ID: 1182599182

View in Genome Browser
Species Human (GRCh38)
Location 22:31446662-31446684
Sequence CTGGACAGTGGAGAGTTCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 267}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182599182 Original CRISPR CTGGACAGTGGAGAGTTCTG AGG Intronic
901004453 1:6165200-6165222 CTGGACAGGGGCGAGGCCTGGGG - Intronic
901965606 1:12863537-12863559 CTGGACCCTCGAGAGTACTGGGG - Intronic
901981003 1:13033915-13033937 CTGGACCCTCGAGAGTACTGGGG - Intronic
902001084 1:13195015-13195037 CTGGACCCTCGAGAGTACTGGGG + Intergenic
902020315 1:13340719-13340741 CTGGACCCTCGAGAGTACTGGGG + Intergenic
902117009 1:14129491-14129513 CTGGAAAGTGGAGGATTCAGGGG - Intergenic
902941421 1:19802559-19802581 GAGGAGAGTGGAGAGTGCTGGGG + Intergenic
903862159 1:26371030-26371052 CTGAACAGGGGAGCCTTCTGTGG + Intronic
904317322 1:29673856-29673878 CAGGAAAGTGGAGAGAGCTGAGG + Intergenic
904424023 1:30412114-30412136 CTGGACGGTGGAGGAGTCTGAGG + Intergenic
905304859 1:37010591-37010613 CTGCACACTGGAGACTGCTGGGG - Intronic
906398603 1:45488590-45488612 TTTTACAGTGGAGAGTACTGTGG - Intronic
911189779 1:94936293-94936315 CTGAAGAGGTGAGAGTTCTGGGG + Intergenic
915214537 1:154331054-154331076 CAGGACAGGGAAGAGATCTGGGG - Exonic
915340791 1:155175598-155175620 CTGGCTTGGGGAGAGTTCTGCGG - Exonic
916673173 1:167043292-167043314 CATGACAGAGGAGAGCTCTGTGG - Intergenic
919659028 1:200225207-200225229 CTGGACAGTGTAGAATCCTTTGG - Intergenic
920460137 1:206133288-206133310 GCGGGCAGTGGTGAGTTCTGGGG - Intergenic
921118625 1:212117657-212117679 CTGAACAGTGGAGGTATCTGGGG + Intergenic
921900041 1:220440396-220440418 CTGGAAAGTGGTGGGTTTTGCGG + Intergenic
922358321 1:224797471-224797493 CTGGACACAGGAGAGTTGTGTGG + Intergenic
922471497 1:225879931-225879953 CTGGAAAGGGGAGGGTGCTGTGG + Intronic
1063573945 10:7244173-7244195 CTGGAGGGTGGGGTGTTCTGAGG - Intronic
1064552660 10:16520074-16520096 CTGGGGAGTGGAGAGGCCTGGGG - Intronic
1065455995 10:25907263-25907285 CTGGACTGTATAGTGTTCTGTGG + Intergenic
1066038195 10:31516261-31516283 GTGGACAGTGCAGAGTACAGTGG - Intronic
1067293854 10:44963153-44963175 CTGGACAGTGCAGAGTCTTCTGG + Intronic
1067791096 10:49288333-49288355 CTGGAAAGTGGAGGGTGATGAGG + Intergenic
1067881466 10:50049375-50049397 CTGGGCAGTGGTGAGCTCAGAGG - Intergenic
1069831832 10:71286536-71286558 CTGGACACTGTACAGCTCTGGGG - Intronic
1070331359 10:75419780-75419802 CTCTACAGTGGAGAGATCTAAGG - Intergenic
1071455374 10:85845981-85846003 GTGCACAGGGGAGAGCTCTGAGG + Intronic
1071484067 10:86086175-86086197 GTGGAGGGTGGTGAGTTCTGTGG - Intronic
1074912671 10:117925628-117925650 CTGGATCCTGGAGAGGTCTGGGG - Intergenic
1076109358 10:127849196-127849218 GTGGACCCTGGAGAGTTCTTTGG - Intergenic
1076406199 10:130213935-130213957 CTGGGCCTTGGAGAGCTCTGGGG + Intergenic
1076995453 11:295448-295470 CTGGTCCGTGGAGAGCGCTGGGG - Exonic
1077138288 11:1012468-1012490 CTGTACAGTGGGGAGCCCTGCGG - Intergenic
1077411478 11:2405865-2405887 GTGGGCAGAGGAGCGTTCTGGGG - Intronic
1078321854 11:10342301-10342323 ATTTAGAGTGGAGAGTTCTGTGG - Intronic
1079042248 11:17069602-17069624 TTAGAAAGTGGTGAGTTCTGAGG - Intergenic
1081543467 11:44052793-44052815 CTAGACAATGGACTGTTCTGGGG + Intronic
1081871955 11:46387042-46387064 CTGGACAGAGGCCAGTGCTGGGG + Intergenic
1081959603 11:47125577-47125599 TTGGACAGTGGAAAGCTCAGAGG + Intronic
1083224105 11:61273849-61273871 CTGGGCAGTGGACCGTGCTGGGG - Intronic
1083901394 11:65645224-65645246 CTGGGGACTGGAGAGTTCTTTGG + Intronic
1085777162 11:79377347-79377369 CTGGCTAGTGGATGGTTCTGAGG + Intronic
1089196816 11:116698418-116698440 CTGGAAAGAGGGGACTTCTGAGG - Intergenic
1090468575 11:126957713-126957735 CTGGACAGGAGAGAGCTCTAAGG + Intronic
1091348343 11:134871512-134871534 CTGGAGTGTGGAGAGTTTTCTGG - Intergenic
1092576569 12:9790532-9790554 CTGCACAGTGGAGACCTCTGGGG - Intergenic
1093565696 12:20600477-20600499 GTTGACACTGGAGAGGTCTGAGG - Intronic
1094291622 12:28856970-28856992 TTGGGCATTGGAGAGTTCTCAGG - Intergenic
1098396739 12:70027340-70027362 CTGGTCCATGGAGAGTGCTGGGG + Intergenic
1099299133 12:80869345-80869367 CTGTAGTGTGGGGAGTTCTGTGG + Intronic
1101226134 12:102689874-102689896 CTGGACTGTGGAAAGTTCCCAGG - Intergenic
1101525645 12:105526714-105526736 CTTCACAGTGGAGAAATCTGGGG - Intergenic
1101813860 12:108130290-108130312 CTGGCCAGTGCAGAGTTCCAAGG + Intronic
1103443267 12:120978898-120978920 CTGGACAAGGGGGAGTCCTGCGG + Exonic
1103771886 12:123333312-123333334 TTGGACAGTGGGGTGTTGTGTGG - Intronic
1103953686 12:124565537-124565559 GTGGACAGTGGGGGGATCTGGGG - Intronic
1104013450 12:124947798-124947820 CTGGTCAGTGGACAGTGGTGGGG + Exonic
1106111157 13:26778338-26778360 CTTGTGAGTGAAGAGTTCTGGGG - Intergenic
1106139028 13:26995301-26995323 CTGTTAAGTGGACAGTTCTGTGG + Intergenic
1106483052 13:30150976-30150998 CTGCTCAGGGGAGAGTGCTGTGG - Intergenic
1106916222 13:34517991-34518013 CTCTACAATGGAGAGTTTTGTGG + Intergenic
1108767262 13:53647254-53647276 CTGAGAGGTGGAGAGTTCTGAGG - Intergenic
1110126295 13:71947071-71947093 ATAGACTGTGGGGAGTTCTGTGG - Intergenic
1117645301 14:57845237-57845259 TTGGGCAGTAGACAGTTCTGGGG + Intronic
1118313141 14:64707280-64707302 CTGGCCAGAGGTGAGTTGTGGGG - Intronic
1118327332 14:64790614-64790636 CGGCACAGTGGAGAGTTCACTGG - Intronic
1119620843 14:76130908-76130930 TTGGACACTGGACACTTCTGGGG + Intergenic
1120595753 14:86433197-86433219 CTGGGAAGTCGAGAGTGCTGTGG - Intergenic
1121407919 14:93730124-93730146 CTGGTCAGTGGTGGTTTCTGTGG - Intronic
1122337700 14:101004750-101004772 CTGGACAGTGGGGGAGTCTGAGG - Intergenic
1122608318 14:102963249-102963271 CTGGACAGTCCTGAGTGCTGGGG - Intronic
1122768339 14:104086032-104086054 CTGGACAGAGGAGATTGCGGTGG + Intronic
1124594197 15:31080314-31080336 CTTGACAGTGGAGAATTCTGGGG + Intronic
1124721201 15:32112326-32112348 TTGTGCATTGGAGAGTTCTGTGG + Intronic
1125044879 15:35233738-35233760 CTGGAGTGTGGAGAGTGATGAGG - Intronic
1125491450 15:40151729-40151751 AAGGACAGTGGGGAGTTATGGGG + Intergenic
1125895946 15:43301848-43301870 CTGGACAAGGGAGAGGTCTAGGG + Intronic
1127288527 15:57550877-57550899 CTGGTCAGTGGTGAATGCTGAGG + Intergenic
1127618703 15:60712432-60712454 CTAGACAATAGAGAGTGCTGTGG - Intronic
1132299037 15:100765247-100765269 CAAGGCAGTGGAGAGATCTGGGG - Intergenic
1133382995 16:5346648-5346670 CAGGAGAGTGGAGTGTGCTGTGG + Intergenic
1135135516 16:19883814-19883836 CTGCACGGGGGAGATTTCTGGGG + Intronic
1137835679 16:51590073-51590095 CTGGATGGAGGAGAATTCTGAGG + Intergenic
1138578996 16:57927395-57927417 CCTGAGAGGGGAGAGTTCTGAGG - Intronic
1138640742 16:58384358-58384380 TTTTACAGTGGAGAGATCTGGGG - Intronic
1139527782 16:67527447-67527469 CTGGAGAGTGGAGAACTGTGAGG + Intronic
1141176135 16:81720511-81720533 ATGGGAAGTGGAGAGTTCTGAGG + Intergenic
1141523489 16:84596826-84596848 CAGAGCAGTGGAGAGTTGTGAGG - Intronic
1141649895 16:85387267-85387289 CGGGAAAGTGGGGGGTTCTGGGG - Intergenic
1143982822 17:10884524-10884546 CTGGACAGTGCAGAACTCAGGGG + Intergenic
1144387311 17:14760901-14760923 CTGGACAGTGTCAGGTTCTGGGG - Intergenic
1144996312 17:19271638-19271660 CTGAACAATGCAGATTTCTGAGG - Intronic
1146121411 17:30198861-30198883 CTGGACAGAGGAGACTTCTGCGG + Intronic
1146400120 17:32495153-32495175 CTGGACAGTGGAGGGCCATGTGG + Intronic
1146623456 17:34418428-34418450 ATTGACAGAGGAGAGTGCTGAGG - Intergenic
1146928371 17:36760748-36760770 CTGGACATTGGAAAGGTCAGGGG + Intergenic
1149646241 17:58243681-58243703 CTGGACTGTGGGGATTTCTCTGG - Intronic
1151348855 17:73519728-73519750 CTGGACAGAGGGGAGGTCAGAGG - Intronic
1151383222 17:73739832-73739854 CAGGCCAGTGGATGGTTCTGGGG - Intergenic
1152464542 17:80458365-80458387 CAGGACAGTGGAGCGTCCTTAGG - Intergenic
1152733241 17:81983738-81983760 CGGGACAGTGGGGGGTGCTGGGG + Intronic
1155077398 18:22371758-22371780 CTGGATAGTGGTGAGCTATGGGG + Intergenic
1155491737 18:26406877-26406899 CTGGATAGTGGAGAGTCCTGAGG + Intergenic
1155821768 18:30386782-30386804 CTACACTGTGGAGAGGTCTGTGG + Intergenic
1159987019 18:74854862-74854884 CTGGACAGTGGTCAGCTCTGGGG - Intronic
1160826101 19:1081275-1081297 CTGGAGGGTGAAGAGTCCTGGGG + Intronic
1162288047 19:9755186-9755208 CTGGACAGTGGACTGTACAGTGG - Intronic
1162925196 19:13927389-13927411 CTGGGCAGTAGGGAGGTCTGAGG - Intronic
1162945346 19:14039901-14039923 CTGGACCCTGGTGAGTGCTGGGG + Exonic
1164645291 19:29854886-29854908 CTGGACAGGAAAGAGCTCTGGGG - Intergenic
1164664043 19:30011339-30011361 CTGAAAAGTGAAGTGTTCTGAGG + Intronic
1165560833 19:36678222-36678244 GTGGCCAGTGGAGAGAACTGAGG + Intergenic
1166542566 19:43615069-43615091 CTGGACCATGGGGAGGTCTGGGG + Intronic
1167713590 19:51126537-51126559 ATGGACAGTGGTTGGTTCTGGGG - Intronic
1168315650 19:55483670-55483692 CTGGACCGTGGTTACTTCTGGGG - Exonic
925648604 2:6064500-6064522 CTGCACAGTGAAGATATCTGAGG - Intergenic
925899082 2:8495669-8495691 CTGGGCAGTGAGGAGCTCTGGGG - Intergenic
927583779 2:24280440-24280462 CAGGAGAGTGGAGAGGTTTGAGG - Intronic
928275299 2:29895251-29895273 CTCCACAGTGCAGAGTGCTGGGG - Intronic
928632839 2:33211624-33211646 CTGCACTGTGCAGAGTCCTGGGG - Intronic
928883054 2:36119137-36119159 CTTTACAGTGGAGAAATCTGGGG - Intergenic
929063427 2:37947206-37947228 ATAGACAGTGGAGACTTCTCAGG - Intronic
929329181 2:40659110-40659132 CAGGACCATGGAGAGCTCTGTGG + Intergenic
929552860 2:42905483-42905505 CTGCACAGTGGGGGGTTCTCAGG - Intergenic
929936609 2:46298117-46298139 CTTTGCAGTGGAGACTTCTGCGG + Intronic
931216213 2:60247450-60247472 CTGGGCCGTGGAGTGGTCTGCGG - Intergenic
932213816 2:69953295-69953317 ATGGACAGTGGTCAGTCCTGGGG + Intergenic
932480484 2:72036202-72036224 AAGGACAGAGGAGAGCTCTGTGG + Intergenic
933841251 2:86287785-86287807 CAGGATAGTGGTGAGTTTTGGGG - Intronic
934937110 2:98473399-98473421 GAGGACAGTGGAGAGTGTTGAGG + Intronic
934937120 2:98473459-98473481 GGGGACAGTGGAGAGTGTTGAGG + Intronic
935661312 2:105469054-105469076 CAGGAGAGTGGAGAGGCCTGGGG + Intergenic
937311103 2:120903980-120904002 GTGGGCAGTGCAGAGTTTTGGGG + Intronic
941978630 2:171432020-171432042 CTGGTGAGTGCAGAGTTGTGTGG - Intronic
944315972 2:198286129-198286151 CAGGACAGTGGTTAATTCTGTGG - Intronic
944980481 2:205113500-205113522 AAGAACAGTGGAGATTTCTGGGG + Exonic
946185038 2:217975966-217975988 CTGGAGAGTAGTGAGTGCTGGGG - Intronic
946365699 2:219247699-219247721 CTGCACAGAGAAGAGCTCTGGGG - Exonic
947126356 2:226873097-226873119 CAGGACACTTGAGAGTGCTGTGG + Intronic
948128970 2:235586265-235586287 CTGGTCAGTGGAGAGTGCAGCGG - Intronic
948711664 2:239829112-239829134 CAGCACAGCCGAGAGTTCTGGGG + Intergenic
1169970981 20:11269199-11269221 CTGTGCAGTGAAGACTTCTGAGG - Intergenic
1170411135 20:16093432-16093454 CTGGTCAGTTGAGGATTCTGGGG - Intergenic
1170536664 20:17347328-17347350 CTGGAGAGGAGAGAGGTCTGCGG - Intronic
1171096478 20:22336869-22336891 CTGGACAGTGTGGAGGTTTGGGG + Intergenic
1171186225 20:23126164-23126186 GGGGAGAGTGGAGAGGTCTGGGG - Intergenic
1171825083 20:29891045-29891067 GTGGACATTGGAGAGCTTTGAGG + Intergenic
1173172901 20:40741867-40741889 CTGGAAAGTGGGGAATTCTGGGG + Intergenic
1174077173 20:47945981-47946003 GTGGTCAGGGGAGGGTTCTGAGG + Intergenic
1175275817 20:57770027-57770049 CTGGAGAGTGGAGAGAGCAGGGG - Intergenic
1178087957 21:29131625-29131647 ATGGACAGTGGAGAGCTTTTTGG + Intronic
1180905511 22:19408183-19408205 CTGGACACAGTAGGGTTCTGGGG - Intronic
1181169644 22:21000939-21000961 CTGGACTGTGAGGAGTCCTGCGG - Intronic
1181872557 22:25911501-25911523 CTGGAGAGTGGAGCCTTATGGGG + Intronic
1182076401 22:27498328-27498350 CTGGACAGATGAGAATCCTGAGG + Intergenic
1182599182 22:31446662-31446684 CTGGACAGTGGAGAGTTCTGAGG + Intronic
1182694515 22:32187715-32187737 CATGACAGTGCAGAGATCTGAGG + Intergenic
1183231357 22:36584112-36584134 TTGGAGAGTGGAGAGTGATGGGG - Intronic
1183411240 22:37655900-37655922 CCGGAGAGTGGAGAGTCCGGTGG - Exonic
1183542980 22:38440622-38440644 CTGGACAGTGCAGACTTCAAAGG - Intronic
1184998663 22:48228378-48228400 CTGGGCTGTGGGGAGGTCTGAGG + Intergenic
1185061418 22:48608951-48608973 CTGGACATTGGACATTCCTGAGG + Intronic
949716353 3:6936047-6936069 CTGGACACTGGAGAGGCCTCTGG - Intronic
949719530 3:6972683-6972705 CAGGCCAATGGAGAGCTCTGCGG + Intronic
950180582 3:10910330-10910352 CTGGAAAGGAAAGAGTTCTGGGG + Intronic
950258322 3:11524136-11524158 CAGAACAGTGGAGAGATTTGGGG - Intronic
950646332 3:14379118-14379140 CTTTAGAGTGGAGAGATCTGGGG + Intergenic
950661566 3:14469853-14469875 AGGGACAGTGGAGAGGTGTGTGG - Intronic
950909712 3:16576355-16576377 CTTTGCAGTGGTGAGTTCTGTGG - Intergenic
952740442 3:36729121-36729143 CTGGTCAGCCGAGAGTCCTGAGG - Intronic
954089925 3:48276184-48276206 CTGGAAAATTGTGAGTTCTGAGG - Intronic
955074532 3:55601125-55601147 CTGGACAAAGGAGATTGCTGGGG + Intronic
955222008 3:57030744-57030766 CTGGAGAGTGCAGTTTTCTGTGG - Intronic
956198246 3:66675460-66675482 CTGGAAAGTGGAGAGAGCTTGGG - Intergenic
960653064 3:119973005-119973027 TTGGAAAGTGTAGAATTCTGAGG - Intronic
961261518 3:125605936-125605958 AGGGACAGTTGAGAGTTCTTGGG + Intergenic
961785720 3:129345411-129345433 CTGGCCCAGGGAGAGTTCTGGGG - Intergenic
961889582 3:130119563-130119585 CTGGACAGTGGAGATGCTTGTGG + Intergenic
962373362 3:134839696-134839718 CAGGACAGTGGTGAGTAATGGGG + Intronic
964348150 3:155775586-155775608 ATGGACAATGGAGAGTTATTAGG + Intronic
964425044 3:156543707-156543729 CTGAAAATTGTAGAGTTCTGAGG - Intronic
968811432 4:2801230-2801252 CTGAACAGTGGAGCGTTGTGAGG + Intronic
968949361 4:3682560-3682582 TTGGACTGCAGAGAGTTCTGCGG + Intergenic
969034901 4:4245208-4245230 CTGCACATTGGAGAGTGATGTGG - Intronic
969224729 4:5788050-5788072 CTGAACACTGGAGAGCCCTGGGG + Intronic
969976407 4:11107049-11107071 CTGGAGAGTGGAGGGGCCTGAGG - Intergenic
970259135 4:14205573-14205595 CTGGACATTTGATAGTTATGAGG + Intergenic
970317365 4:14842123-14842145 ATGCAGAGTGCAGAGTTCTGAGG + Intergenic
970580158 4:17467658-17467680 CTGTACAGAGGAGAGTGCTAGGG - Intronic
971928314 4:33044163-33044185 CTGGACACTGGAGAGTACACAGG - Intergenic
973118890 4:46492980-46493002 ATGGATAGTGGAGGCTTCTGAGG - Intergenic
975297313 4:72749507-72749529 CTGGACACTGGAGACTACTGTGG + Intergenic
975979011 4:80134261-80134283 CTGGAGTGAGGAGAGTTCTGGGG + Intergenic
976569552 4:86593239-86593261 CTCCAAAGTGGAGAGATCTGAGG - Intronic
976755271 4:88491246-88491268 CTGGTAAGAGGAGATTTCTGGGG + Intronic
978901204 4:113951451-113951473 CTGGACAGTGTAAAGTTCAATGG + Intronic
980099643 4:128528903-128528925 CTGTACTGTCGGGAGTTCTGAGG - Intergenic
980596722 4:134964363-134964385 AGGGACAGTGGAGACATCTGAGG + Intergenic
980766171 4:137307741-137307763 CTGAAAAGTGGAGAGCTCTACGG + Intergenic
982221741 4:153130451-153130473 CAGCACAATGGAGCGTTCTGGGG - Intergenic
984710347 4:182879373-182879395 CTGGACAATGGAGAGCTTTTTGG + Intergenic
985140959 4:186840462-186840484 ATGGAAAGTGGAGAGGACTGGGG - Intergenic
986141413 5:5033949-5033971 CTAGACAGTTGAGATTTCTGTGG - Intergenic
987088129 5:14487994-14488016 CTGGAGAGCGGCGAGTTCAGCGG - Exonic
990807846 5:59686701-59686723 CTGTACAGTAGAGTGCTCTGTGG - Intronic
991129322 5:63104099-63104121 CTGGCCAGTGGTGAGTGCTTCGG - Intergenic
993455038 5:88118126-88118148 CATGACAGTGGTGAGTTCTCAGG - Intergenic
997714329 5:136030527-136030549 CTGGAAAGAGGAGAATACTGGGG + Intronic
999751250 5:154629644-154629666 CTGGCCAGGGGAGACTTCTCAGG - Intergenic
1002049319 5:176561020-176561042 CTGGCCAGGGCAGAGTTCTCCGG + Intronic
1002076427 5:176711351-176711373 CTGGGCAGTGGGGAGCCCTGGGG + Intergenic
1002187276 5:177460208-177460230 CTGAACAGTGGGGAGTGCTAGGG - Intronic
1002331303 5:178442807-178442829 CTGGGCTCTGGAGAGTTCTAAGG - Intronic
1002836502 6:869293-869315 AGGGACAGAGGAGAGGTCTGCGG + Intergenic
1004286044 6:14322000-14322022 CTGACCAGAGGAGAGATCTGAGG + Intergenic
1006947329 6:37793431-37793453 TTGGAGATAGGAGAGTTCTGAGG - Intergenic
1006995684 6:38257791-38257813 CAGAACAGTGGTTAGTTCTGGGG + Intronic
1007702741 6:43774052-43774074 CTCGACAGTGAAGCATTCTGGGG + Intronic
1009616293 6:66011543-66011565 CTGGACATTTAAGAGTTCTCTGG + Intergenic
1010345583 6:74806395-74806417 CTGGATGGTGTAGAGTCCTGTGG - Intergenic
1013293912 6:108742012-108742034 CAGGACACTGGAGTGTCCTGGGG - Intergenic
1017978602 6:159378839-159378861 CAGCACTGTAGAGAGTTCTGGGG - Intergenic
1018520614 6:164646344-164646366 ATGGACAGTGGACAGAGCTGTGG - Intergenic
1019121212 6:169805806-169805828 CTGTGGTGTGGAGAGTTCTGTGG - Intergenic
1019358686 7:594112-594134 CAGGACTGGGGAGAGTCCTGGGG - Intronic
1019802783 7:3100574-3100596 CTAGACCGTGGAGAGTGATGGGG + Intergenic
1020281005 7:6649942-6649964 CTGGGCAGCTGAGACTTCTGTGG + Intronic
1021597308 7:22331017-22331039 GTGGACAGTGGAGGGCTGTGGGG - Intronic
1022041540 7:26586512-26586534 CTAAACAGTGTAGAGTTCTGGGG + Intergenic
1022390940 7:29943944-29943966 GTGGATGATGGAGAGTTCTGAGG - Intronic
1022510086 7:30929521-30929543 CTGGATTGTGGGGAGGTCTGGGG - Intergenic
1022942894 7:35256629-35256651 GCGGAGAGTGGGGAGTTCTGAGG + Intergenic
1023833898 7:44057447-44057469 CTAGACATTGGGCAGTTCTGAGG - Intronic
1024173836 7:46818107-46818129 CTGGAGAGAGGGTAGTTCTGGGG + Intergenic
1024724013 7:52171569-52171591 CTTTACAGTGGAGAATCCTGAGG + Intergenic
1024909883 7:54435273-54435295 CCTCACAGTGGAGAGTTATGTGG - Intergenic
1025312601 7:57967323-57967345 GTGGACATTGGAGTGCTCTGCGG - Intergenic
1026847049 7:73704240-73704262 CTGGACAGCGTGGAGTGCTGGGG + Exonic
1030514756 7:110525744-110525766 CTGGGAAGTGGAGACTTCAGTGG - Intergenic
1030533920 7:110743186-110743208 TTGGGCAGTGGAGAGCTATGTGG + Intronic
1032973743 7:137196724-137196746 CAACACAGTGGTGAGTTCTGTGG - Intergenic
1033548116 7:142420944-142420966 ATGGACAGTGGAGGGTGCTGAGG + Intergenic
1035657072 8:1318382-1318404 ATGGACAGTGGGGAGCCCTGTGG - Intergenic
1036377164 8:8210475-8210497 CTGGACAGTGGAGATGCTTGTGG - Intergenic
1036460695 8:8950017-8950039 CGGGACAGTGGAAAGTCATGAGG - Intergenic
1036852382 8:12212674-12212696 CTGGACAGTGGAGATGCTTGTGG + Intergenic
1036873750 8:12455197-12455219 CTGGACAGTGGAGATGCTTGTGG + Intergenic
1038181513 8:25233094-25233116 CAGGAGAGTGGAGAATTCAGGGG - Intronic
1039296748 8:36164507-36164529 CTGGAAGGTGGAGATTTCAGTGG + Intergenic
1039758070 8:40544105-40544127 CTGGCCAGGGCAGAGTTGTGAGG - Intronic
1041340816 8:56843816-56843838 CTGGACAGAGGAGAGAGCAGAGG - Intergenic
1041380676 8:57251523-57251545 CTAGAAAATGCAGAGTTCTGTGG - Intergenic
1043549823 8:81358198-81358220 CTAGACAGTCCAGAGATCTGTGG - Intergenic
1048452562 8:134546668-134546690 ATGTACAGTGGAGAGGTCTGTGG + Intronic
1048712127 8:137224299-137224321 GTGGACAGTGGAGTGTGCTTAGG + Intergenic
1048794520 8:138137741-138137763 CTGCAGAGAGGTGAGTTCTGAGG - Intronic
1049986339 9:955133-955155 CTGGAGAAAGGAGAGTACTGTGG + Intronic
1050976043 9:11939887-11939909 CAGCACAGTGGTGAGTTCTCTGG + Intergenic
1052959711 9:34285046-34285068 GTGGACAGTGGATAGCTCAGTGG + Intronic
1053180772 9:35967573-35967595 CAGCATAGTGGAGAGTTCTTAGG - Intergenic
1055203525 9:73697273-73697295 CTGAACATTGGCCAGTTCTGTGG + Intergenic
1055305386 9:74924029-74924051 CTGGCCTGTGGTGAGTCCTGAGG + Intergenic
1059280160 9:113126081-113126103 CTGGACAGTGAAGATCTCTGAGG + Intergenic
1060299442 9:122366317-122366339 CTGTCTAGTGGAGAGGTCTGCGG + Intergenic
1060374870 9:123108796-123108818 CAGGTAAGTGGAGAGTTGTGTGG - Intergenic
1060602852 9:124889590-124889612 CGGGGAAGTGGAGATTTCTGTGG - Intronic
1060607739 9:124932397-124932419 CAGGACAGTGGACAGTTAAGAGG + Intronic
1061370455 9:130194700-130194722 CCAGACAGGGGAAAGTTCTGGGG - Intronic
1203356988 Un_KI270442v1:162015-162037 GTGGACATTGGAGAGCTTTGAGG - Intergenic
1189329891 X:40137729-40137751 CCAGACAGTGGAGGTTTCTGGGG + Intronic
1190516105 X:51225118-51225140 AGGGACAGTGGAGGGTTCAGTGG - Intergenic
1192397785 X:70800627-70800649 CTGAACAGTGGTGATTTCTTAGG + Intronic
1192409898 X:70924836-70924858 CAGGGCAGTGCAGAGTGCTGTGG - Intergenic
1192539087 X:71953098-71953120 CTAGACAGTGGAGAGTTAGATGG - Intergenic
1193300598 X:79884090-79884112 ATATACAGTGGAAAGTTCTGTGG - Intergenic
1193741295 X:85220450-85220472 CTGTACAGCGGAGAGTTTAGGGG - Intergenic
1195431288 X:104792331-104792353 CTAGACAGTGAAGCGATCTGGGG - Intronic
1200753605 Y:6969317-6969339 CTGGGCAGTGCTGAGCTCTGAGG + Intronic
1200911410 Y:8534572-8534594 CTTGGCAGAGGAGACTTCTGTGG + Intergenic
1200957838 Y:8969826-8969848 CTGGCCAGTCCAGAGTTCAGGGG + Intergenic