ID: 1182623736

View in Genome Browser
Species Human (GRCh38)
Location 22:31631270-31631292
Sequence GAAGAAGCTGGTCCTCAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 334}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182623736_1182623739 15 Left 1182623736 22:31631270-31631292 CCTCACTGAGGACCAGCTTCTTC 0: 1
1: 0
2: 1
3: 32
4: 334
Right 1182623739 22:31631308-31631330 AAGCCACCCCTGCTAGCCCTAGG 0: 1
1: 0
2: 0
3: 27
4: 319

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182623736 Original CRISPR GAAGAAGCTGGTCCTCAGTG AGG (reversed) Intronic
900380998 1:2383863-2383885 GAGGCTGCTGGTCCACAGTGTGG - Intronic
900383662 1:2398998-2399020 GATGAAGCTGCTCCTGGGTGGGG + Intronic
902043700 1:13510263-13510285 GAAGTAGGTGGTCCTCACGGAGG + Intronic
902251294 1:15155386-15155408 GAAGAAGCTGAGGCTCAGAGAGG - Intronic
902981176 1:20124497-20124519 GAGGAAGCTGGAGCTCAGAGAGG + Intergenic
903101724 1:21035765-21035787 GAAGGGGCGAGTCCTCAGTGAGG + Intronic
903896263 1:26607400-26607422 GAAGAAACTGATGCTCAGAGAGG - Intergenic
904318685 1:29682515-29682537 GAAGAAGCTGAGCCCCAGGGAGG + Intergenic
904344308 1:29857888-29857910 GAGGCAGCTGGTGCTCTGTGAGG + Intergenic
904379108 1:30099537-30099559 GAAGAAACTGCGGCTCAGTGAGG + Intergenic
904429581 1:30453416-30453438 GAAGAAGCTGGGCATGTGTGAGG + Intergenic
904484696 1:30816958-30816980 GAAGAAACTGAGCCTCAGAGAGG - Intergenic
904899447 1:33845257-33845279 GAGGAAGCTGGGGCTCAGAGAGG - Intronic
904999785 1:34659175-34659197 GAAGAAACTGAGCCTCAGAGAGG - Intergenic
905452802 1:38067964-38067986 GAAGAAGCTGAGGCTCAGAGAGG + Intergenic
905595772 1:39205289-39205311 GAAGAAGCTGGTCTGCCCTGGGG + Intronic
906232127 1:44172626-44172648 GCAGAAGCGGGACTTCAGTGTGG + Intergenic
906581292 1:46937108-46937130 GAAGAAGCTGAGCCTCAGGAAGG + Intronic
906602429 1:47141787-47141809 GAAGAAGCTGAGCCTCAGGAAGG - Intronic
906611319 1:47205683-47205705 GGAGGAGCTGGTTTTCAGTGGGG - Intergenic
906612450 1:47212789-47212811 GAAGAAACTGAACCTCAGAGAGG + Intergenic
907356287 1:53877371-53877393 GAGGAAGCTGATGCTCAGTGAGG - Intronic
909041201 1:70654285-70654307 GAAGATGCTGGTCATATGTGTGG - Intergenic
909094561 1:71271125-71271147 AAAGAAGGTGGTCCCCAGAGAGG - Intergenic
909237052 1:73166211-73166233 GAAGCAGCTGGTCATCAGCCTGG + Intergenic
910117015 1:83742637-83742659 ACAGAAGCTGGTGCTGAGTGGGG + Intergenic
911208418 1:95116235-95116257 GAAGAAATTGAGCCTCAGTGAGG + Intergenic
911251983 1:95586842-95586864 GAAGAATCTCGTTCTCAGAGTGG + Intergenic
913500639 1:119469650-119469672 GAAGAAACTGGGGCTCAGAGAGG - Intergenic
913538912 1:119800161-119800183 GAAGAAACTGAGCCTCAGAGAGG - Intronic
913616462 1:120564958-120564980 GAAGCAGCAGGACCTCAGAGAGG + Intergenic
914573815 1:148945953-148945975 GAAGCAGCAGGACCTCAGAGAGG - Intronic
915974500 1:160376033-160376055 GAAAAAGCTGTTGCTCAGGGAGG - Intergenic
916279690 1:163035975-163035997 GAAGTATCTTGACCTCAGTGTGG + Intergenic
916569690 1:166014263-166014285 GGAGAAGCTGGTCCACAATGAGG - Intergenic
916964590 1:169923764-169923786 AAAGAAGATGGTCCTCAGAAGGG + Intronic
917649973 1:177066680-177066702 CATGGAGCTGGTCCTCAATGAGG - Intronic
917730253 1:177867886-177867908 GAAGAAGCTGAGCCACAGAGAGG - Intergenic
920086539 1:203421589-203421611 GTAGATGCTGGGGCTCAGTGGGG + Intergenic
920442928 1:205993462-205993484 GAGGATGCTGGCCCCCAGTGTGG + Exonic
921584498 1:216931412-216931434 GAAGGAGCAGTTTCTCAGTGTGG - Intronic
1062944909 10:1452956-1452978 GCAGAGCCTGGGCCTCAGTGGGG + Intronic
1063971084 10:11381597-11381619 GAAGAACCAGGACCTCAGGGTGG + Intergenic
1064288189 10:14011014-14011036 GAAGAAACTGGTGCTCAGAGGGG + Intronic
1064335154 10:14433734-14433756 GAAGAAAATGGGCCTCAGTCTGG + Intronic
1068750117 10:60582790-60582812 GAAGAAGCTTCTACACAGTGAGG - Intronic
1069869910 10:71526806-71526828 GAGGAAGCTGGGGCTCAGAGAGG + Intronic
1070739285 10:78892125-78892147 GAGGAAGCAGGCCCTCAGAGCGG + Intergenic
1071003990 10:80861091-80861113 GAAGAAACTGGAAATCAGTGAGG + Intergenic
1071237293 10:83663951-83663973 AAAGAAGCTGGTGTTCAGTGAGG - Intergenic
1071914114 10:90271734-90271756 GAAGAAACTGATACTCAGAGAGG - Intergenic
1074183777 10:111084225-111084247 GAAGAAGCAGGGACTCAGAGAGG - Intergenic
1074350011 10:112727562-112727584 TAAAGAGCTGGTCCTCACTGTGG + Intronic
1074471339 10:113729480-113729502 GAAGAAGCAGATCCCCTGTGTGG + Exonic
1074546239 10:114404192-114404214 GAAGGAGGGGGTCGTCAGTGGGG - Intronic
1074819314 10:117166843-117166865 AAAGAAACTGGTGCTCAGAGAGG - Intergenic
1074881852 10:117665749-117665771 GAAGAAACTGATGCTCAGAGAGG + Intergenic
1075084405 10:119404924-119404946 GAAGAGGCTGGTCCAGAATGGGG + Intronic
1076182211 10:128419040-128419062 GCAGGAGCTGGGCCTGAGTGGGG + Intergenic
1076525304 10:131108917-131108939 GAAGAAGCTGCCCCACTGTGGGG - Intronic
1078553122 11:12293965-12293987 GAAGAAGTTAGTCCTCACTCAGG + Exonic
1078781622 11:14444231-14444253 GAAGAAGCTAAACCTCAGAGAGG + Intronic
1079169013 11:18074346-18074368 GAAGAAGCTGGTCTGCATAGAGG - Intronic
1079457910 11:20652668-20652690 TATTATGCTGGTCCTCAGTGTGG + Intronic
1081581068 11:44352370-44352392 GGAGGAGCTGGTTCACAGTGAGG + Intergenic
1082187884 11:49207135-49207157 CAAGCATCTCGTCCTCAGTGTGG - Intronic
1082846305 11:57728485-57728507 GGAGAAGCTCGAACTCAGTGGGG - Intronic
1083607942 11:63990113-63990135 GACCAGGCTGGTGCTCAGTGGGG + Intronic
1083642208 11:64151508-64151530 GCAGTAGGTGCTCCTCAGTGTGG - Intronic
1084442153 11:69180715-69180737 GAAGAGGCTTGTTCTCACTGTGG + Intergenic
1084578306 11:70005287-70005309 GAAGAAGCTGGGGTTCAGAGAGG + Intergenic
1088170484 11:106990671-106990693 GAAGAAGCTGCAGCTCAGGGAGG + Intronic
1088171775 11:107006090-107006112 GAACAAACTGATCCTCAGAGAGG + Intronic
1089752063 11:120659152-120659174 GCAGAATCTGGGTCTCAGTGGGG + Intronic
1089873732 11:121699921-121699943 GAAGATGCTGGTGCTCAGCTTGG + Intergenic
1091862699 12:3800996-3801018 TAAGAAGCTGGTATTCAGTAGGG - Intronic
1092112643 12:5974721-5974743 GAGGAAGCTGGCCTGCAGTGAGG + Intronic
1093129533 12:15373407-15373429 GAAGAAGCAGATCCTAGGTGTGG + Intronic
1093506349 12:19871312-19871334 GAAGAAACTGGGTCTCAGAGAGG - Intergenic
1096841593 12:54383232-54383254 GAGGAAGCTGGTCTCCAGTGAGG - Intronic
1098019385 12:66136573-66136595 GAAAAATGAGGTCCTCAGTGTGG + Intronic
1098904690 12:76149904-76149926 GAAGAAGCTGAGGCTCAGAGAGG + Intergenic
1099611260 12:84874259-84874281 GAAGAAGCTGAAACTCAGAGAGG - Intronic
1100548787 12:95627674-95627696 GAACTAGCTGGTCCTCAGTTTGG - Intergenic
1101850621 12:108399263-108399285 AAAGAAGCTGAGCCTCAGAGAGG + Intergenic
1102202416 12:111066835-111066857 GGAGAAGCTGATGCTCAGAGAGG - Intronic
1102433378 12:112900979-112901001 GAGGAAACTGATACTCAGTGAGG - Intergenic
1102965166 12:117120072-117120094 GAAGAAACTGAGGCTCAGTGAGG - Intergenic
1103739318 12:123080770-123080792 GAAGAAGCTGAAGCTCAGAGAGG - Intronic
1104835280 12:131786347-131786369 GCAGAGGCTGCTCCTCAGGGTGG - Intronic
1104967103 12:132513306-132513328 GAAGGGGTTGGTACTCAGTGGGG + Intronic
1104972621 12:132538902-132538924 GAGGAAGGTGGGCCTCAGTGTGG + Intronic
1105892823 13:24694227-24694249 GGAGAAGCTGGACCTCTGCGAGG - Intronic
1106659592 13:31784729-31784751 GAAGAAGCTGGCCATCAGGTTGG - Intronic
1107235115 13:38159129-38159151 GAAGAGGCTGTTCCTAAGGGAGG + Intergenic
1108244352 13:48499814-48499836 GAAGAACGTGGTCCTCACAGAGG - Intronic
1111453910 13:88454256-88454278 GAAGAAGGTGGTTCCCAGTAAGG - Intergenic
1113331086 13:109328381-109328403 GAGGAAACTGGGCCTCAGCGGGG - Intergenic
1113612776 13:111659502-111659524 GAAGGAGCTGAGCCTCAGAGAGG + Intronic
1114710934 14:24777539-24777561 GAGTGAGCAGGTCCTCAGTGAGG + Intergenic
1114717493 14:24843129-24843151 GAAGAAACTGAGCCTCAGAGAGG - Intronic
1115755732 14:36524792-36524814 GAAGAATCTGCTCCTCTGTCGGG + Intergenic
1116716372 14:48431498-48431520 GAAGAAACTTGACCTCAGAGAGG - Intergenic
1118350217 14:64968344-64968366 GCTGAAGCTAGGCCTCAGTGTGG - Intronic
1118893746 14:69929408-69929430 GAAGAAGCTGAGGCTCAGAGAGG + Intronic
1121465404 14:94112420-94112442 CAAGAATATGGTTCTCAGTGTGG - Intronic
1122144270 14:99679949-99679971 GTAAAAGCTAGTTCTCAGTGGGG - Exonic
1122415461 14:101547557-101547579 GAAGAAGCTGGAGCCCAGAGAGG + Intergenic
1122776590 14:104119565-104119587 GAAGAAACAGGTCCTCCGAGGGG - Intergenic
1124806297 15:32886768-32886790 GCCCAGGCTGGTCCTCAGTGTGG - Intronic
1125443750 15:39731177-39731199 AAAGAAATTGATCCTCAGTGAGG + Intronic
1128222448 15:65978889-65978911 GAAGAAGCTGAGGCTCAGAGAGG - Intronic
1128736466 15:70056580-70056602 GAGGATGCTGGTTCACAGTGGGG - Intronic
1128804697 15:70522113-70522135 GGAGAAGCTGGGGCTCAGAGAGG + Intergenic
1129523113 15:76198169-76198191 GAAGAAGCTGAAGCTCAGAGTGG + Intronic
1129857671 15:78836495-78836517 GAAGAAGCTGAGGCTCAGAGAGG + Intronic
1129923428 15:79340272-79340294 CAAGAAGCTGCTCCTCAGCAGGG + Intronic
1130411209 15:83650286-83650308 GAAGAAGCAGGTCCTGAGACAGG + Intergenic
1132338438 15:101063459-101063481 TGAGAAGCTGCCCCTCAGTGGGG + Intronic
1133114195 16:3566970-3566992 GAAAACGCTGGTTCTCAGAGCGG + Intronic
1134236568 16:12470945-12470967 GAAGAAGCTGAGTCTCAATGTGG + Intronic
1134820888 16:17246581-17246603 GAAGAAACTGATCCTCAGAGAGG - Intronic
1134839260 16:17388509-17388531 GAAGAAGTTGGGGCTCAGGGAGG - Intronic
1137832401 16:51556560-51556582 GAAGAAACTGAAGCTCAGTGAGG + Intergenic
1138309365 16:56010039-56010061 GAAGAAACTGAGGCTCAGTGAGG - Intergenic
1138908869 16:61372074-61372096 GGAGAAGCTGGTGTTCAGTGAGG - Intergenic
1140394989 16:74618731-74618753 GAAGAAGCTGGGGCTGGGTGTGG + Intergenic
1141141101 16:81497359-81497381 GAAGAACTTGGGGCTCAGTGAGG + Intronic
1141977725 16:87528628-87528650 GAAGAAGCTGGGATTCAGAGAGG - Intergenic
1142013949 16:87733724-87733746 GGAGAGGCAGGTCATCAGTGAGG - Intronic
1143954427 17:10657404-10657426 GAAGAAGCTGGTTCTCGGCTTGG - Intergenic
1144676409 17:17165140-17165162 GAAGGAGCAGGACCTCAATGAGG + Intronic
1144952442 17:19001535-19001557 GAAGAAGCTGGTCTCCAGTTTGG - Intronic
1147121568 17:38338160-38338182 AAGGAAGCTGCTCCTCCGTGGGG - Intronic
1148443260 17:47722607-47722629 TGAGAAGCTGGTGCTCAGAGAGG - Intergenic
1149001463 17:51762142-51762164 GAAGAAACTGAGGCTCAGTGAGG + Intronic
1149517024 17:57288488-57288510 GGAGAAGCTGGGACTCTGTGAGG - Intronic
1150493077 17:65587704-65587726 GAAGAAGCTGGTCTCCAGGGTGG + Intronic
1150627055 17:66848523-66848545 GTAGAGGTTTGTCCTCAGTGAGG - Intronic
1150739745 17:67769782-67769804 GAAATGGCTGGTGCTCAGTGGGG - Intergenic
1151151886 17:72095398-72095420 GAACAATCTGGTCCTCAGGAAGG - Intergenic
1151195100 17:72425731-72425753 GAATGAGCTGGTCTTCAGGGTGG + Intergenic
1151745112 17:76007769-76007791 GAAGAAACTGGTGCTCTGGGGGG + Exonic
1152290047 17:79435214-79435236 GAGGAAGCTGGTTCTCAGTTTGG + Intronic
1152705916 17:81843570-81843592 GGAGAAGCTTGTCCCCCGTGTGG - Exonic
1152842372 17:82578299-82578321 GAGGGAGCTGGTGCTCAGGGAGG + Intronic
1153352555 18:4097135-4097157 CAAGAAGGTGGTCCTTAATGTGG - Intronic
1153779179 18:8479065-8479087 GAAGAAACTGGGGCTCAGAGAGG - Intergenic
1156787043 18:40927819-40927841 GAATTAGCTGGTCCTGAGTGAGG - Intergenic
1158465038 18:57682349-57682371 GAGGAAGGTGGTTCTCAGAGAGG + Intronic
1158887976 18:61846944-61846966 GAAGAAGCAGATACTCAGTAAGG - Intronic
1159144990 18:64442594-64442616 CAAGAAGCTGCTCCTCCCTGGGG + Intergenic
1159258300 18:65977044-65977066 GAAGAGTGTGGTCCCCAGTGAGG - Intergenic
1160436673 18:78857203-78857225 GAGGAGGCAGCTCCTCAGTGTGG + Intergenic
1160683277 19:422316-422338 GACGCAGCTGTTCCTCCGTGGGG + Exonic
1160705152 19:526041-526063 GAAGAAGCTGGAAGTCATTGAGG + Intergenic
1161011521 19:1961511-1961533 CCAGGAGCTGGGCCTCAGTGGGG + Intronic
1161930708 19:7337633-7337655 GAGGAAGCTGAGGCTCAGTGAGG - Intergenic
1162346484 19:10121063-10121085 GAAAAAACTGGTCCTCAGGGAGG + Intergenic
1163818178 19:19480671-19480693 GAAGAAACTTGGCCTCATTGAGG + Intronic
1165276772 19:34759972-34759994 GAATACGCTGGTGCTCCGTGAGG + Exonic
1165407067 19:35637533-35637555 GAAGAAGCTGGGCCTGAGATAGG + Exonic
1165912756 19:39239224-39239246 GAAGAAGCTGGTACTCAGAGAGG + Intergenic
1165993278 19:39827730-39827752 CAAGAAGCCTGTCCTCAGTTGGG - Intronic
1166427210 19:42689445-42689467 GAAAAAGCTGTTTCTCAGGGTGG + Intronic
1167119437 19:47507821-47507843 GAGGAAGCTGGGGCTCAGAGAGG + Intronic
1167851468 19:52205693-52205715 GCAGAAGCTGGGACTCAGAGAGG + Intronic
925424548 2:3737646-3737668 GAAGAATCTGGACCTCTGAGAGG - Intronic
925451650 2:3974169-3974191 GAAGAGACTCGTCCTCAGGGGGG - Intergenic
925705764 2:6683491-6683513 GAAGAGGGTGGTCCCCAGTGAGG - Intergenic
926058874 2:9792860-9792882 GAGGAAGCAGGTCCGCAGTGCGG - Intergenic
926464899 2:13175883-13175905 GAAGAGGATGGTCCTCAATGAGG - Intergenic
926719658 2:15950252-15950274 GAGGAAGCTGGTCCTCTGCCTGG + Intergenic
927257649 2:21054214-21054236 GATGGGGCCGGTCCTCAGTGAGG - Intergenic
927265061 2:21137088-21137110 GGAGAAGGAGGTCCCCAGTGAGG + Intronic
929008818 2:37421201-37421223 GAAGAAGCTGAGACTCAGGGAGG + Intergenic
929747782 2:44676725-44676747 GAGGAAGCTGAGGCTCAGTGAGG - Intronic
929859993 2:45668705-45668727 GAGGAAGCTGGAGCTCAGAGAGG - Intronic
930698189 2:54432569-54432591 GCAGAAGCTCTTCCACAGTGAGG - Intergenic
931401812 2:61938238-61938260 CAGGAAGCTGCTCCTCCGTGGGG - Intronic
931486872 2:62702915-62702937 TAAGAAGCTGGGACTCAGAGAGG + Intronic
932684878 2:73860237-73860259 GACAAAGCTGGTCTTCTGTGTGG - Intronic
932986696 2:76734459-76734481 AAACAATCTGGTCCTCACTGTGG + Intergenic
933186168 2:79281287-79281309 CAAGAAGCTGGTCCCCATGGTGG + Intronic
934082774 2:88483571-88483593 GAGGAAGCTGGTCCTCGGAGAGG - Intergenic
935542534 2:104366485-104366507 AAAGAAGCTGGTCTTCAGCATGG - Intergenic
936944045 2:117914697-117914719 GAAGCAGGTGGGCCTCAGTGTGG + Intergenic
937053585 2:118912373-118912395 GAAAAAGCTGGGATTCAGTGAGG - Intergenic
938150756 2:128880297-128880319 GAAGAGGGTGGTTCCCAGTGAGG - Intergenic
939522721 2:143251513-143251535 GAAGAAGCTGGTTTCCAGTTCGG + Intronic
942105441 2:172629204-172629226 GAAGAGGGTGGTCCCCAGCGAGG + Intergenic
944382640 2:199129280-199129302 TGAGATGCTGGTTCTCAGTGTGG + Intergenic
945030416 2:205658056-205658078 GAAGACGTTGGGCCTCAGAGAGG - Intergenic
946184507 2:217972186-217972208 GAAGAAGCTGGGGCTCAGAGAGG + Intronic
946349935 2:219143564-219143586 GAAGAAGTTGAGCCTCAGAGAGG - Intronic
946457360 2:219838291-219838313 GAAGAGGCTGGTGCTCAGGTAGG + Intergenic
946831684 2:223734274-223734296 GAGGAGGCTGGGACTCAGTGAGG - Intergenic
1168780706 20:487302-487324 GAAGAATCTGAGGCTCAGTGTGG + Intronic
1168835644 20:875563-875585 GAAGAAACTGAGGCTCAGTGGGG - Intronic
1169702990 20:8469544-8469566 AAAGAAGCTGGAACTCAGTAGGG - Intronic
1169712453 20:8580142-8580164 GAATTAGCTAGCCCTCAGTGGGG + Intronic
1171093316 20:22306650-22306672 GAAGATGCGGGTCCTGAGTGAGG - Intergenic
1171339203 20:24413878-24413900 TGAGAAGCTGATCCTGAGTGTGG - Intergenic
1172308568 20:33899499-33899521 TAAGAAGCTGGGCCTCAGAGAGG - Intergenic
1173024336 20:39294145-39294167 GAAGAAACTGGTGATCAGAGAGG - Intergenic
1173132858 20:40410978-40411000 GAAGAAGCAGGTATTCAGAGAGG - Intergenic
1173323096 20:42007288-42007310 GAAGCAGGAGGTCCTCAATGGGG + Intergenic
1173755738 20:45514424-45514446 GAAGAAACTGATGCTCAGAGAGG + Intronic
1174083156 20:47985044-47985066 GAAGAAACTGGTTTTCAGAGAGG + Intergenic
1176197301 20:63843453-63843475 GAAGACGCTGGGCAGCAGTGTGG - Intergenic
1176230476 20:64030192-64030214 GAAGGAGCTGGGCCTGAGTGTGG + Intronic
1177073723 21:16545292-16545314 AAAGAAACTGGGCCTCAGTTTGG - Intergenic
1179487093 21:41717313-41717335 GAGGAAGGTGCTCCCCAGTGAGG - Intergenic
1179657302 21:42853269-42853291 GATGAAGTTGGCACTCAGTGTGG - Intronic
1179787486 21:43737982-43738004 TAGGAAGCTGGGCCTCAGAGGGG + Intronic
1180845137 22:18976669-18976691 TCTGAGGCTGGTCCTCAGTGAGG - Intergenic
1181031255 22:20149723-20149745 GAAGAAGATGGTCATCACAGAGG - Exonic
1181159157 22:20946908-20946930 GAAGAAGCTGGTCCATAGCCAGG + Intronic
1181512083 22:23393674-23393696 GAAGAAGATGGTCATCACAGAGG + Intergenic
1182463990 22:30503163-30503185 GAAGAAACTGAGGCTCAGTGGGG + Intronic
1182558437 22:31141357-31141379 GAAGAAACTGAGGCTCAGTGAGG + Intergenic
1182570149 22:31231149-31231171 GAGGAAACTGAGCCTCAGTGAGG - Intronic
1182623736 22:31631270-31631292 GAAGAAGCTGGTCCTCAGTGAGG - Intronic
1182712844 22:32333329-32333351 GAAGGAGCATGACCTCAGTGAGG + Intergenic
1182964961 22:34512298-34512320 GAAGAAACTGGGTCTCAGAGAGG + Intergenic
1183711096 22:39503921-39503943 GAGGAAGCTGGTGCTCAGCGGGG + Intronic
1184161456 22:42699861-42699883 GAAGCAGATGGCCCCCAGTGTGG + Intronic
1184599386 22:45533494-45533516 GAAGATGCTGCCCCTCCGTGGGG + Intronic
1184860859 22:47172729-47172751 GAGGAAGCTGGGCCTCGGGGTGG + Intronic
950450003 3:13060152-13060174 GAACAAGCTGGGGCTCAGAGAGG + Intronic
950873476 3:16249419-16249441 GAAGAAACTGATGCTCAGAGAGG + Intergenic
951701818 3:25504553-25504575 GAAGAAAATGTTCCTCAGAGGGG + Intronic
954212873 3:49108350-49108372 CAAGGAGCTGGCCCTCTGTGTGG + Intronic
954717004 3:52531898-52531920 GAAGAAACTGGGGCTCAGGGAGG + Intronic
955339859 3:58116917-58116939 GTAGAAGCTGTTACTCTGTGAGG - Intronic
955351815 3:58199165-58199187 GCAGAAGCTGGTGATCACTGAGG - Intronic
955625322 3:60912370-60912392 GAATAACCTGGGCCTCAGGGAGG - Intronic
956594540 3:70951380-70951402 GTAGATGCTGGTCACCAGTGGGG - Intergenic
958054080 3:88386829-88386851 GAAAAAGATGGTCATAAGTGAGG + Intergenic
958538377 3:95433670-95433692 GAAGATGGTGGTCTTCAGTAGGG - Intergenic
959090901 3:101901665-101901687 GAGGAAGCTGGGGCTCAGAGAGG + Intergenic
959495916 3:107051729-107051751 GAAGAGGTGGGTCCTGAGTGAGG - Intergenic
960143364 3:114172697-114172719 GAAGAATCTGGAGCTCAGAGAGG - Intronic
960984940 3:123271794-123271816 GAAGAAGCTGTTCCCCACAGAGG + Exonic
961796555 3:129413027-129413049 GAGGAAGCTGGAGCTCAGAGAGG - Intronic
961805146 3:129483885-129483907 GAAGAAACTGATACTCAGGGAGG - Intronic
961905569 3:130259639-130259661 GGAGAAGCTGACTCTCAGTGGGG + Intergenic
962140030 3:132780580-132780602 GGAGAAGCTGGGCTTCAGTGTGG - Intergenic
962165608 3:133044695-133044717 GAAGAAGCTGGTGCTTTGAGAGG + Intronic
964749572 3:160041890-160041912 GAAGAAGCAGGTGATCAGTTAGG + Intergenic
965451903 3:168848196-168848218 GAAGAAGCAGGTCATCTGGGGGG + Intergenic
965843719 3:172937621-172937643 TAAGAAGGTGGTCCACATTGAGG + Intronic
965897968 3:173601126-173601148 GACGAAGCTCGTCCTATGTGTGG + Intronic
966019297 3:175188385-175188407 GAAGAATCTGGCCCTCACGGGGG - Intronic
967471177 3:189863935-189863957 GAAGAAGCTGAGGCTCAGAGGGG - Intronic
968005313 3:195238579-195238601 GAAGAAACTGGGGCTCAGAGAGG - Intronic
968729807 4:2264395-2264417 GAAGTGCTTGGTCCTCAGTGTGG - Intergenic
969261466 4:6036814-6036836 GAAGTAGCTGCTCCTTAGTAAGG - Intronic
969298924 4:6285799-6285821 AGAAAGGCTGGTCCTCAGTGTGG + Intronic
970075975 4:12221160-12221182 GAAGAAGCTGGGGCTGGGTGTGG - Intergenic
972462379 4:39316518-39316540 GAGGAACCTGGTCCTTGGTGGGG - Intronic
975849119 4:78553237-78553259 GAAGAAGCTGGAGCCCAGAGAGG - Intronic
976112773 4:81693838-81693860 GAAGACTCTGGTCCTAAATGGGG + Intronic
977007947 4:91595787-91595809 GCAGCACCTTGTCCTCAGTGTGG + Intronic
979395674 4:120186258-120186280 GAAAAGGCTGGCCTTCAGTGAGG - Intergenic
981286674 4:143026203-143026225 GAAGAAGCAGGGCTTCTGTGTGG - Intergenic
982995631 4:162340706-162340728 AAAGAAGCTGGTTGGCAGTGGGG - Intergenic
988400175 5:30751930-30751952 GCAGTAGCTGTTTCTCAGTGGGG + Intergenic
988641084 5:33041368-33041390 GAAGGAGTGGGTCCCCAGTGAGG - Intergenic
989408688 5:41091891-41091913 GAAGAAGCTGGTACTTATTCTGG - Intergenic
989765283 5:45075705-45075727 AAAGATCCTGGTTCTCAGTGGGG - Intergenic
990873739 5:60461870-60461892 GAATACGCTGGACCTCAGTCTGG + Intronic
991610153 5:68441377-68441399 GAAGTGGCTGTTCCTCAGTGGGG + Intergenic
991724918 5:69526517-69526539 GAAAAACCTTGTACTCAGTGAGG - Intronic
993297021 5:86153561-86153583 AATGAAACTGGCCCTCAGTGGGG + Intergenic
993522547 5:88921190-88921212 GATGAAGCTGGTCCACAGAGAGG - Intergenic
995296361 5:110528682-110528704 GAAGAAAATGGGCCTCAATGGGG + Exonic
996386628 5:122915716-122915738 GTAAAAGCTGGTCTTTAGTGTGG + Intronic
996576358 5:124980586-124980608 GAAAAAGCTGGTGCTGAGGGCGG + Intergenic
997177696 5:131796697-131796719 GCAGCATCTGGTCCTCGGTGGGG - Intronic
997893648 5:137696742-137696764 GAAGAAACTGGTGCTCAAAGGGG - Intronic
998333596 5:141351102-141351124 GAAGAGGCTGGTACTTATTGGGG - Exonic
998377810 5:141702637-141702659 CAGGAAGCTGGTCCTGATTGAGG + Intergenic
998897275 5:146813371-146813393 GAAGAAGCTGCTCCTGAGGTTGG - Intronic
999295575 5:150457717-150457739 GAAGAAGCTGTGGCTCAGAGAGG + Intergenic
1000664179 5:163973962-163973984 GAAGAAGCAGCTCCTGAGTAGGG - Intergenic
1001131319 5:169066012-169066034 GAAGAAACTGAGCCTCAGAGAGG + Intronic
1001617307 5:173053343-173053365 GAAGAAACTGGAACTCAGAGAGG + Intergenic
1001626631 5:173141380-173141402 GAAGATGCTGGTAGGCAGTGGGG + Intergenic
1001818201 5:174689059-174689081 GAAGAAGCTGAGGCTCAGAGAGG + Intergenic
1002084874 5:176768202-176768224 GAGGAAGCTGGGGCTCAGAGAGG + Intergenic
1002324060 5:178394039-178394061 AAGGAAGCAGGTGCTCAGTGTGG + Intronic
1002335886 5:178478063-178478085 GAAGAGGCTGGGCCTGGGTGGGG + Intronic
1002865313 6:1116442-1116464 GAAGGTGCTGGGCATCAGTGTGG + Intergenic
1003311515 6:4973467-4973489 TAGGAAGTTGGTACTCAGTGAGG + Intergenic
1003448227 6:6204941-6204963 GAAGCAGCTGAGCCTCAGAGAGG - Intronic
1006629320 6:35419984-35420006 GAAGAAACTGGTCCTCAGAAAGG + Intronic
1007310224 6:40939438-40939460 GAATAAGTTGGTCCTCAGGCAGG - Intergenic
1007352782 6:41286129-41286151 GAAGAGGCTGGTGCTCATTTTGG - Intronic
1009622403 6:66094651-66094673 GAAGAAGCTGGGCGTCAAAGAGG + Intergenic
1010048569 6:71476422-71476444 TAAGAAGCTTGTAATCAGTGAGG - Intergenic
1010379036 6:75205832-75205854 GGAGAAGCTGGTGCTCGGTGTGG + Exonic
1011035710 6:82972152-82972174 GAAGATGATGGTACTCTGTGAGG - Intronic
1011842325 6:91517056-91517078 GAAGAAGCAAATCATCAGTGAGG + Intergenic
1015854072 6:137604813-137604835 GAAGAAGCTGATGCGCAGAGAGG + Intergenic
1016734836 6:147466783-147466805 CAAGAAACTGGCACTCAGTGGGG - Intergenic
1016997589 6:149971092-149971114 GGAGGAGCAGGCCCTCAGTGAGG + Intronic
1017690404 6:156958229-156958251 GAAAAAGCTGTTCCTAGGTGTGG - Intronic
1017910610 6:158789443-158789465 ACATAAGCTGCTCCTCAGTGTGG + Intronic
1018629914 6:165813121-165813143 GGAGAAGCTGGGGCTCAGGGAGG + Intronic
1021646986 7:22798339-22798361 GAAGATCCTGGTCCCCATTGTGG + Intergenic
1021754308 7:23836203-23836225 GAAGGAGCTGGTCATCATTCTGG + Intergenic
1022528146 7:31051656-31051678 GAAGAAGCTGAAGCTCAGAGAGG + Intergenic
1022954480 7:35368432-35368454 GAAGAAATTGGGCCTCAGGGAGG - Intergenic
1024627513 7:51220632-51220654 AAAGAAAATGTTCCTCAGTGTGG - Intronic
1026772217 7:73209772-73209794 CAAGCCCCTGGTCCTCAGTGGGG + Intergenic
1027013086 7:74763165-74763187 CAAGCCCCTGGTCCTCAGTGGGG + Intergenic
1027074955 7:75182869-75182891 CAAGCCCCTGGTCCTCAGTGGGG - Intergenic
1028574417 7:92331059-92331081 GTAGAAGCTGTTCATCAGTGGGG + Intronic
1028894264 7:96023242-96023264 GGAGAGGATGGTCCTCAGGGAGG - Intronic
1029106402 7:98179850-98179872 CACGCAGCTGGTCCTCAATGTGG - Intronic
1029191767 7:98777065-98777087 GAGGAAGCTGGGGCTCAGGGAGG - Intergenic
1029219118 7:98974061-98974083 GTGGTAGCTGGTCCTCAGTAGGG + Intronic
1029667629 7:102006077-102006099 GAAGTAGCAGGACCCCAGTGGGG + Intronic
1030230661 7:107205313-107205335 GATGAAGCTGGTATTCAGTTGGG - Intronic
1030724110 7:112904938-112904960 GAATTAGCTGGTCCTGAGAGGGG - Intronic
1030923780 7:115425992-115426014 GTAGAAGCTGCTTCTCACTGAGG - Intergenic
1032151875 7:129435609-129435631 GAAGAAACTGGAGCTCAGAGAGG - Intronic
1033157813 7:138971595-138971617 GCAGAAGCTGGCCCTCTGAGGGG + Intronic
1035534050 8:377748-377770 GCGGAGGCTGGTGCTCAGTGGGG - Intergenic
1036673658 8:10811176-10811198 GAAGAAGCTGGGGCTCAGAGAGG + Intronic
1036691623 8:10948178-10948200 GAAGAGGCTGGGCTTCAGAGAGG + Intronic
1038410976 8:27359773-27359795 GAAGAAGCTTGACCTCTGTCTGG - Intronic
1039257005 8:35730499-35730521 GTTGAAGGTGGTACTCAGTGGGG - Intronic
1039829883 8:41204676-41204698 GAAGCAGAAGGTCCGCAGTGAGG + Intergenic
1040316376 8:46263070-46263092 GCAAAAGCTGGGCCGCAGTGTGG + Intergenic
1040871147 8:52101076-52101098 GAAGAGGCTGGGGCTGAGTGCGG + Intergenic
1041601052 8:59717707-59717729 GAATAAGGAAGTCCTCAGTGAGG + Intergenic
1042865475 8:73353291-73353313 GAAGAAACTGCTCCTCAGATGGG + Intergenic
1043423333 8:80122976-80122998 GCAGAAGCAGGTCAGCAGTGGGG + Intronic
1044818985 8:96143428-96143450 GAAGATGGTGGGCCTCAGGGAGG - Exonic
1045323331 8:101098315-101098337 GGAGCAGCAGGTACTCAGTGCGG - Intergenic
1045442463 8:102227987-102228009 GAAGAAGATGGTCCCCAGCGAGG + Intronic
1048277829 8:133080576-133080598 GATGAAGATGGTCCTGAGTTTGG - Intronic
1052790096 9:32867345-32867367 AAAGAAGCTGAACCTCGGTGGGG + Intergenic
1052823665 9:33159596-33159618 GCAGAACCTGGTTCTCAGTTGGG - Intronic
1055261743 9:74444711-74444733 GCAGAAAATGCTCCTCAGTGAGG + Intergenic
1057113088 9:92492842-92492864 GATGATGCTGGGGCTCAGTGAGG - Intronic
1057479261 9:95431722-95431744 GAAGAAGCTGAGGCTCAGAGAGG - Intergenic
1057694644 9:97314549-97314571 GAAGAAGCAGGACCTGGGTGGGG - Intronic
1059751569 9:117252700-117252722 AAAGAAGCTGAAGCTCAGTGAGG + Intronic
1061101835 9:128498068-128498090 GAAGAAACTGAGCCTCAGAGAGG - Intronic
1061315447 9:129792814-129792836 GAGGTAGGTGGTCCTCAGGGAGG - Intergenic
1061367086 9:130177712-130177734 GAGCAAGCTGGTGCTCAGAGAGG - Intronic
1062392234 9:136338418-136338440 GATGAAGCTGGACCCCAGAGAGG + Intronic
1203776619 EBV:76744-76766 GAAGCAACAGGTCCTCAGAGGGG + Intergenic
1186328698 X:8509178-8509200 GAAGATGCTGATTCTCACTGTGG - Intergenic
1186896701 X:14011109-14011131 GGAGAAGCTAGTCCCCAGCGGGG - Intronic
1187240614 X:17509661-17509683 GAAGAAACTGGGACTCAGAGAGG + Intronic
1187371672 X:18714225-18714247 GAAGCAGCTCATGCTCAGTGTGG + Intronic
1188013736 X:25085058-25085080 GAAGAAACTTGGGCTCAGTGAGG - Intergenic
1188582819 X:31735884-31735906 CAAGAAGCTGGTCCTGGTTGAGG - Intronic
1190214865 X:48473363-48473385 GAGGAAGCTGAGACTCAGTGAGG - Intergenic
1190436900 X:50434353-50434375 GAAGAAGTTGGGGCTCAGAGAGG + Intronic
1190476228 X:50830504-50830526 GAAGAAGCTGAGGCTCAGAGAGG - Intergenic
1192562666 X:72137664-72137686 GAAGAAGCTGAGGCTCAGAGAGG - Intronic
1197137154 X:123074792-123074814 GAAGAAACTGGAGCTCAGAGAGG + Intergenic
1197924122 X:131628677-131628699 GAAGAAACTGAAGCTCAGTGAGG - Intergenic