ID: 1182610100

View in Genome Browser
Species Human (GRCh38)
Location 22:31540451-31540473
Sequence TTTGTGTTACTAGTAAAGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204521
Summary {0: 1, 1: 5, 2: 349, 3: 13370, 4: 190796}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182610094_1182610100 0 Left 1182610094 22:31540428-31540450 CCCACCACCATGCCTGGCTGATT 0: 109
1: 4482
2: 22103
3: 51215
4: 74458
Right 1182610100 22:31540451-31540473 TTTGTGTTACTAGTAAAGACGGG 0: 1
1: 5
2: 349
3: 13370
4: 190796
1182610097_1182610100 -7 Left 1182610097 22:31540435-31540457 CCATGCCTGGCTGATTTTTGTGT 0: 39
1: 1834
2: 27316
3: 65171
4: 117963
Right 1182610100 22:31540451-31540473 TTTGTGTTACTAGTAAAGACGGG 0: 1
1: 5
2: 349
3: 13370
4: 190796
1182610096_1182610100 -4 Left 1182610096 22:31540432-31540454 CCACCATGCCTGGCTGATTTTTG 0: 580
1: 21768
2: 67031
3: 141917
4: 193027
Right 1182610100 22:31540451-31540473 TTTGTGTTACTAGTAAAGACGGG 0: 1
1: 5
2: 349
3: 13370
4: 190796
1182610092_1182610100 24 Left 1182610092 22:31540404-31540426 CCTGAGTAGCTGAGATCACAGGT 0: 50
1: 3141
2: 46465
3: 177325
4: 268008
Right 1182610100 22:31540451-31540473 TTTGTGTTACTAGTAAAGACGGG 0: 1
1: 5
2: 349
3: 13370
4: 190796
1182610095_1182610100 -1 Left 1182610095 22:31540429-31540451 CCACCACCATGCCTGGCTGATTT 0: 203
1: 9387
2: 29562
3: 53695
4: 58371
Right 1182610100 22:31540451-31540473 TTTGTGTTACTAGTAAAGACGGG 0: 1
1: 5
2: 349
3: 13370
4: 190796
1182610090_1182610100 27 Left 1182610090 22:31540401-31540423 CCTCCTGAGTAGCTGAGATCACA 0: 79
1: 5430
2: 71928
3: 163884
4: 242116
Right 1182610100 22:31540451-31540473 TTTGTGTTACTAGTAAAGACGGG 0: 1
1: 5
2: 349
3: 13370
4: 190796

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182610100 Original CRISPR TTTGTGTTACTAGTAAAGAC GGG Intronic
Too many off-targets to display for this crispr