ID: 1182598816

View in Genome Browser
Species Human (GRCh38)
Location 22:31443697-31443719
Sequence CCCCACGTGGGTCTTTGCAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 127}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182598816_1182598820 27 Left 1182598816 22:31443697-31443719 CCGGTGCAAAGACCCACGTGGGG 0: 1
1: 0
2: 1
3: 11
4: 127
Right 1182598820 22:31443747-31443769 TTTTTTTCCTTCTTCTCTATCGG 0: 1
1: 1
2: 12
3: 186
4: 1566

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182598816 Original CRISPR CCCCACGTGGGTCTTTGCAC CGG (reversed) Intronic
900605275 1:3521083-3521105 CCCCGCCTGGGGCTTTGCAGGGG - Intronic
902834499 1:19037900-19037922 CGCCAGGGGGGACTTTGCACGGG + Intergenic
903292321 1:22322124-22322146 CCCCACCTGGTTCTCTCCACGGG + Intergenic
904587385 1:31587840-31587862 CCCCAAGTGGGTCAGTGCCCAGG - Intergenic
904697151 1:32336921-32336943 CCCCACGTGGGACTTTGCAGTGG - Intergenic
906290410 1:44616049-44616071 CCACATGTGGGTCTCTGCATAGG + Intronic
917760488 1:178151874-178151896 CTCCAGGTGGGCCTTTCCACAGG - Intronic
917900560 1:179539071-179539093 GCCTATGTGTGTCTTTGCACAGG + Intronic
918325106 1:183402764-183402786 TCCCACGAAGGTCTTTGGACAGG + Intronic
921816903 1:219574621-219574643 CCCCATGTGTTTCTTTGCCCTGG + Intergenic
922748945 1:228061888-228061910 CACCTCGTGGGGCTGTGCACAGG + Intergenic
1065195599 10:23262209-23262231 CCAGACGTGGGTCTTTTCCCCGG - Intergenic
1074942127 10:118246190-118246212 CCCCAGGTGGGTCGATGCCCGGG - Intergenic
1076729254 10:132430012-132430034 CCCCAGGTTGGGCTTTGCGCTGG + Intergenic
1077508762 11:2944404-2944426 TGCCATGTGGGTCTTTGCAGGGG - Intergenic
1084662927 11:70557721-70557743 AACCACTTGGGCCTTTGCACAGG - Intronic
1084953404 11:72678929-72678951 CCACATCTGGGTCTTTGCAATGG + Intergenic
1088214709 11:107494938-107494960 TTCCCCGTGGGCCTTTGCACTGG + Intergenic
1088807191 11:113363348-113363370 CCCCACATGGGTGATTGCAAGGG + Intronic
1091096246 11:132824924-132824946 TCCCAGGTAGGTCTTTGCATAGG + Intronic
1095924698 12:47566902-47566924 TCCCACGTGGGTCTGTCCACAGG + Intergenic
1096071323 12:48776932-48776954 GTCCGCATGGGTCTTTGCACAGG + Intronic
1100825301 12:98469322-98469344 CCCTATGTGGGTCTTTCCACAGG - Intergenic
1102019446 12:109671541-109671563 CCCCACGTGGATCTCCCCACAGG - Intergenic
1106312305 13:28564562-28564584 GCACACTTGGGTCTTTGAACAGG + Intergenic
1109316532 13:60756036-60756058 TCTCACCTGGGTCTTTACACAGG - Intergenic
1110793125 13:79607002-79607024 CCCCTCGTGGCTGCTTGCACAGG + Intergenic
1112760725 13:102691009-102691031 TACCAAGTGTGTCTTTGCACTGG - Intronic
1114083139 14:19218823-19218845 CCCCACGAGGGGCTGTGCAGTGG + Intergenic
1114182743 14:20379509-20379531 CCCCTCCTGTGTCTTTGCTCAGG + Intronic
1116222796 14:42110823-42110845 CTCCTCCTGGATCTTTGCACAGG + Intergenic
1120743519 14:88133122-88133144 CACCACTTGGGCATTTGCACAGG + Intergenic
1121351164 14:93174189-93174211 ACCCACGTGGGCCTGTCCACCGG - Intergenic
1129264851 15:74388042-74388064 GCCCACGTGGGCCTTTCCGCTGG + Intergenic
1130715529 15:86329846-86329868 CTCCACTTGGATCTCTGCACAGG - Intronic
1131863673 15:96682617-96682639 CACCACGAGGGTCTTTCCAGAGG - Intergenic
1135121347 16:19769074-19769096 CCCCATCTGGGTCTTTCCATGGG + Intronic
1140677402 16:77346045-77346067 CCCAAAGCGGGTCTTTACACTGG + Intronic
1141410272 16:83828387-83828409 CCCCAGGTGTGTCTGTGCCCAGG + Intergenic
1141699145 16:85634501-85634523 CCCCAAGTGGCTCCTTGCCCAGG + Intronic
1144628535 17:16857869-16857891 CCCCAGGTGGGACTTGGCAGGGG - Intergenic
1145160122 17:20568440-20568462 CCCCAGGTGGGACTTGGCAGGGG - Intergenic
1148455042 17:47806756-47806778 CCCCAGGTGTCTCTCTGCACTGG - Intergenic
1149207170 17:54261729-54261751 CACCACTTGGGCCTTTCCACAGG + Intergenic
1150196223 17:63302673-63302695 GCCTATGTGTGTCTTTGCACGGG + Intronic
1150616317 17:66775197-66775219 CCCCACATGGGACTTTGCCACGG - Intronic
1151940018 17:77286529-77286551 TCCCAGGTGGGTGTTTGCAGAGG + Intronic
1153619950 18:6968085-6968107 CCCCAAGTGGGTCTCTGCCTTGG + Intronic
1154348204 18:13561648-13561670 CATCACGTCCGTCTTTGCACAGG - Intronic
1154499839 18:14990498-14990520 CCCCACGAGGGGCTGTGCAGTGG + Intergenic
1156468560 18:37363118-37363140 CACCAGGAGGGTCTTTGCTCTGG - Intronic
1157173227 18:45427334-45427356 CCCCACCTGGTTCTTTCCATGGG + Intronic
1157591425 18:48838426-48838448 TCTCACCTGGGTCCTTGCACAGG + Intronic
1158676758 18:59527377-59527399 GCCTACATGTGTCTTTGCACAGG + Intronic
1160911278 19:1474910-1474932 GCCCACGTGGGTGTTGACACAGG - Exonic
1163478438 19:17540202-17540224 TCCCACCTGGGTCTTTGTAGGGG - Intronic
1164920304 19:32084196-32084218 CCCCACCTGGGTCTCTACCCGGG + Intergenic
1165462655 19:35953199-35953221 ACCCATCTGGGTCCTTGCACTGG + Intergenic
1168375984 19:55879616-55879638 CCCCAGGTAGCTCTTTTCACTGG + Intronic
925282484 2:2694501-2694523 CCCCACATGGCTCCTTGCCCTGG + Intergenic
927931719 2:27049925-27049947 TCCCTTGTGGGTCTTTGCACAGG - Intronic
931762451 2:65430662-65430684 CCCCGCGCGCGTCTTTGCAGGGG - Intronic
933642969 2:84783994-84784016 CCTCACTAGGGCCTTTGCACTGG - Intronic
934847677 2:97672660-97672682 CACCAGGTGGGCCTTGGCACTGG + Intergenic
936862324 2:117032588-117032610 CCCCTCGTGGCTGTTTTCACGGG + Intergenic
937209092 2:120256240-120256262 CACCATGTGGGCCTATGCACAGG + Intronic
937547983 2:123048266-123048288 CTCCACATGGGCCTTTCCACAGG + Intergenic
938499050 2:131820853-131820875 CCCCACGAGGGGCTGTGCAGTGG + Intergenic
939992228 2:148886468-148886490 CCTCACCTGGGTCTTTGGCCAGG + Intronic
942118995 2:172758196-172758218 CCACACCTGAGCCTTTGCACTGG - Intronic
945040076 2:205736557-205736579 TAACAAGTGGGTCTTTGCACAGG - Intronic
945710956 2:213293544-213293566 CCCCATGTGGGTCTCTCCACAGG - Intronic
948528182 2:238586349-238586371 CACCACGAGGCTCTGTGCACTGG + Intergenic
948585853 2:239019187-239019209 CCCCACATGGGTGTCTGCCCAGG - Intergenic
1168966804 20:1903674-1903696 CCACCCGAGGGCCTTTGCACTGG + Intronic
1169519183 20:6352684-6352706 TCCTACGTGGGTCTCTTCACAGG - Intergenic
1171933947 20:31256094-31256116 CTGCATGTGGGTCTGTGCACTGG - Intergenic
1172486561 20:35301858-35301880 CCCCACGTGGTTCTCTGCTCTGG - Intergenic
1172892057 20:38272539-38272561 CGCCACCTGGGTGTTTCCACAGG - Intronic
1175635775 20:60581787-60581809 CCCCATATGGGCCTCTGCACAGG + Intergenic
1178878841 21:36432783-36432805 GCCCGTGTGGGGCTTTGCACAGG + Intergenic
1179455609 21:41497768-41497790 TCCCACGTGGGTCTCTTCCCTGG + Intronic
1180294834 22:10874444-10874466 CCCCACGAGGGGCTGTGCAGTGG - Intergenic
1180497640 22:15903858-15903880 CCCCACGAGGGGCTGTGCAGTGG - Intergenic
1181821366 22:25478241-25478263 CACCACATGGGTCTCTCCACTGG - Intergenic
1182598816 22:31443697-31443719 CCCCACGTGGGTCTTTGCACCGG - Intronic
1182621556 22:31621317-31621339 CACCAGGTGGGTCACTGCACAGG - Exonic
950810939 3:15649205-15649227 CACCACTTGGGTCTTTCCATAGG + Intergenic
953498312 3:43407864-43407886 GCCCACGTGGGGCTTTGCAGGGG + Intronic
954630186 3:52043811-52043833 CCCCACTGGGGTCTGGGCACAGG - Intergenic
954762063 3:52882170-52882192 CACCACGTGGGTCTCTTCACAGG + Intronic
955621236 3:60866436-60866458 CCCCATGTGGGCCTCTCCACTGG - Intronic
958255274 3:91318513-91318535 GCCTATGTGTGTCTTTGCACAGG + Intergenic
961554064 3:127685581-127685603 CCCCACGTGCTGTTTTGCACTGG - Intergenic
961653077 3:128426853-128426875 CCCCACGTGGCTCTGAGCACCGG + Intergenic
962655658 3:137542050-137542072 CTCCATGTGGGTGTTTGCAAAGG + Intergenic
962874667 3:139526746-139526768 CACCACGTGGTTCTGTGCAAGGG + Intronic
963725189 3:148911930-148911952 CCCCAGGTGGCTCATGGCACTGG + Intergenic
965538336 3:169848044-169848066 CCCCACCTGGTGCTTTGCAGGGG + Intronic
967509042 3:190288721-190288743 CCCCCAGTAGGTATTTGCACAGG + Intergenic
971717432 4:30197330-30197352 CCCCACTTGTTTCTTTCCACTGG + Intergenic
976793009 4:88900905-88900927 CCCTATGTGTGTCTTTGCACAGG - Intronic
978863969 4:113485018-113485040 CCCCACGTGGTTCAGTGCAGTGG + Intronic
979904469 4:126269275-126269297 TACCACGTGGGTCTTTTCACAGG - Intergenic
981490646 4:145336077-145336099 CGCCACGTGGGCCTTTCCATTGG + Intergenic
985733593 5:1564966-1564988 CCACAGGCGGGTCTGTGCACTGG + Intergenic
986064140 5:4219497-4219519 CACCACGTGGGCCTCTGTACAGG + Intergenic
986506587 5:8457957-8457979 CCCCACGTCGGCCTCTGCGCGGG + Intergenic
987687822 5:21227520-21227542 GCCTATGTGTGTCTTTGCACAGG - Intergenic
990627591 5:57632020-57632042 TGCCATGTGGGTCTTTCCACAGG - Intergenic
992446793 5:76841529-76841551 CTCCACGTGGGCCTCTTCACAGG + Intergenic
995129336 5:108613131-108613153 CCCCTCGTGGCTGTTTTCACAGG - Intergenic
996671224 5:126120302-126120324 CTCCACGTTGATCTTTGGACAGG + Intergenic
998286184 5:140863056-140863078 TTCCACGTGGGGCTCTGCACGGG + Intronic
999275767 5:150329063-150329085 CCCCAACAGGGCCTTTGCACTGG + Intronic
999318063 5:150596806-150596828 CCTGACTTGGGTCTTTGCATGGG - Intergenic
1007366790 6:41399725-41399747 TCCCATGTGGGCCTTTCCACAGG - Intergenic
1009933026 6:70198960-70198982 CCCCACATGGGCCTCTCCACAGG + Intronic
1010740437 6:79496310-79496332 CCACACTTAGGTCTTTACACAGG + Intronic
1011045180 6:83073822-83073844 CCCCACATGGGCCTCTTCACAGG + Intronic
1019313564 7:374448-374470 CCCCGGGTGAGTTTTTGCACTGG - Intergenic
1019791311 7:3015666-3015688 CCCCACGGGGGCTTTGGCACTGG + Intronic
1039937111 8:42054468-42054490 CCCCAGTTTGGTCTTTTCACAGG - Intergenic
1040415272 8:47189388-47189410 CCCCAAGCGGGGCTCTGCACAGG + Intergenic
1043461815 8:80467977-80467999 TCCTCTGTGGGTCTTTGCACAGG + Intergenic
1046074124 8:109296871-109296893 CCCCATGTGGGTCTGTCCATGGG - Intronic
1047312252 8:123702298-123702320 CCACAAGTGGGTCTTTATACAGG - Intronic
1052774532 9:32720082-32720104 CACCACGTGTGTCTTTTCTCTGG - Intergenic
1053297232 9:36923589-36923611 CCCCTTGTGGGCCTTGGCACAGG - Intronic
1054913926 9:70478846-70478868 CCCCACCTGGGCCTGAGCACTGG + Intergenic
1059032791 9:110718158-110718180 CCCCATGTGGGTCTCTCCTCAGG + Intronic
1059454425 9:114390520-114390542 CCCCACGTGGGTCCCTGGATCGG + Intronic
1061543624 9:131291122-131291144 CCCCACGTGGCACCTGGCACAGG - Intronic
1203794921 EBV:170679-170701 CCCCACGGGGGTCTTTCCTGGGG - Intergenic
1186739770 X:12505310-12505332 CCCCACGTGGCATTTGGCACAGG - Intronic
1189310909 X:40016882-40016904 CTCCACGTGGGCCTCTCCACAGG + Intergenic
1190133545 X:47773022-47773044 CCCCATGTGGGTGTTACCACTGG + Intergenic
1190473023 X:50801432-50801454 CCCCACCTGGGTCTTAGCAGTGG + Intronic
1191002960 X:55681026-55681048 CCCCATCTGCGTCTTTTCACTGG + Intergenic
1193447907 X:81627546-81627568 CCCTACTAGAGTCTTTGCACTGG + Intergenic