729-122939751 CTGAATTAGAATCTTTGTGATGG + Intronic
996429982 5:123363373-123363395 CTAAATTGCAAGCTCTGTGATGG + Intronic
997896338 5:137721004-137721026 CTGAACTCTAAGCTTTGTGAGGG - Intronic
998004875 5:138650164-138650186 CTGGAGTGGAAGCTCTGTGAAGG - Intronic
1000231985 5:159324490-159324512 CTGAATCAGAAACCTTGGGATGG + Intronic
1001765198 5:174240258-174240280 CTGTGTTGGATGCCTTGTGGAGG + Intronic
1004158560 6:13192811-13192833 CTGAACAGGAGGCTTTGTGAGGG + Intronic
1004328595 6:14700417-14700439 CTGTACTGGAAGCATTGTGCTGG - Intergenic
1004737012 6:18417133-18417155 ATGGATTGGAAGACTTGTTAAGG + Intronic
1005194391 6:23266181-23266203 CTGGAATGTAAGCCTTCTGAAGG - Intergenic
1007683184 6:43648586-43648608 CTTAATTGGAAGCCATTGGAAGG + Intronic
1009810912 6:68665042-68665064 CTGAAGGTGAAGCCTGGTGAAGG - Intronic
1010357790 6:74954733-74954755 TTCAATTGGAAGCTCTGTGAGGG - Intergenic
1011125457 6:84002680-84002702 CTGAATTTGAAAAGTTGTGAGGG + Intergenic
1012908587 6:105094577-105094599 CAGAATTGAAAACCTTCTGATGG - Intergenic
1013037737 6:106402921-106402943 CTGAAATGTAAGCTCTGTGAGGG + Intergenic
1014596398 6:123346457-123346479 CTGTATTGTAATCTTTGTGATGG + Intronic
1021250551 7:18320308-18320330 CAGATTTCGAAGCCTTGTGGAGG - Intronic
1022513849 7:30963257-30963279 GTTGGTTGGAAGCCTTGTGAAGG - Intronic
1022820164 7:33951597-33951619 CTGAACTGGAAGTTTTGGGAGGG + Intronic
1025606911 7:63046105-63046127 CTGAATTAGAATCCTTGGGAAGG - Intergenic
1025745264 7:64237290-64237312 CTGAAGGTGAAGCCTTGTCATGG + Intronic
1026370004 7:69690055-69690077 CTGGATTGTAAGCTTTGTAAGGG + Intronic
1031815316 7:126426546-126426568 CTGGATTTGGAGCTTTGTGATGG + Intergenic
1033327389 7:140390831-140390853 CTGAATTGGGAGCCTTGTTGAGG - Intronic
1034848969 7:154475959-154475981 CTGAATTGGAAGTCAGGGGACGG - Intronic
1035934914 8:3826171-3826193 CTGAGTTGAAAGCCCTGTGGAGG + Intronic
1036778021 8:11626900-11626922 CTGAATTAGAATCCCTGGGAAGG + Intergenic
1036815671 8:11901218-11901240 CTGAAATGGGGCCCTTGTGATGG + Intergenic
1038713183 8:29967822-29967844 CTGAAATGGCAGGGTTGTGATGG + Intergenic
1041364962 8:57092300-57092322 CAGAATCGGAAGCCCTGAGAAGG + Intergenic
1045858043 8:106787126-106787148 CTGAATTGCAAGCCCTGAGATGG - Intergenic
1046515814 8:115258995-115259017 ATGAATTTTAAGCCTTGTCAGGG - Intergenic
1046523687 8:115357941-115357963 CTAGATTGGAAGCTTGGTGAGGG - Intergenic
1046954002 8:120044868-120044890 CTAAATTGTAAGCTTCGTGAAGG + Intronic
1050491023 9:6187942-6187964 ATGAATTGGTAACCTTGGGAAGG - Intergenic
1051324187 9:15946798-15946820 TTGAATTAGATGCCTTTTGATGG + Intronic
1052607733 9:30726576-30726598 TTTAATTGGAAGGCCTGTGAAGG - Intergenic
1059847911 9:118302213-118302235 CTGAATTAGAACCTTTGTGGTGG - Intergenic
1060672906 9:125485997-125486019 CTAATCTGGAAGCTTTGTGAAGG + Intronic
1062305266 9:135902720-135902742 CTGATTTGGAAACCATGTTATGG - Intronic
1187835866 X:23431923-23431945 CTGAATTGTAAGCTTTGTGATGG - Intergenic
1191014550 X:55794535-55794557 CTGAAGTGGAAACATTGTCAGGG + Intergenic
1192777793 X:74263138-74263160 CCTAATTGGCAGCCTTGTCATGG - Intergenic
1192957538 X:76089091-76089113 ATGAATTGGAAGATTTATGATGG - Intergenic
1194165025 X:90505574-90505596 CTGAAATGGAGGCCTCATGATGG - Intergenic
1198148079 X:133878897-133878919 ATGAACTGGAAGCCTTGCCAAGG - Intronic
1198865915 X:141122771-141122793 CTGATTTGGAAGCTATGTGAAGG + Intergenic
1200511289 Y:4083377-4083399 CTGAAATGGAGGCCTCATGATGG - Intergenic