ID: 1182604947

View in Genome Browser
Species Human (GRCh38)
Location 22:31496108-31496130
Sequence GCGTGGGCCTCTCTGGCTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 253}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182604947_1182604952 -5 Left 1182604947 22:31496108-31496130 CCAAAAGCCAGAGAGGCCCACGC 0: 1
1: 0
2: 1
3: 15
4: 253
Right 1182604952 22:31496126-31496148 CACGCACGAGTCCGGAAGTGAGG 0: 1
1: 0
2: 0
3: 1
4: 23
1182604947_1182604955 0 Left 1182604947 22:31496108-31496130 CCAAAAGCCAGAGAGGCCCACGC 0: 1
1: 0
2: 1
3: 15
4: 253
Right 1182604955 22:31496131-31496153 ACGAGTCCGGAAGTGAGGGAGGG 0: 1
1: 0
2: 0
3: 10
4: 116
1182604947_1182604956 3 Left 1182604947 22:31496108-31496130 CCAAAAGCCAGAGAGGCCCACGC 0: 1
1: 0
2: 1
3: 15
4: 253
Right 1182604956 22:31496134-31496156 AGTCCGGAAGTGAGGGAGGGAGG 0: 1
1: 0
2: 1
3: 132
4: 3997
1182604947_1182604954 -1 Left 1182604947 22:31496108-31496130 CCAAAAGCCAGAGAGGCCCACGC 0: 1
1: 0
2: 1
3: 15
4: 253
Right 1182604954 22:31496130-31496152 CACGAGTCCGGAAGTGAGGGAGG 0: 1
1: 0
2: 1
3: 5
4: 78
1182604947_1182604953 -4 Left 1182604947 22:31496108-31496130 CCAAAAGCCAGAGAGGCCCACGC 0: 1
1: 0
2: 1
3: 15
4: 253
Right 1182604953 22:31496127-31496149 ACGCACGAGTCCGGAAGTGAGGG 0: 1
1: 0
2: 0
3: 0
4: 24

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182604947 Original CRISPR GCGTGGGCCTCTCTGGCTTT TGG (reversed) Intronic
900098974 1:952914-952936 GGGAGGGCCTCTCTGGCTGGAGG - Intronic
900623077 1:3596320-3596342 GCTGGGGTCTCTCTGGCTGTGGG - Intronic
900660074 1:3777797-3777819 GCGTGGGCATCACTGGCATGCGG - Intergenic
900906591 1:5563920-5563942 GGGTGGGTCTCTTGGGCTTTGGG + Intergenic
902179676 1:14678385-14678407 GCGAGGGGCTCTCGGGCCTTTGG + Intronic
903130156 1:21273922-21273944 GCGTAGGCCACCCAGGCTTTGGG - Intronic
904432610 1:30474522-30474544 TAGTGGGCTTCTCTGGATTTTGG + Intergenic
905240615 1:36578661-36578683 GCGTGGGCCTCTGTGGAGCTGGG - Intergenic
905809530 1:40901985-40902007 CACTGGTCCTCTCTGGCTTTGGG + Intergenic
906054983 1:42908743-42908765 TCGTGGGCCTCTTTGAATTTTGG - Intergenic
907515498 1:54990984-54991006 GTGTGGGCTGCTCTTGCTTTGGG - Intronic
909656026 1:78033644-78033666 GCCTGGGGTTCTGTGGCTTTGGG + Intronic
912212205 1:107568603-107568625 TAGTGGGCCTATTTGGCTTTTGG + Intergenic
913201124 1:116495932-116495954 GCCGGGGCCTCTCAGACTTTGGG + Intergenic
915403536 1:155641877-155641899 GGGTTTGCCTCTCTGACTTTGGG + Intergenic
916369796 1:164079513-164079535 CAGTGGGCCTCTTTGGATTTGGG + Intergenic
920971486 1:210746950-210746972 GCACAGCCCTCTCTGGCTTTGGG + Intronic
922620855 1:226987251-226987273 GCCTGGGCCTCGCAGGCTTAAGG - Exonic
923946978 1:238899077-238899099 GCCTGGGGCTTTCTGGCCTTTGG - Intergenic
1063250638 10:4270055-4270077 GCTTGGGCCACCCTAGCTTTAGG + Intergenic
1063383860 10:5603749-5603771 ACATTGGTCTCTCTGGCTTTGGG + Intergenic
1063460336 10:6211560-6211582 GGGTGTGCCTCACTGGCTTTCGG + Intronic
1063462001 10:6220883-6220905 GCATGGGCCGTTCTGGCTGTAGG + Intronic
1064177864 10:13090951-13090973 GCTGGGGGCTCTCAGGCTTTTGG - Intronic
1068120537 10:52779155-52779177 GGGTGGGCCTTGCCGGCTTTGGG + Intergenic
1068700052 10:60009987-60010009 GCTTGGGTCTCTCTGGCTTATGG - Intergenic
1069145675 10:64889864-64889886 TCGTGGGCCTATTTGGATTTTGG + Intergenic
1069731506 10:70618435-70618457 GCGTGGGGCTGTGGGGCTTTCGG - Intergenic
1070047367 10:72851867-72851889 GCTTGGGCCTAGCTAGCTTTGGG - Intronic
1071281277 10:84106297-84106319 GCCAGGGGCTCTCTGGCCTTTGG - Intergenic
1071364513 10:84884819-84884841 TAGTGGGCCTATCTGGATTTTGG - Intergenic
1071719696 10:88131062-88131084 GCCTGGGACTCTCTGGCTTTAGG - Intergenic
1072694880 10:97595759-97595781 GCCTGGGCTTCTCTGACTTCAGG + Intronic
1075455481 10:122582214-122582236 GCATGGGCCTCTCTGCCTTCTGG - Intronic
1075457088 10:122591903-122591925 ACGTGGTCCTCTCTGGCTTCTGG - Intronic
1075457604 10:122594917-122594939 GCATGGGCCTCTCTGCCTTCTGG - Intronic
1075458677 10:122601411-122601433 GCATGGTCCTCTCTGCCTTCTGG - Intronic
1075459308 10:122605470-122605492 GCATGGTCCTCTCTGCCTTCTGG - Intronic
1075459940 10:122609529-122609551 GCATGGTCCTCTCTGCCTTCTGG - Intronic
1075460572 10:122613588-122613610 GCATGGTCCTCTCTGCCTTCTGG - Intronic
1076001078 10:126913490-126913512 GCGTGGCCCTCCGTGGCCTTGGG + Intronic
1076727339 10:132419755-132419777 TCCTGGGCCTCTCTTGCTCTGGG + Intergenic
1076905179 10:133357790-133357812 GCTCGGGCCTCCCTGGCTTCCGG - Intronic
1078089548 11:8256182-8256204 GCTTTGGCCTCTCAGTCTTTAGG - Intronic
1078392727 11:10950795-10950817 ATGTGGGCCTGTCTTGCTTTGGG + Intergenic
1079343447 11:19631930-19631952 GCGTGGGTCTCTCTTGCTGATGG - Intronic
1079447000 11:20566648-20566670 GCCAGGGCCTCTCAGGCCTTTGG + Intergenic
1080662086 11:34304823-34304845 GCCAGGGCCTCTGTGGCTTTTGG - Intronic
1083227007 11:61291537-61291559 ACGTCTGCCTCTCTGGGTTTGGG - Exonic
1083847674 11:65345467-65345489 CCGTGGGGCTCTCTAGCTTCTGG - Intronic
1089182779 11:116594526-116594548 GCTTGGGAATTTCTGGCTTTAGG - Intergenic
1089182885 11:116595091-116595113 GCTTGGGAATTTCTGGCTTTAGG - Intergenic
1089699761 11:120237530-120237552 ATATGGGCCTCTCTGACTTTTGG + Intronic
1090035498 11:123246265-123246287 TTGGGGGCCCCTCTGGCTTTGGG + Intergenic
1090465479 11:126929590-126929612 TCAGGGGCCTCTCTGGCTTGAGG - Intronic
1095466207 12:42490386-42490408 GCCTGGGCCTGGCTGCCTTTGGG - Intronic
1096457113 12:51796750-51796772 GCCAGGGGCTCTCTGGCCTTTGG - Intronic
1096490615 12:52010802-52010824 GCTTGGGCCTCCCTGGATATTGG - Intronic
1097267093 12:57752302-57752324 GAGGGGGCCTCTCTAGCTTGCGG - Exonic
1099379422 12:81936832-81936854 TCGTGGGCCTATTTGGATTTAGG - Intergenic
1100265011 12:92967279-92967301 GCCAGGGGCTCTCAGGCTTTCGG + Intergenic
1101713856 12:107293353-107293375 GCCAGGGGCTCTCAGGCTTTTGG + Intergenic
1101813876 12:108130403-108130425 GCCTGGGCAGCTCTGGCTGTTGG - Intronic
1102220640 12:111192044-111192066 GCGTGGGCCTCTATTGCTGGTGG - Intronic
1102717871 12:114989819-114989841 GCCAGGGCCTCTCAGGCCTTTGG - Intergenic
1103440712 12:120960771-120960793 GAGTGGGCGCCTCTGGCCTTTGG + Intergenic
1103704092 12:122862128-122862150 GCGTGGGGCTCCCTGCCTTCTGG + Exonic
1104496702 12:129247374-129247396 ACTTGTCCCTCTCTGGCTTTAGG + Intronic
1104761213 12:131298621-131298643 GCGGGGGCCTCTCCAGCTCTGGG + Intergenic
1104818562 12:131662171-131662193 GCGGGGGCCTCTCCAGCTCTGGG - Intergenic
1104922208 12:132296339-132296361 GCGTGGGCATCTCCTGCTCTTGG - Intronic
1108590715 13:51910787-51910809 GCGTGGGCCTGTCAGGCCTGTGG - Intergenic
1110168271 13:72469642-72469664 GCCTGGGACTCTCAGGCCTTCGG + Intergenic
1110443148 13:75547848-75547870 TACTGGGCCTCTTTGGCTTTTGG + Intronic
1112105589 13:96236012-96236034 GCCAGGGACTCTCTGGCCTTTGG - Intronic
1112565104 13:100545748-100545770 GTGTGGGGCTTTCTGGCATTAGG + Intronic
1113714430 13:112493108-112493130 GCCTGAGACACTCTGGCTTTGGG + Intronic
1113719870 13:112547094-112547116 GCTTTGGCCTCTCTGGCTCTAGG - Intronic
1115040215 14:28915340-28915362 GCCAGGGCCTCTCGGGCGTTTGG - Intergenic
1116530889 14:45972127-45972149 TAGTAGGCCTCTTTGGCTTTTGG + Intergenic
1117222079 14:53616511-53616533 GCCAAGGGCTCTCTGGCTTTTGG - Intergenic
1118047837 14:61991527-61991549 TGCTGGGCCTCTTTGGCTTTAGG + Intergenic
1123184610 14:106504935-106504957 GCCAGGGGCTCTCTGGCCTTTGG + Intergenic
1123931006 15:25171651-25171673 CCCTGGGACTCGCTGGCTTTGGG + Intergenic
1124962585 15:34409797-34409819 GCGTGGGGCTCTCTGGCCGCAGG - Intronic
1124979210 15:34556019-34556041 GCGTGGGGCTCTCTGGCCGCAGG - Intronic
1125162324 15:36660041-36660063 GCATGGGCCTGGCTGGCCTTTGG + Intronic
1128240882 15:66100235-66100257 GCCTGGCCCTCTCTGTATTTTGG - Intronic
1131459533 15:92608640-92608662 ACGTGGGCCTTCCTGGCCTTGGG + Intergenic
1132305779 15:100811192-100811214 TAGTGCGCCTCTCTGGATTTTGG - Intergenic
1132591760 16:729167-729189 GAGTGAGCATCTCTGGCTTGGGG + Intronic
1132888021 16:2190979-2191001 GCGTGGGCCCCTCTGGCCTCAGG - Intronic
1133983515 16:10650992-10651014 CCGTCTGCCTCTCTGGCATTGGG - Intronic
1134440799 16:14298626-14298648 GGGTGGGCCTCTGGGGCTTCCGG + Intergenic
1136417551 16:30113080-30113102 GAGTGGGCCTCTGGGGCTTGGGG + Intronic
1137543403 16:49380120-49380142 GCCAGGGGCTCTCGGGCTTTTGG + Intronic
1137785589 16:51134936-51134958 CCGCCGCCCTCTCTGGCTTTGGG + Intergenic
1139101890 16:63777625-63777647 GTGTGGGCCACTCTGGAATTGGG + Intergenic
1141618128 16:85221713-85221735 AAGTGGGCCTCTCTGGCTCTGGG - Intergenic
1142171521 16:88625054-88625076 GCCTGGGCCTGTCTTCCTTTAGG - Intronic
1142690176 17:1601420-1601442 CCGTGTGCCTCTCTGGCTGTGGG - Intronic
1142743507 17:1943470-1943492 CCGTGGGGCTCTCTGGGTCTTGG + Intronic
1143353515 17:6307237-6307259 CTGTGGGCTTCTCTGGTTTTTGG + Intergenic
1143788345 17:9273502-9273524 GCGTGGTCCTCGCTGGCAGTGGG - Intronic
1144833106 17:18142679-18142701 GCAAGGGCCTCTCTACCTTTTGG + Intronic
1147186587 17:38716520-38716542 AGGTGGTCTTCTCTGGCTTTGGG + Exonic
1147557671 17:41489685-41489707 GGTCGGGCCTCTCTGGCCTTGGG - Exonic
1150463783 17:65374601-65374623 ACTTGGGCCTCTGTGGATTTGGG + Intergenic
1150493841 17:65592565-65592587 GGGAGGCCCCCTCTGGCTTTGGG + Intronic
1151759182 17:76090940-76090962 GCCTGGTCCTCTCTGGCTGATGG - Intronic
1151827343 17:76530679-76530701 GCCTGGGCAGCTGTGGCTTTGGG + Intronic
1152363720 17:79843806-79843828 GAGTGGGCCCCGCTGGGTTTGGG - Intergenic
1152647328 17:81475488-81475510 GCGTGGGCCTCTGGGCCTCTGGG - Intergenic
1153104121 18:1508126-1508148 GCCAGGGCCTCTTGGGCTTTTGG + Intergenic
1153414476 18:4831486-4831508 ACGTGGGGCTATCTGGCTCTTGG - Intergenic
1154254423 18:12770164-12770186 GAGTGGGCCTCACTGGATCTTGG + Intergenic
1154367004 18:13720431-13720453 TAGTGGGCCTCTTTGGATTTTGG - Intronic
1154405506 18:14086404-14086426 GCGCTGGCCTCAGTGGCTTTGGG + Intronic
1157256843 18:46147082-46147104 GCTTGGGCTTCTCGGCCTTTGGG + Intergenic
1157312248 18:46561103-46561125 GCTTGGGCCTCTGTGGGTGTGGG - Intronic
1159301754 18:66581674-66581696 CTGGGGGCCTCTCAGGCTTTTGG + Intronic
1159968782 18:74623354-74623376 GCGTGTGCGTCTGTGACTTTGGG + Intronic
1160027577 18:75231126-75231148 GCGTGGGCCTGACAGGCTCTGGG + Intronic
1164040780 19:21490899-21490921 GCCTGGGCCTCTCATGTTTTGGG + Intronic
1165269285 19:34691128-34691150 GGGTATTCCTCTCTGGCTTTAGG + Intergenic
1167489975 19:49786905-49786927 GGGTGGGGCTGTCTGGCTCTAGG + Intronic
1167693058 19:50999115-50999137 GCGAGGGGCTCTCTGGATTCTGG + Intronic
926577781 2:14601231-14601253 GCCAGGGGCTCTCTGGCCTTCGG + Intergenic
928299514 2:30112945-30112967 GCCTGGGGCTCTCAGGCCTTCGG + Intergenic
929434191 2:41914836-41914858 GTGTGGGCCTCTGTGTCTCTTGG + Intergenic
930758402 2:55003874-55003896 ACGTGGGCATCTGTGGATTTTGG + Intronic
934258344 2:91445900-91445922 GCCTGGGCCTTTGTGGCATTGGG - Intergenic
935216086 2:100976310-100976332 GCATGGGCCTCTCAAGCCTTAGG + Intronic
935950171 2:108321755-108321777 GCGTGGGTCTCCCTGGGTCTGGG + Intergenic
936749701 2:115627371-115627393 GTGTGGGCCTCTGTGGCATGGGG - Intronic
937254432 2:120545149-120545171 GAGTGGGCCTTTCTGCCTATGGG + Intergenic
938096477 2:128467335-128467357 GCTTGGCCCTCTCTGGACTTTGG - Intergenic
939227392 2:139381109-139381131 TCGTGTGCCTGTCTTGCTTTGGG + Intergenic
939959786 2:148556312-148556334 GCATGGGACTCTCTGGCTGGTGG + Intergenic
941034838 2:160557029-160557051 CTCTGGGCCTCTCTGGATTTGGG - Intergenic
943129298 2:183837507-183837529 CCTTGGCCCTCTCTGGATTTTGG + Intergenic
944648419 2:201803955-201803977 GCCTGAGCCTCTCTGGCTCTTGG + Intronic
945117117 2:206418806-206418828 GAGTGGTCCTCTGTGGCTCTTGG + Intergenic
945243363 2:207696953-207696975 GCCAGGGGCTCTCGGGCTTTCGG - Intergenic
946306731 2:218860491-218860513 GTGTGGCCCTCTCTGCCTTGTGG - Intronic
946790488 2:223296248-223296270 GCCTGGGGCTCTCGGGCCTTCGG + Intergenic
947145172 2:227057540-227057562 GCATGTCCCTCTCTGCCTTTGGG + Exonic
947614599 2:231547380-231547402 GCGTGAGCCTCTGTGGCTGCCGG + Intergenic
948885937 2:240884696-240884718 GTGTGGGCCTCATTGGATTTTGG - Intergenic
1169725250 20:8721828-8721850 GCAAGGTCCTCTCTGGCCTTGGG + Intronic
1171409864 20:24938947-24938969 TAGTGGGCCTCTTTGGATTTGGG - Intergenic
1171436066 20:25125628-25125650 TCGTGGGTCTCTTTGGATTTAGG + Intergenic
1172346989 20:34209690-34209712 CCTTGGGCCCCTCTGGATTTGGG + Intronic
1174388846 20:50204737-50204759 GCCTTGGTCTGTCTGGCTTTCGG + Intergenic
1174527591 20:51186044-51186066 GCCTGGGCCTCTCAGTCTTCTGG - Intergenic
1176722009 21:10401006-10401028 ACGTTGGCCTCTCAGGCTCTGGG + Intergenic
1177395937 21:20536367-20536389 GCCAGGGCCTCTCAGGCGTTGGG - Intergenic
1178063334 21:28875668-28875690 TAGTGGGCCTCTTTGGGTTTTGG - Exonic
1178511138 21:33206069-33206091 GCTTGGGCATCTGTGGATTTTGG - Intergenic
1178540573 21:33446108-33446130 GTGTGGGCATGGCTGGCTTTGGG - Intronic
1179656760 21:42850612-42850634 CAGGGGGCCTCTCTGGCTGTTGG - Intronic
1179719365 21:43306602-43306624 GCTTGGGGCTCCCTGGCTTGTGG - Intergenic
1180955108 22:19737988-19738010 GCCTCGGCCCCTCTGGCCTTAGG - Intergenic
1182604947 22:31496108-31496130 GCGTGGGCCTCTCTGGCTTTTGG - Intronic
1183878812 22:40808381-40808403 GCCTCTGCCACTCTGGCTTTGGG - Intronic
1185131180 22:49039838-49039860 GCGTGGGCCACATTTGCTTTGGG + Intergenic
1185315751 22:50178454-50178476 CCGTGGGCCGCTGTGGCTGTGGG - Intronic
950493121 3:13318194-13318216 GCGTGCTCCTCCCTGGGTTTTGG - Intronic
952920774 3:38282470-38282492 GCCTGGGCCTGTTTGGCTGTGGG + Intronic
953662037 3:44898530-44898552 GAGTGGTCCTCACTGGCATTGGG - Intronic
954657915 3:52208356-52208378 GCCTGGGCCACTCTTTCTTTTGG + Intronic
956467750 3:69536026-69536048 GCGTGGCCTTGTCTGGCTTAGGG + Intronic
956881074 3:73511285-73511307 GCTTGGGCCTTTCTGTTTTTGGG - Intronic
957247627 3:77734208-77734230 TAGTGGGCCTCTTTGGATTTTGG - Intergenic
958586919 3:96098993-96099015 GCTTGGGGCTCTCGGGCCTTTGG + Intergenic
959123317 3:102258991-102259013 TCGTGGACCTCTGTGGCATTCGG + Intronic
961381508 3:126498940-126498962 TCGTGGGCCTCTCTGGCCATGGG - Intronic
961473671 3:127134168-127134190 GGGGGGGCCTCTGTGCCTTTTGG + Intergenic
961770890 3:129249345-129249367 GCGTGAGTCTTTGTGGCTTTCGG - Intergenic
963349379 3:144134141-144134163 CCTTGGGCCTCTCTGGCTGCAGG - Intergenic
965266502 3:166550391-166550413 GCCAGGAACTCTCTGGCTTTTGG + Intergenic
965893198 3:173540416-173540438 TAGTGGGCCTCTTTGGATTTTGG - Intronic
966287227 3:178312127-178312149 GCCAGGGCCTCTCAGGCCTTTGG + Intergenic
966445643 3:179998237-179998259 TAGTGGGCCTATCTGGATTTTGG + Intronic
968945571 4:3661830-3661852 GCGTGTTCCTCTCGGGCTTGAGG + Intergenic
969148578 4:5146328-5146350 GCCAGGGGCTCTCAGGCTTTCGG - Intronic
971078852 4:23183736-23183758 GCTGGGGGCTCTCAGGCTTTTGG - Intergenic
972877969 4:43388482-43388504 GCAGGGGACTCTCTGGCTCTGGG + Intergenic
973143645 4:46798287-46798309 TGGTAGGCCTCTCTGGATTTGGG + Intronic
974396309 4:61339823-61339845 TCTTGGGTCTCTCTGTCTTTGGG + Intronic
979595352 4:122528489-122528511 AAGTGGGCCTCTTTGGATTTTGG + Intergenic
981220359 4:142225280-142225302 GCCAGGGGCTCTCTGGCCTTTGG + Intronic
982088207 4:151857735-151857757 GTGTGGCCCTCTCTGGGCTTGGG + Intergenic
982550410 4:156791039-156791061 GGCTGCGGCTCTCTGGCTTTGGG + Intronic
983228415 4:165106703-165106725 GCCTGGGGCTCTCAGGCCTTCGG + Intronic
985212796 4:187613251-187613273 GGAAGGGCCTCTGTGGCTTTGGG + Intergenic
985552459 5:540574-540596 GGGATGGCCTCTCTGGATTTTGG + Intergenic
987475635 5:18389136-18389158 GCATGTTCCTCTCTGCCTTTAGG - Intergenic
987696931 5:21344353-21344375 GCTTTGGCCATTCTGGCTTTTGG + Intergenic
987987094 5:25161705-25161727 GACTTGGCCTCTTTGGCTTTGGG - Intergenic
988218937 5:28316524-28316546 CTGTGGGCCTCTCTAGATTTGGG - Intergenic
988755273 5:34242188-34242210 GCTTTGGCCATTCTGGCTTTTGG - Intergenic
991743509 5:69707916-69707938 GCTTTGGCCATTCTGGCTTTTGG - Intergenic
991754200 5:69847316-69847338 GCTTTGGCCATTCTGGCTTTTGG + Intergenic
991795082 5:70287648-70287670 GCTTTGGCCATTCTGGCTTTTGG - Intergenic
991803825 5:70404075-70404097 GCTTTGGCCATTCTGGCTTTTGG + Intergenic
991822880 5:70583194-70583216 GCTTTGGCCATTCTGGCTTTTGG - Intergenic
991833516 5:70722439-70722461 GCTTTGGCCATTCTGGCTTTTGG + Intergenic
991887447 5:71287170-71287192 GCTTTGGCCATTCTGGCTTTTGG - Intergenic
996570862 5:124931130-124931152 GTGTAGTCTTCTCTGGCTTTGGG + Intergenic
997210915 5:132076268-132076290 GCGGGGGCCTCCCAGGCGTTGGG + Intergenic
997564073 5:134874040-134874062 TCCTGGGCCTTTCTGGCTCTGGG + Exonic
998200270 5:140113495-140113517 GGGTGGGCCTGTCTAGGTTTGGG + Intronic
998512479 5:142724991-142725013 GCTTGGGCCACGCTGTCTTTTGG - Intergenic
1001490787 5:172153689-172153711 GCCTGGGCCCCTGTGGCTTTAGG - Intronic
1005265674 6:24109778-24109800 GCCAGGGGCTCTCTGGCCTTTGG - Intergenic
1005553905 6:26953952-26953974 GCTTTGGCCATTCTGGCTTTTGG - Intergenic
1006284899 6:33085271-33085293 GCAGGGGACTCTCTGGCTCTGGG + Intronic
1006290083 6:33128138-33128160 GCAGGGGACTCTCTGGCTCTGGG + Intergenic
1008845958 6:55964389-55964411 ACAAGGGCCTCTCTGGATTTGGG - Intergenic
1010552385 6:77238495-77238517 TAGTGGGCCTGTCTGGATTTTGG + Intergenic
1010938289 6:81886733-81886755 TAGTGGGCCTATCTGGATTTTGG - Intergenic
1011715358 6:90099263-90099285 ACCTGGGTCTCTCTGACTTTAGG - Intronic
1012736890 6:102959209-102959231 GCCAGGGGCTCTCTGGCCTTAGG + Intergenic
1018067780 6:160135704-160135726 GACTGGGCCTCTCTGGCATAAGG - Intronic
1020976979 7:15018547-15018569 GCCAGGGGCTCTCGGGCTTTAGG + Intergenic
1024159198 7:46657044-46657066 TAGTGGGCTTCTCTGGATTTAGG - Intergenic
1024858587 7:53811739-53811761 CGGTGGGCCTCTCTGGTTTGGGG - Intergenic
1024984114 7:55181043-55181065 GCCTGGGCCTCTCTGTCATGGGG + Intronic
1025038865 7:55621718-55621740 GTGTGAGCCTCTCTGATTTTTGG + Intergenic
1026047115 7:66913737-66913759 TAGTGGGCCTATGTGGCTTTTGG - Intergenic
1026426423 7:70298869-70298891 ACGTGGAGCTGTCTGGCTTTTGG - Intronic
1027678969 7:81195110-81195132 GCCTGGGGCTCTCAGGCCTTCGG + Intronic
1027685751 7:81277654-81277676 TAGTGGGCCTCTTTGGATTTTGG + Intergenic
1027714574 7:81653751-81653773 GCCTTGGCCTATCTGCCTTTCGG + Intergenic
1029728568 7:102424765-102424787 GCGTGTGCCTCTGGGCCTTTGGG + Intronic
1031643417 7:124193468-124193490 GCCAGGGGCTCTCAGGCTTTTGG - Intergenic
1032349739 7:131149690-131149712 GAGTGGGCCCCACTGGCATTTGG + Intronic
1034123216 7:148645930-148645952 GCCAGGGGCTCTCAGGCTTTTGG + Intergenic
1036452411 8:8880495-8880517 GCGTGTGCCATTCTGCCTTTTGG - Intronic
1037077240 8:14735518-14735540 GCTGGGGCCTCTCAGGCCTTTGG + Intronic
1047844602 8:128792385-128792407 GCCAGGGCCTCTCGGGCCTTTGG - Intergenic
1048539831 8:135332756-135332778 GGGTGGGACTCTCTGGCTGAGGG + Intergenic
1049332588 8:142063172-142063194 GCAGGGGCCTCTCTAGCTTGTGG - Intergenic
1049349458 8:142156529-142156551 GCGTCTGCCGCTCTGGCGTTCGG + Intergenic
1049587577 8:143439154-143439176 GGGTGGGCCTCTCTGGGGTCGGG - Intronic
1052326184 9:27218691-27218713 GGGTGGGTCTCCCTGGCTTTTGG + Intronic
1052365790 9:27610899-27610921 GCGTGGGCCTCTGAGACCTTTGG - Intergenic
1053449131 9:38178925-38178947 GCCTGGGCCTCTGATGCTTTTGG - Intergenic
1055461590 9:76524778-76524800 GCCAGGGCCTCTCAGGCTTTTGG - Intergenic
1055640870 9:78317989-78318011 CCCTGGGGCTCTCAGGCTTTGGG + Intronic
1057211742 9:93204374-93204396 GCTTGGGCCTCCCTGACTCTTGG - Intronic
1058259300 9:102809987-102810009 TAGTGGGCCTATCTGGATTTTGG - Intergenic
1058489539 9:105481853-105481875 GCCTGGACCTCCCTGGCTTAAGG + Intronic
1058543798 9:106039745-106039767 GCTACGGGCTCTCTGGCTTTCGG + Intergenic
1058719385 9:107749905-107749927 GCGTGGGCGTGGCTGGCTTCAGG - Intergenic
1059985760 9:119818836-119818858 GCCGGGGGCTCTCAGGCTTTTGG + Intergenic
1060224149 9:121781211-121781233 CCGGGGGCCTCTGGGGCTTTAGG + Intronic
1060973778 9:127753554-127753576 CCCTGGGCCTCTCTGCCCTTCGG - Intronic
1061044001 9:128154516-128154538 GCCTGAGCCTCTCTGGGCTTGGG - Intergenic
1061544824 9:131298581-131298603 GTGTGGCCCTTTGTGGCTTTGGG - Intronic
1062135427 9:134924701-134924723 TCGTGGGCCTATTTGGATTTCGG + Intergenic
1062321773 9:135993612-135993634 GTGTGGGCCTCGGGGGCTTTGGG + Intergenic
1186267797 X:7850649-7850671 GCCAGGGGCTCTCTGGCCTTTGG + Intergenic
1188609001 X:32072459-32072481 CTGTGGGCCCCTCTGGGTTTTGG - Intronic
1192337705 X:70235865-70235887 GAGTGGGACTCTCTGGCTGCAGG - Intronic
1194591085 X:95800471-95800493 GCTGGGGGCTCTCAGGCTTTTGG + Intergenic
1196718159 X:118829039-118829061 TTGGGGGCCTCTTTGGCTTTGGG - Intergenic
1200555401 Y:4631177-4631199 GAGTGGGCCTCTCTGTCTCAGGG + Intergenic
1200954644 Y:8931072-8931094 GCCAGGGCATCTCTGGCTTCTGG - Intergenic